Multi-probe primer group, application thereof and kit

Abstract

The invention belongs to the field of biology, and discloses a multiple primer probe set and application thereof. Wherein the multiple primer probe group comprises corresponding primers and probes for detecting seven respiratory tract infection pathogens including canine distemper virus, canine adenovirus type 2, canine parainfluenza virus, canine influenza virus, canine respiratory tract coronavirus, new coronavirus and bordetella bronchiseptica, and the invention also discloses a kit for detecting the respiratory tract infection pathogens including canine distemper virus, canine adenovirus type 2, canine parainfluenza virus, canine influenza virus, canine respiratory tract coronavirus, new coronavirus and bordetella bronchiseptica. The kit is composed of a qPCR reaction solution A1, a qPCR reaction solution A2, an enzyme system mixture, a positive quality control product and a negative quality control product. In the application, the multiple qPCR kit is simple to operate and short in consumed time, the seven different common respiratory tract infection pathogens can be detected at one time through a two-tube reaction system, and the lowest detectable concentration of the seven respiratory tract infection pathogens is 0.1 copies / uL, so that the kit is suitable for clinical rapid detection of the respiratory tract pathogens; and timely and correct treatment aiming at infected pathogens is facilitated.

Description

Technical Field

[0001] The present application relates to the field of biology, and particularly relates to a multiplex probe primer set and its application and kit. Background Art

[0002] In veterinary clinical diagnosis, canine respiratory diseases are relatively common, occurring throughout the year, with fewer cases in summer and the highest incidence during periods of frequent alternation between hot and cold weather. Among them, canine infectious respiratory disease (CIRD) is an acute and highly contagious disease caused by multiple infectious pathogens. The pathogens of this disease involve traditional canine parainfluenza virus (CPIV), canine adenovirus (CAV), canine distemper virus (CDV), Bordetella bronchiseptica (Bb), etc., and there are also emerging pathogens related to canine infectious respiratory diseases such as canine influenza virus (CIV), canine respiratory coronavirus (CRCov), etc. Many pathogens may not be as non-infectious to humans as previously thought, and they may also develop this ability in animals or humans. It is precisely because the monitoring means at the animal-to-human transmission interface are very scarce that it provides an opportunity for the virus to evolve in an unpredictable and unforeseeable manner. At the same time, due to the general lack of immunity in the population to newly emerging viruses and the generally lack of timely and effective vaccines and drugs. Therefore, strengthening the research on pathogen differential diagnosis technology, developing multiplex detection technology, improving the ability to detect pathogenic microorganisms, and achieving the goal of moving the checkpoint forward are important links in the prevention and control of various diseases or epidemics.

[0003] Chinese Patent Application No. 202211275201.3 discloses primers and probes for the dual TaqMan fluorescence quantitative PCR of canine distemper virus (CDV) and canine coronavirus (CCov), and the primers and probes for canine distemper virus (CDV) and canine coronavirus (CCov) are as follows:

[0004] CDV-F: AAATCAACGGACCTAAATTAACTGG;

[0005] CDV-R: TCATCTGCCTCAGAATCCAAAC;

[0006] CDV-Probe: HEX-ACTCTGTTTGTGGTCTTACATTTGC-BHQ1;

[0007] CCoV-F: GGTGACAGCGATCTCGTTGC;

[0008] CCoV-R: CTTCAATCTGGTCGCCATCTTC;

[0009] CCoV-Probe: HEX-CATTCTGTTTGGAAGCTATTGGAC-BHQ1.

[0010] This method can detect two different pathogens in a single sample simultaneously, and has the advantages of strong specificity, high sensitivity, simple operation and few opportunities for aerosol contamination, providing technical support for the epidemiological investigation and differential diagnosis of viral diarrhea in fur animals.

