Application of lncRNA MCM3AP-AS1 as diabetic cardiomyopathy biomarker and therapeutic target
By upregulating the expression of lncRNA MCM3AP-AS1 in diabetic cardiomyopathy, inhibiting miR-155-5p activity and promoting DHCR24 expression, it solves the early diagnosis and treatment problems of diabetic cardiomyopathy, provides specific biomarkers and treatment methods, and achieves the inhibition of oxidative stress and apoptosis.
Patent Information
- Application Number
- CN202510783717.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-12
- Publication Date
- 2025-07-11
- Estimated Expiration
- 2045-06-12
AI Technical Summary
The prior art is difficult to early diagnosis and targeted treatment of diabetic cardiomyopathy, and the lack of specific biomarkers and therapeutic drugs, making disease progress difficult to control.
lncRNA MCM3AP-AS1 is used as the active ingredient to inhibit oxidative stress and apoptosis of cardiomyocytes in high sugar and high lipid environments by upregulating their expression. Specifically, the expression of DHCR24 gene is promoted by inhibiting miR-155-5p activity, and lentiviral vectors are used to overexpress lncRNA MCM3AP-AS1, and detection kits are developed to detect its expression levels.
The mechanism of action of lncRNA MCM3AP-AS1 in diabetic cardiomyopathy is revealed, providing a new breakthrough in the diagnosis and treatment of DCM. By inhibiting oxidative stress and apoptosis, specific diagnosis and treatment of DCM are achieved.
Smart Images

Figure CN120284997A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biological medicine technology, and particularly relates to the application of lncRNA MCM3AP-AS1 as a biomarker and therapeutic target for diabetic cardiomyopathy. Background Art
[0002] Diabetes Mellitus (DM) is a complex metabolic disease characterized by chronic hyperglycemia. Its pathological essence lies in insulin secretion deficiency or dysfunction, which in turn leads to disorders in glucose, lipid, and protein metabolism. Uncontrolled blood sugar over a long period can trigger extensive microvascular and macrovascular lesions, affecting the kidneys, retina, nerves, and cardiovascular system. Among them, diabetic cardiomyopathy (DCM) is the leading cause of death in diabetic patients; DCM refers to the heart failure in DM patients with elevated left ventricular end-diastolic pressure, reduced ventricular compliance, and ultimately reduced ventricular ejection fraction, in the absence of other heart failure causes such as coronary atherosclerosis, valvular disease, and hypertension.
[0003] Currently, there are huge challenges in the early diagnosis and targeted treatment of DCM. On the one hand, DCM has an insidious onset and lacks specific symptoms in the early stage of the disease course (such as the stage with preserved left ventricular ejection fraction). Clinical diagnosis highly relies on imaging techniques such as echocardiography and cardiac magnetic resonance. However, these methods are difficult to capture the myocardial injury signals at the molecular level in the initial stage of the disease, resulting in difficulties in early diagnosis. On the other hand, the existing treatment strategies are limited to symptomatic treatment means such as controlling blood sugar and delaying the progression of heart failure (such as ACEI drugs), and there is a lack of specific therapeutic drugs. Therefore, revealing the molecular pathogenesis of DCM and screening biomarkers with dual diagnostic and therapeutic values have become the key to breaking through the clinical bottleneck.
[0004] Long noncoding RNA (lncRNA) is a class of noncoding RNA molecules with a length of more than 200 nucleotides. It has attracted widespread attention due to its complex and diverse regulatory gene expression mechanisms, especially the competitive endogenous RNA (ceRNA) mechanism. The ceRNA mechanism refers to the ability of lncRNA to competitively bind to microRNA (miRNA), inhibit the complementary binding of miRNA to the 3' untranslated region of the target RNA, and thus hinder the degradation of the target mRNA induced by miRNA. Through this mechanism, lncRNA can affect the expression of a variety of pathogenic genes and become a key regulatory molecule for the disease. It is worth mentioning that lncRNA also has tissue specificity and high stability (it can be stably present in body fluids such as blood and saliva), making it a highly potential non-invasive diagnostic marker. Although lncRNA is regarded as a key molecule to break through the diagnosis and treatment difficulties of DCM, its mechanism of action in DCM is still unclear. In addition, MCM3AP-AS1 has been found to be upregulated in a variety of cancers such as colorectal cancer, prostate cancer, and liver cancer. It promotes tumorigenesis by participating in tumor cell proliferation, invasion and migration, and is associated with poor prognosis in patients. It can be used as a biomarker and therapeutic target for a variety of tumors. Recent studies have also found that MCM3AP-AS1 can bind to miR-501-3p, upregulate the expression of cell adhesion molecule 3 (CADM1), enhance cell viability, and thus reduce lipopolysaccharide-mediated myocardial apoptosis, but there are no studies on its role in DCM. To this end, the present invention proposes the use of lncRNA MCM3AP-AS1 as a biomarker and therapeutic target for diabetic cardiomyopathy. Summary of the invention
[0005] The purpose of the present invention is to provide the use of lncRNA MCM3AP-AS1 as a biomarker and therapeutic target for diabetic cardiomyopathy, aiming to solve the problems raised in the above background technology.