[0011] Chinese Patent Application No. 201911179200.7 discloses a quadruple real-time fluorescence quantitative PCR detection method for canine adenovirus type II (CAV-II), canine distemper virus (CDV), canine parvovirus (CPV) and canine parainfluenza virus (CPIV). Detection is carried out based on primers and probes for canine adenovirus type II, canine distemper virus, canine parvovirus and canine parainfluenza virus. The primers and probes are as follows:

[0012] CAV2-F: GATGTAAATGACCAGTCCTTTGC;

[0013] CAV2-R: AGTAGGGGTCGTAAGGTGAGC;

[0014] CAV2-P: GTCTTCTGCCAACATGCTTTATCCC;

[0015] CDV-F: AGAAACAAGAGGAGCAAAAAAACTG;

[0016] CDV-R: TCAATGCTTGGATCTAGAGGTAATG;

[0017] CDV-P: CCTTTGGAGGAGGACAGTTGCCTTCTTAT;

[0018] CPV-F: TGAACTTGCTACAGGGACATTTT;

[0019] CPV-R: ATTTCCCATTTGAGTTACACCAC;

[0020] CPV-P: ATGGCAAACAAATAGAGCATTGGGCTTACC;

[0021] CPIV-F: CATATGAGCGATTCACACTCACTC;

[0022] CPIV-R: CATTACTGAGAACAATCCGTAGGC;

[0023] CPIV-P: ACTGCAAGATCAGAGTGAGGAAGGTACAATCC.

[0024] The detection operation of this kit is simple, with strong specificity, high sensitivity and good repeatability. It can not only be used for qualitative differential detection of canine adenovirus type II, canine distemper virus, canine parvovirus and canine parainfluenza virus, but also achieve accurate quantification, and can be applied in quality control and rational vaccine formulation during vaccine production.

[0025] The above two schemes respectively propose detection methods for simultaneously detecting two pathogens and simultaneously detecting four pathogens, and both can identify them quickly and accurately.

[0026] The problem to be solved by this scheme: how to produce a multiplex qPCR kit that can simultaneously detect more pathogens. Summary of the Invention

[0027] The purpose of this application is to provide a multiplex probe primer set and its application, as well as a kit, to solve the technical problems that the existing detection of canine respiratory pathogens is mainly single detection, which is time-consuming and cannot simultaneously achieve rapid and accurate detection and identification of multiple pathogens, and to cope with the potential threats of canine respiratory pathogens in clinical practice.

[0028] To achieve the above purpose, this application discloses a multiplex primer probe set, which is characterized by including a first primer set, a first probe, a second primer set, a second probe, a third primer set, a third probe, a fourth primer set, a fourth probe, a fifth primer set, a fifth probe, a sixth primer set, a sixth probe, a seventh primer set, and a seventh probe;

[0029] The first primer set and the first probe are designed from the specific gene fragment of canine distemper virus;

[0030] The second primer set and the second probe are designed from the specific gene fragment of canine adenovirus type 2;

[0031] The third primer set and the third probe are designed from the specific gene fragment of canine parainfluenza virus;

[0032] The fourth primer set and the fourth probe are designed from the specific gene fragment of canine influenza virus;

[0033] The fifth primer set and the fifth probe are designed from the specific gene fragment of canine respiratory coronavirus;

[0034] The sixth primer set and the sixth probe are designed from the specific gene fragment of novel coronavirus;

[0035] The seventh primer set and the seventh probe are designed from the specific gene fragment of Bordetella bronchiseptica.

[0036] Preferably, the first primer set includes a first forward primer and a first reverse primer. The nucleotide sequence of the first forward primer is as shown in SEQ ID NO: 1, the nucleotide sequence of the first reverse primer is as shown in SEQ ID NO: 2, and the nucleotide sequence of the first probe is as shown in SEQ ID NO: 3;

[0037] The second primer set includes a second forward primer and a second reverse primer. The nucleotide sequence of the second forward primer is as shown in SEQ ID NO: 4, the nucleotide sequence of the second reverse primer is as shown in SEQ ID NO: 5, and the nucleotide sequence of the second probe is as shown in SEQ ID NO: 6;

[0038] The third primer set includes a third forward primer and a third reverse primer. The nucleotide sequence of the third forward primer is as shown in SEQ ID NO: 7, the nucleotide sequence of the third reverse primer is as shown in SEQ ID NO: 8, and the nucleotide sequence of the third probe is as shown in SEQ ID NO: 9;