[0006] The purpose of the present invention is achieved through the following technical solutions: A composition for regulating oxidative stress and apoptosis of cardiomyocytes, wherein the composition uses lncRNA MCM3AP-AS1 as an active ingredient and inhibits oxidative stress and apoptosis of cardiomyocytes in a high-sugar and high-fat environment by upregulating the expression of lncRNA MCM3AP-AS1.
[0007] Furthermore, the high-sugar and high-fat environment is 33.3 mM glucose and 100 μM palmitic acid.
[0008] Furthermore, the lncRNA MCM3AP-AS1 promotes the expression of the DHCR24 gene by inhibiting the activity of miR-155-5p, thereby achieving the effect of inhibiting oxidative stress and apoptosis of cardiomyocytes.
[0009] Furthermore, the way to inhibit the activity of miR-155-5p includes lncRNA MCM3AP-AS1 binding to miR-155-5p as a competing endogenous RNA.
[0010] Furthermore, the way to promote the expression of lncRNA MCM3AP-AS1 is to infect cells with a lentiviral vector to overexpress lncRNA MCM3AP-AS1.
[0011] A method for in vitro regulation of oxidative stress and apoptosis in cardiomyocytes, applying the above-mentioned composition to cardiomyocytes cultured in a high-glucose and high-fat environment.
[0012] An application of lncRNA MCM3AP-AS1 as a biomarker for detecting diabetic cardiomyopathy.
[0013] A kit for detecting diabetic cardiomyopathy, the kit contains reagents for detecting the expression level of lncRNA MCM3AP-AS1.
[0014] Compared with the prior art, the beneficial effects of the present invention are: The present invention reveals the mechanism of action of lncRNA MCM3AP-AS1 in diabetic cardiomyopathy (DCM), bringing new breakthroughs to the diagnosis and treatment of DCM. Previously, bioinformatics tools were used to screen lncRNAs that might be involved in the development of DCM - MCM3AP-AS1, and it was found that its expression was significantly downregulated in DCM. Further research shows that MCM3AP-AS1 can act as a competing endogenous RNA (ceRNA), competitively binding to miR-155-5p to regulate the expression of DHCR24 (24-dehydrocholesterol reductase). Specifically, MCM3AP-AS1 promotes the expression of DHCR24 by targeting the miR-155-5p / DHCR24 axis, and then enzymatically degrades H2O2, reducing oxidative stress and apoptosis in cardiomyocytes. The elucidation of this molecular mechanism establishes MCM3AP-AS1 as a biomarker with both diagnostic and therapeutic potential, providing a new target and theoretical basis for breaking through the bottleneck of clinical diagnosis and treatment of DCM. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1It is the volcano plot of differentially expressed lncRNAs; among them, A shows the differential expression of lncRNAs between the diabetic patient group and the control group in the GSE95894 dataset; B shows the differential expression of lncRNAs between the diabetic patient group and the control group in the GSE130279 dataset; C shows the differential expression of lncRNAs between the diabetic patient group and the control group in the GSE133225 dataset; D shows the differential expression of lncRNAs between the diabetic patient group and the control group in the GSE163980 dataset; E shows the differential expression of lncRNAs between the heart failure patient group and the control group in the GSE21610 dataset; F shows the differential expression of lncRNAs between the heart failure patient group and the control group in the GSE46224 dataset.
[0016] Figure 2 They are lncRNAs that intersect between diabetic patients and heart failure patients; among them, A are lncRNAs that are upregulated in both diabetic patients and heart failure patients; B are lncRNAs that are downregulated in both diabetic patients and heart failure patients.
[0017] Figure 3 They are the volcano plot and heat map of the differential expression analysis of miRNAs and mRNAs; among them, A is the volcano plot of miRNAs; B is the heat map of miRNAs; C is the volcano plot of mRNAs; D is the heat map of mRNAs.
[0018] Figure 4 It is the schematic diagram of the lncRNA-miRNA-mRNA ceRNA network construction; among them, A shows the interaction relationships based on the ceRNA mechanism among a part of differentially expressed lncRNAs (such as FAM225B, LOC101926887, etc.), miRNAs, and mRNAs; B shows the interaction relationships among another part of differentially expressed lncRNAs (such as LINC00471, MCM3AP-AS1), miRNAs, and mRNAs.
[0019] Figure 5The expression differences of heart-related indicators (NPPA, NPPB, EDN1, ADM) in heart failure patients with high expression of MCM3AP-AS1 and low expression of MCM3AP-AS1; A is the content of NPPA, NPPB, EDN1, and ADM in the low-expression group of LINC00663 (LINC00663_low) and the high-expression group (LINC00663_high); B is the content of NPPA, NPPB, EDN1, and ADM in the low-expression group of LOC100286925 (LOC100286925_low) and the high-expression group (LOC100286925_high); C is the content of NPPA, NPPB, EDN1, and ADM in the low-expression group of FAM225B (FAM225B_low) and the high-expression group (FAM225B_high); D is the content of NPPA, NPPB, EDN1, and ADM in the low-expression group of LINC00471 (LINC00471_low) and the high-expression group (LINC00471_high); E is the content of NPPA, NPPB, EDN1, and ADM in the low-expression group of FAM225A (FAM225A_low) and the high-expression group (FAM225A_high); F is the content of NPPA, NPPB, EDN1, and ADM in the low-expression group of LOC101926887 (LOC101926887_low) and the high-expression group (LOC101926887_high), and G is the content of NPPA, NPPB, EDN1, and ADM in the low-expression group of MCM3AP-AS1 (MCM3AP-AS1_low) and the high-expression group (MCM3AP-AS1_high).
[0020] Figure 6 Schematic diagram of high glucose and high fat inducing oxidative stress and apoptosis in AC16 cardiomyocytes; among them, A is the detection of 4HNE expression by Western blot and the statistical analysis of its relative expression; B is the detection of Cleaved caspase-3 expression by Western blot and the statistical analysis of its relative expression; C is the statistical analysis of the H2O2 content in the control group and the HG+HF group; D is the Hoechst 33342 staining map and apoptosis rate statistics in the control group and the HG+HF group; E is the statistical analysis of the relative expression of MCM3AP-AS1 in the control group and the HG+HF group.
[0021] Figure 7Schematic diagram of overexpression of MCM3AP-AS1 inhibiting oxidative stress and apoptosis in high glucose and high fat-induced AC16 cardiomyocytes; among them, A shows the cell morphology and green fluorescence of the two groups; B shows the relative expression level of MCM3AP-AS1 detected by RT-qPCR; C shows the protein expression of 4HNE and Cleaved caspase-3 detected by Western blot; D shows the statistical result of the relative expression level of 4HNE; E shows the statistical result of the relative expression level of Cleaved caspase-3; F shows the statistical result of the H2O2 content, and G shows the apoptosis of cells stained by Hoechst33342.
[0022] Figure 8 Schematic diagram of the decreased expression of DHCR24 in high glucose and high fat-treated AC16 cardiomyocytes; among them: A shows the average values of heart failure indicators NPPA and MCAM in the DHCR24 low-expression group (DHCR24_low) and the high-expression group (DHCR24_high); B shows the average values of apoptosis indicators CASP10, CASP12, CASP2, BCL211, and APAF1 in the DHCR24 low-expression group and the high-expression group; C shows the relative mRNA expression level of DHCR24 detected by RT-qPCR in AC16 cardiomyocytes; D shows the protein expression of DHCR24 detected by Western blot and its relative expression level statistics.
[0023] Figure 9 Schematic diagram of overexpression of MCM3AP-AS1 promoting the expression of DHCR24; among them, A shows the relative mRNA expression level of DHCR24 in each group of AC16 cardiomyocytes; B shows the protein expression of DHCR24 detected by Western blot in each group; C shows the statistical result of the relative expression level in Figure B.
[0024] Figure 10 Schematic diagram of obtaining AC16 cardiomyocytes with inhibited DHCR24 expression; among them: A shows the relative mRNA expression level of DHCR24 detected by RT-qPCR when 3 DHCR24-siRNAs are transfected into AC16 cardiomyocytes respectively; B shows the protein expression of DHCR24 detected by Western blot and its relative expression level statistics when 3 DHCR24-siRNAs are transfected into AC16 cardiomyocytes respectively; C shows the relative mRNA expression level of DHCR24 detected by RT-qPCR under the condition of overexpressing MCM3AP-AS1; D shows the protein expression of DHCR24 detected by Western blot and its relative expression level statistics under the condition of overexpressing MCM3AP-AS1.
[0025] Figure 11Schematic diagram showing that inhibiting DHCR24 can reverse the protective effect of MCM3AP-AS1 on high glucose and high fat-induced myocardial cell injury; among them, A is the protein expression of oxidative stress index 4HNE and apoptosis index Cleaved caspase-3 detected by Western blot in different treatment groups; B is the bar graph quantifying and statistically analyzing the protein expression level of 4HNE in Figure A; C is the bar graph quantifying and statistically analyzing the protein expression level of Cleaved caspase-3 in Figure A; D is the H2O2 content in different treatment groups; E is the Hoechst33342 staining map of different treatment groups (bright blue nuclei represent apoptotic cells) and the bar graph after counting apoptotic cells.
[0026] Figure 12 Schematic diagram showing that MCM3AP-AS1 targets miR-155-5p to promote the expression of DHCR24; among them: A is the relative expression of miR-155-5p mRNA in each group, reflecting the effects of high glucose and high fat and overexpression of MCM3AP-AS1 on it; B is the relative expression of miR-155-5p mRNA in each group, showing the effect of transfection with mimic-miR-155-5p; C is the relative expression of DHCR24 mRNA in each group; D is the effect of overexpressing miR-155-5p on the luciferase activity of MCM3AP-AS1-WT and MCM3AP-AS1-MT (the left figure in D is the predicted binding site of miR-155-5p and MCM3AP-AS1 on the website, and the right figure is the verification of the binding of MCM3AP-AS1 and miR-155-5p by the dual-luciferase reporter gene experiment); E is the effect of overexpressing miR-155-5p on the luciferase activity of DHCR24-WT and DHCR24-MT (the left figure in E is the predicted binding of miR-155-5p and DHCR24 on the website, and the right figure is the verification of the binding of miR-155-5p and DHCR24 by the dual-luciferase reporter gene experiment).
[0027] Figure 13 Schematic diagram showing that overexpressing miR-155-5p reverses the promoting effect of MCM3AP-AS1 on the expression of DHCR24; among them: A is the relative expression level of DHCR24 mRNA in each group; B is the detection of DHCR24 protein expression in each group by Western blot; C is the relative expression level of DHCR24 in each group.
[0028] Figure 14Overexpression of miR-155-5p reverses the protective effect of MCM3AP-AS1 on high glucose and high fat-induced injury of AC16 cells; wherein: A is the protein expression of 4HNE and Cleaved caspase-3 detected by Western blot in each group; B is the relative expression level of 4HNE in each group; C is the relative expression level of Cleaved caspase-3 in each group; D is the content of H2O2 in each group; E is the Hoechst33342 staining map and the apoptosis rate of cells in each group.
[0029] Figure 15 It is the molecular mechanism diagram of the present invention. Detailed implementation manners
[0030] For a clearer understanding of the technical features, objectives and beneficial effects of the present invention, the technical solutions of the present invention are described in detail below, but it should not be construed as a limitation on the implementable scope of the present invention.
[0031] The present invention proposes a molecular mechanism diagram as Figure 15 shown: MCM3AP-AS1 targets the miR-155-5p / DHCR24 axis and inhibits the occurrence of oxidative stress and apoptosis in diabetic cardiomyopathy.
[0032] The nucleotide sequence of MCM3AP-AS1 is as shown in SEQ ID NO.1:
[0033] The following describes the specific implementation of the present invention in detail in conjunction with specific embodiments.
[0034] Example 1: Screening for differentially expressed lncRNAs, miRNAs, and mRNAs in patients with diabetic cardiomyopathy in the database; 1.1 Screening for differentially expressed lncRNAs in patients with diabetic cardiomyopathy in the database; Perform differential analysis on multiple datasets using the GEO2R bioinformatics tool to screen for lncRNAs with differential expression between the disease group and the control group, and calculate log2(FC) and p-values. There are 66 differentially expressed lncRNAs in GSE95894, of which 46 are up-regulated and 20 are down-regulated in diabetic patients ( Figure 1 in A). There are 388 differentially expressed lncRNAs in GSE130279, of which 283 are up-regulated and 105 are down-regulated in diabetic patients ( Figure 1 in B). There are 422 differentially expressed lncRNAs in GSE133225, with 197 up-regulated and 225 down-regulated in diabetic patients ( Figure 1 in C). There are 223 differentially expressed lncRNAs in GSE163980, of which 117 are up-regulated and 106 are down-regulated in diabetic patients ( Figure 1 in D). There are 247 differentially expressed lncRNAs in GSE21610, with 63 up-regulated and 184 down-regulated in patients with heart failure ( Figure 1 in E). There are 110 differentially expressed lncRNAs in GSE46224, with 66 up-regulated and 44 down-regulated in patients with heart failure ( Figure 1 in F).
[0035] Use a Venn diagram to obtain lncRNAs with consistent expression in the diabetic patient dataset and the heart failure patient dataset. LncRNAs that are up-regulated in both diabetic patients and heart failure patients include LINC00663, LOC101926887, FAM225B, FAM225A, LOC100286925 ( Figure 2 in A), and lncRNAs that are down-regulated in both diabetic patients and heart failure patients include MCM3AP-AS1, LINC00471 ( Figure 2 in B).
[0036] 1.2 Identifying differentially expressed miRNAs and mRNAs; Differential analysis was performed on miRNA and mRNA datasets. There were 70 differential miRNAs in GSE185845, among which 56 were up-regulated and 14 were down-regulated in patients with diabetic ischemic cardiomyopathy. There were 233 differential mRNAs in GSE26887, among which 131 were up-regulated and 102 were down-regulated in patients with diabetic heart failure. Finally, volcano plots ( Figure 3 A and C in Figure 3 ) and heatmaps ( B and D in
[0037] ) were drawn for the differential miRNA genes and mRNA genes. 1.3 Construction of lncRNA-miRNA-mRNA network; The ceRNA network of the screened differential lncRNAs, miRNAs and mRNAs was constructed by Cytoscape. Based on the ceRNA theory, we used the shared miRNAs as connection points, and constructed a ceRNA network with 7 differential lncRNAs (LINC00663, LOC101926887, FAM225B, FAM225A, LOC100286925, MCM3AP-AS1, LINC00471), 70 differential miRNAs and 233 differential mRNAs ( Figure 4 A and B in
[0038] 1.4 lncRNA MCM3AP-AS1 is negatively correlated with heart failure indicators; LINC00663, LOC100286925, LINC00471 and MCM3AP-AS1 are differential lncRNAs in the heart failure dataset GSE21610, and FAM225B, FAM225A and LOC101926887 are lncRNAs in the heart failure dataset GSE46224. The 7 differential lncRNAs screened above that may be related to DCM were divided into high-expression group and low-expression group of lncRNAs by median dichotomy in their respective datasets, and the heart failure indicators NPPA (proBNP A), NPPB (proBNP B), EDN1 (endothelin 1) and ADM (adrenomedullin) were compared for differences between the two groups with high and low lncRNA expression. The results are shown as Figure 5 A-G in p <0.05), and there was no significant difference in ADM. The levels of NPPA and END1 in the high-expression group of LOC100286925 were higher and statistically significant than those in the low-expression group of LOC100286925 ( p<0.05), there was no statistical significance between NPPB and ADM; there was no statistical significance in the contents of NPPA, NPPB, EDN1 and ADM between the high-expression group of FAM225B and the low-expression group; there was no statistical significance in the contents of NPPA, NPPB, EDN1 and ADM between the high-expression group of LINC00471 and the low-expression group; the contents of NPPA, NPPB and ADM in the high-expression group of FAM225A were higher than those in the low-expression group of FAM225A and there was statistical significance ( p <0.05); there was no statistical significance in EDN1; the contents of NPPA and NPPB in the high-expression group of LOC101926887 were high and there was statistical significance (p < 0.05); there was no statistical difference in EDN1 and ADM; compared with the low-expression group of MCM3AP-AS1, the contents of NPPA, NPPB, EDN1 and ADM in the high-expression group of MCM3AP-AS1 were low and there was statistical significance ( p <0.05). Among the 7 differential lncRNAs screened above that may be related to DCM, only MCM3AP-AS1 affected all heart failure indicators, and these indicators predicting heart failure decreased in the high-expression group of MCM3AP-AS1, suggesting that MCM3AP-AS1 may be a molecule protecting cardiac function. Therefore, MCM3AP-AS1 was selected as the research object subsequently. Based on the ceRNA network diagram established in Result 1.3, it was found that MCM3AP-AS1 might play a role by targeting the miR-155-5p / DHCR24 pathway.
[0039] Example 2: lncRNA MCM3AP-AS1 inhibits the occurrence of oxidative stress and apoptosis in cardiomyocytes induced by high glucose and high fat; 2.1 High glucose and high fat induce oxidative stress, apoptosis and decreased expression of MCM3AP-AS1 in AC16 cardiomyocytes; AC16 cardiomyocytes were divided into a control group (Control) and an HG+HF group (high glucose and high fat group). The Control group was treated with 27.8 mmol mannitol as a control; the HG+HF group was treated with high glucose and high fat for AC16 cardiomyocytes: AC16 cardiomyocytes were treated with a combination of 33.3 mmol glucose and 100 μM palmitic acid to establish a model of AC16 cardiomyocyte injury induced by high glucose and high fat. Both groups were cultured in DMEM / F12 medium, and the medium itself contained 5.5 mmol glucose, and the drug treatment time was 48 h. Western blot was used to detect oxidative stress index (4HNE) and apoptosis index (Cleaved caspase-3); a hydrogen peroxide kit was used to detect the content of hydrogen peroxide (H2O2); Hoechst 33342 staining was used to observe the apoptosis of cardiomyocytes.
[0040] The results of Western bolt showed that the oxidative stress index 4HNE and the apoptosis index Cleaved caspase-3 were increased in the HG+HF group (Figure 6 A and B in p <0.05). Detection of H2O2 content showed that the H2O2 content in the HG+HF group was significantly higher than that in the control group ( Figure 6 C in p <0.01). Hoechst33342 staining showed that the number of apoptotic cells with bright blue nuclei in the HG+HF group increased, and the apoptosis rate was significantly higher than that in the control group after statistics ( Figure 6 D in p <0.0001), indicating that high glucose and high fat caused AC16 cardiomyocyte injury, manifested as oxidative stress and apoptosis. And RT-qPCR detection found that the expression of MCM3AP-AS1 was decreased in AC16 cardiomyocytes treated with high glucose and high fat ( Figure 6 E in p <0.05).
[0041] 2.2 Overexpression of MCM3AP-AS1 inhibits oxidative stress and apoptosis induced by high glucose and high fat in AC16 cardiomyocytes; AC16 cardiomyocytes were divided into a transfection empty vector group (LV-Vector) and an LV-MCM3AP-AS1 group. The transfection empty vector group is a cell group transfected with an empty lentiviral vector as a control; the LV-MCM3AP-AS1 group is a cell group in which MCM3AP-AS1 is overexpressed by lentiviral infection. After grouping and treatment, detection was carried out. The results are as Figure 7 shown in A and B. Cells in the transfection empty vector group (LV-Vector) and the LV-MCM3AP-AS1 group both expressed GFP green fluorescent protein, and RT-qPCR detected a significant increase in its mRNA level in the MCM3AP-AS1 group, indicating that AC16 cardiomyocytes with overexpressed MCM3AP-AS1 were obtained ( p <0.0001). To further verify whether overexpression of MCM3AP-AS1 can inhibit oxidative stress and apoptosis, the following grouping experiments were set up: NC group: When the growth density of AC16 cardiomyocytes reached 60%-70%, Vector vector virus solution was added to establish a stable transfected cell line; LV-MCM3AP-AS1 group: When the cell growth density reached 60%-70%, the virus solution of overexpressed MCM3AP-AS1 vector was added to establish a cell line with stable overexpression of MCM3AP-AS1; HG+HF / LV-MCM3AP-AS1: AC16 cells with stable overexpression of MCM3AP-AS1 were treated with high glucose and high fat for 48 h. The results are as Figure 7As shown in C-G, compared with the NC group, the expressions of 4HNE and Cleaved caspase-3 in the HG+HF group were significantly increased, the content of H2O2 was elevated, and more bright blue cells were seen by Hoechst33342 staining; while in the LV-MCM3AP-AS1 group and the HG+HF / LV-MCM3AP-AS1 group, the above-mentioned indexes were significantly lower than those in the HG+HF group ( p <0.05). This indicates that overexpression of MCM3AP-AS1 can effectively inhibit the oxidative stress and apoptosis of AC16 cardiomyocytes induced by high glucose and high fat, suggesting that MCM3AP-AS1 plays an important protective role in regulating cardiomyocytes' response to high glucose and high fat injury.
[0042] Example 3: MCM3AP-AS1 inhibits oxidative stress and apoptosis of AC16 cardiomyocytes by promoting DHCR24 expression; 3.1 DHCR24 expression is decreased in AC16 cardiomyocytes treated with high glucose and high fat; First, the relationship between DHCR24 and heart failure and myocardial apoptosis was analyzed using the diabetes heart failure dataset GSE26887. The data in the dataset were divided into the DHCR24 high-expression group and the DHCR24 low-expression group based on the median value of DHCR24 expression. The results are as Figure 8 shown in A and B. Compared with the DHCR24 low-expression group, the heart failure indexes NPPA and MCAM (melanoma cell adhesion molecule) and the apoptosis indexes CASP10 (caspase 10), CASP12, CASP2, BCL211 (apoptosis promoting factor), and APAF (apoptotic protease activating factor) in the DHCR24 high-expression group were significantly decreased ( p <0.05), suggesting that in patients with diabetes heart failure, DHCR24 may inhibit the occurrence of apoptosis and the progression of heart failure. In AC16 cardiomyocytes, the expression of DHCR24 was detected by RT-qPCR and Western blot. Compared with the control group, the mRNA and protein expressions of DHCR24 in the HG+HF group were significantly decreased ( Figure 8 as shown in C and D, p <0.05).
[0043] 3.2 Overexpression of MCM3AP-AS1 promotes the expression of DHCR24; The expression changes of DHCR24 in AC16 cardiomyocytes were detected by RT-qPCR and Western blot. The results are as Figure 9As shown in A-C. It can be seen that compared with the Control group, the mRNA and protein expression levels of DHCR24 in the HG+HF group were significantly decreased, indicating that high glucose and high fat can induce the down-regulation of DHCR24 expression; compared with the HG+HF group, the mRNA and protein expression levels of DHCR24 in the HG+HF / LV-MCM3AP-AS1 group were significantly increased ( p <0.05), indicating that overexpression of MCM3AP-AS1 can restore the mRNA and protein levels of DHCR24. The above results suggest that MCM3AP-AS1 may play a role by targeting DHCR24.
[0044] 3.3 Obtain AC16 cardiomyocytes with inhibited DHCR24 expression; The present invention designed 3 siRNAs targeting DHCR24 (si-DHCR24-01, si-DHCR24-02, si-DHCR24-03) and a negative control siRNA (si-NC): The sequence of si-DHCR24-01: 5’–UUUCUUGGUGUCCACUUCCAG–3’ (as shown in SEQ ID NO.2); The sequence of si-DHCR24-02: 5’–AUUGCCAAUGCUAUUCAGCUU–3’ (as shown in SEQ ID NO.3); The sequence of si-DHCR24-03: 5’–UUGUCUUCAGAUAGUUCUCCA–3’ (as shown in SEQ ID NO.4); The sequence of si-NC: 5’–ACGUGACACGUUCGGAGAATT–3’ (as shown in SEQ ID NO.5).
[0045] Each siRNA with a concentration of 50 nM was transfected into AC16 cardiomyocytes respectively, and the results are as Figure 10 shown in A and B. si-DHCR24-01, si-DHCR24-02, and si-DHCR24-03 can all decrease the expression of DHCR24 mRNA and protein in AC16 cardiomyocytes ( p <0.001). Then, the 3 DHCR24 siRNAs were transfected into cardiomyocytes overexpressing MCM3AP-AS1 respectively, and the results are as Figure 10 shown in C and D. Compared with HG+HF / LV-MCM3AP-AS1+si-NC, after transfection with si-DHCR24-01, si-DHCR24-02, and si-DHCR24-03; the expression of DHCR24 mRNA and protein both decreased significantly ( p<0.01), indicating that under high glucose and high fat conditions and overexpression of MCM3AP-AS1, all three DHCR24-siRNAs can effectively inhibit DHCR24. Therefore, si-DHCR24-02 and si-DHCR24-03 were randomly selected for subsequent experiments.
[0046] 3.4 Inhibition of DHCR24 can reverse the protective effect of MCM3AP-AS1 on high glucose and high fat-induced myocardial cell injury; To explore whether MCM3AP-AS1 inhibits oxidative stress by promoting the expression of DHCR24, the changes in cell injury after knocking down DHCR24 in AC16 myocardial cells overexpressing MCM3AP-AS1 were observed. The results are as Figure 11 shown in A-E below. Compared with the control group (Control group), the expressions of 4HNE and Cleaved caspase-3 increased, the content of H2O2 increased, and Hoechst33342 staining showed an increase in apoptotic cells in the HG+HF group; compared with the HG+HF group, the above-mentioned injury indexes were significantly decreased in the group with overexpression of MCM3AP-AS1 and stimulation with high glucose and high fat (HG+HF / LV-MCM3AP-AS1 group); however, compared with the HG+HF / LV-MCM3AP-AS1 group, after transfection with si-DHCR24-02 (HG+HF / LV-MCM3AP-AS1+si-DHCR24-02 group) and si-DHCR24-03 (HG+HF / LV-MCM3AP-AS1+si-DHCR24-03 group) in the group overexpressing MCM3AP-AS1, the above-mentioned injury indexes were significantly increased ( p <0.05). This indicates that knocking down DHCR24 can reverse the protective effect of MCM3AP-AS1 on myocardial cells, that is, MCM3AP-AS1 inhibits high glucose and high fat-induced myocardial cell injury by promoting the expression of DHCR24.
[0047] Example 4: MCM3AP-AS1 plays a myocardial cell protective role by targeting miR-155-5p to promote the expression of DHCR24; 4.1 MCM3AP-AS1 targets miR-155-5p to promote the expression of DHCR24; The present invention designed 1 mimic-miR-155-5p for overexpressing miR-155-5p and a negative control mimic-NC: mimic-miR-155-5p sequence: 5’ –CCCCUAUCACGAUUAGCAUUAAUU–3’ (as shown in SEQ ID NO.6); mimic-NC sequence: 5’ –UACUCUUUCUAGGAGGUUGUGAUU–3’ (as shown in SEQ ID NO.7).
[0048] Predictions using the lncBase and Starbase websites revealed that miR-155-5p has binding sites with MCM3AP-AS1 and DHCR24 respectively. First, it was verified that MCM3AP-AS1 regulates the expression of miR-155-5p. As shown in Figure 12 Panel A, compared with the control group (Control group), the HG+HF group induced an upregulation of miR-155-5p expression, while the miR-155-5p expression was significantly inhibited after overexpressing MCM3AP-AS1 (LV-MCM3AP-AS1 group and HG+HF / LV-MCM3AP-AS1 group) ( p <0.01). Transfecting 50 nM of mimic-miR-155-5p into AC16 cardiomyocytes, as shown in Figure 12 Panel B, compared with the mimic-NC group and the Control group, the relative mRNA expression level of miR-155-5p in the mimic-miR-155-5p group was significantly increased (p<0.0001); meanwhile, as shown in Figure 12 Panel C, the relative mRNA expression level of DHCR24 in the mimic-miR-155-5p group was significantly decreased compared with the mimic-NC group and the Control group (p<0.0001). This suggests that MCM3AP-AS1 may regulate the expression of DHCR24 by targeting miR-155-5p.
[0049] To further verify the targeting relationship among the three, a dual-luciferase reporter gene assay was performed. As shown in Figure 12 Panel D, compared with the NC group, overexpressing miR-155-5p (hsa-miR-155-5p group) significantly decreased the luciferase activity of MCM3AP-AS1 wild type (MCM3AP-AS1-WT) (p<0.001), but had no significant effect on the luciferase activity of MCM3AP-AS1 mutant type (MCM3AP-AS1-MT). As shown in Figure 12 Panel E, overexpressing miR-155-5p (hsa-miR-155-5p group) downregulated the luciferase activity of DHCR24 wild type (DHCR24-WT) (p<0.001), while there was no significant change in the DHCR24 mutant type group (DHCR24-MT). These results indicate that miR-155-5p can directly bind to MCM3AP-AS1 and DHCR24 respectively.
[0050] 4.2 Overexpression of miR-155-5p reverses the protective effect of MCM3AP-AS1 on high glucose and high fat-induced AC16 cardiomyocyte injury; AC16 cardiomyocytes overexpressing MCM3AP-AS1 were transfected with 50 nM miR-155-5p and stimulated with high glucose and high fat, and the expression of DHCR24 was detected. The results are shown in Figure 13 A-C. The mRNA and protein expression levels of DHCR24 in the HG+HF group were significantly lower than those in the control group (Control group); in the HG+HF / LV-MCM3AP-AS1 group, overexpression of MCM3AP-AS1 could restore the expression of DHCR24. However, compared with the HG+HF / LV-MCM3AP-AS1+mimic-NC group, the mRNA and protein expression of DHCR24 decreased again in the HG+HF / LV-MCM3AP-AS1+mimic-miR-155-5p group (p<0.05). This indicates that miR-155-5p inhibits the expression of DHCR24 and reverses the promoting effect of MCM3AP-AS1 on the expression of DHCR24.
[0051] To further verify the effect of interfering with miR-155-5p on the myocardial protective effect of MCM3AP-AS1, the changes in cell injury were observed after overexpressing miR-155-5p in AC16 cardiomyocytes overexpressing MCM3AP-AS1. The results are shown in Figure 14 A-E. Compared with the control group (Control group), the expression of oxidative stress index 4HNE and apoptosis index Cleaved caspase-3 increased in the HG+HF group, the content of H2O2 increased, and an increase in apoptotic cells was seen by Hoechst33342 staining; compared with the HG+HF group, overexpression of MCM3AP-AS1 in the HG+HF / LV-MCM3AP-AS1 group could inhibit the increase of the above-mentioned cardiomyocyte oxidative stress and apoptosis indexes; however, transfection of mimic-miR-155-5p in the MCM3AP-AS1 overexpression group (HG+HF / LV-MCM3AP-AS1+mimic-miR-155-5p group) significantly increased the protein expression of 4HNE, Cleaved caspase-3, the content of H2O2 and apoptotic cells, which were higher than those in the HG+HF / LV-MCM3AP-AS1 group. The above results suggest that overexpression of miR-155-5p reverses the protective effect of MCM3AP-AS1 on cardiomyocytes, indicating that MCM3AP-AS1 inhibits high glucose and high fat-induced cardiomyocyte injury by targeting miR-155-5p to promote the expression of DHCR24.
[0052] The above are only the preferred embodiments of the present invention. It should be noted that for those skilled in the art, without departing from the concept of the present invention, several modifications and improvements can be made, which should also be regarded as the protection scope of the present invention, and these will not affect the implementation effect of the present invention and the practicality of the patent.
Claims
1. A composition for regulating oxidative stress and apoptosis of cardiomyocytes, characterized in that, The composition uses lncRNA MCM3AP-AS1 as the active ingredient, and by upregulating the expression of lncRNA MCM3AP-AS1, inhibits oxidative stress and apoptosis of cardiomyocytes in a high-glucose and high-fat environment.
2. The composition according to claim 1, characterized in that, The high-glucose and high-fat environment is 33.3 mM glucose and 100 μM palmitic acid.
3. The composition according to claim 1, characterized in that, The lncRNA MCM3AP-AS1 promotes the expression of the DHCR24 gene by inhibiting the activity of miR-155-5p, achieving the effect of inhibiting oxidative stress and apoptosis of cardiomyocytes.
4. The composition according to claim 3, wherein The method of inhibiting the activity of miR-155-5p includes lncRNA MCM3AP-AS1 binding to miR-155-5p as a competing endogenous RNA.
5. The composition according to claim 3, wherein The method of promoting the expression of lncRNA MCM3AP-AS1 is to infect cells with a lentiviral vector to overexpress lncRNA MCM3AP-AS1.
6. A method for in vitro regulation of oxidative stress and apoptosis of cardiomyocytes, characterized in that, The composition according to any one of claims 1-5 is applied to cardiomyocytes cultured in a high-glucose and high-fat environment.
7. Use of lncRNA MCM3AP-AS1 as a biomarker for detecting diabetic cardiomyopathy.
8. A kit for detecting diabetic cardiomyopathy, characterized in that, The kit contains reagents for detecting the expression level of lncRNA MCM3AP-AS1.
Citation Information
Patent Citations
Application of miR-144 and inhibitor thereof
CN104548134A
Long-chain non-coding RNA and application thereof in diagnosis and treatment of hepatocellular carcinoma
CN113265466A
Construction method and application of ceRNA regulatory network in Exo-LT, fatty tumor tissue judgment method and detection product
CN117305459A
Effect and application of HSP22 in relieving diabetic cardiomyopathy
CN118236518A