[0039] The fourth primer set includes a fourth forward primer and a fourth reverse primer. The nucleotide sequence of the fourth forward primer is as shown in SEQ ID NO: 10, the nucleotide sequence of the fourth reverse primer is as shown in SEQ ID NO: 11, and the nucleotide sequence of the fourth probe is as shown in SEQ ID NO: 12;

[0040] The fifth primer set includes a fifth forward primer and a fifth reverse primer. The nucleotide sequence of the fifth forward primer is as shown in SEQ ID NO: 13, the nucleotide sequence of the fifth reverse primer is as shown in SEQ ID NO: 14, and the nucleotide sequence of the fifth probe is as shown in SEQ ID NO: 15;

[0041] The sixth primer set includes a sixth forward primer and a sixth reverse primer. The nucleotide sequence of the sixth forward primer is as shown in SEQ ID NO: 16, the nucleotide sequence of the sixth reverse primer is as shown in SEQ ID NO: 7, and the nucleotide sequence of the sixth probe is as shown in SEQ ID NO: 18;

[0042] The seventh primer set includes a seventh forward primer and a seventh reverse primer. The nucleotide sequence of the seventh forward primer is as shown in SEQ ID NO: 19, the nucleotide sequence of the seventh reverse primer is as shown in SEQ ID NO: 20, and the nucleotide sequence of the seventh probe is as shown in SEQ ID NO: 21.

[0043] Preferably, the 5' end of the first probe is labeled with a fluorescent group HEX, and the 3' end is labeled with a quenching group BHQ1;

[0044] The 5'-end of the second probe is labeled with a fluorescent group FAM, and the 3'-end is labeled with a quenching group BHQ1;

[0045] The 5'-end of the third probe is labeled with a fluorescent group FAM, and the 3'-end is labeled with a quenching group BHQ1;

[0046] The 5'-end of the fourth probe is labeled with a fluorescent group HEX, and the 3'-end is labeled with a quenching group BHQ1;

[0047] The 5'-end of the fifth probe is labeled with a fluorescent group CY5, and the 3'-end is labeled with a quenching group BHQ3;

[0048] The 5'-end of the sixth probe is labeled with a fluorescent group Texas Red , and the 3'-end is labeled with a quenching group BHQ2;

[0049] The 5'-end of the seventh probe is labeled with a fluorescent group CY5, and the 3'-end is labeled with a quenching group BHQ3.

[0050] In addition, the present application also discloses the use of the multiplex primer probe set as described above in the preparation of a multiplex qPCR kit.

[0051] In addition, the present application also discloses a kit, which includes a qPCR reaction solution A1 and a qPCR reaction solution A2 containing the multiplex probe primer set according to any one of claims 1-3;

[0052] Among them, the qPCR reaction solution A1 contains multiplex qPCR primers and probes for detecting canine adenovirus type 2, canine influenza virus, Bordetella bronchiseptica, and novel coronavirus;

[0053] The qPCR reaction solution A2 contains multiplex qPCR primers and probes for detecting canine distemper virus, canine parainfluenza virus, and canine respiratory coronavirus.

[0054] Preferably, the concentrations of the primers and probes contained in the qPCR reaction solution A1 and the qPCR reaction solution A2 are both 0.1-1 μM.

[0055] Preferably, it further includes an enzyme system mixture, a positive control product, and a negative control product.

[0056] Preferably, the enzyme system mixture is dNTPs, Taq enzyme, and MMLV enzyme, and the concentration of dNTPs is 0.2-0.4 mM, the concentration of Taq enzyme is 2.5-10 U, and the concentration of MMLV enzyme is 2.5-10 U;

[0057] The positive control product is a plasmid containing the target gene to be measured;

[0058] The negative control product is sterilized water.

[0059] Preferably, the dNTPs in the enzyme mixture are composed of five substances: dATP, dUTP, dCTP, dGTP, and dTTP, and the concentration ratio of dATP:dUTP:dCTP:dGTP:dTTP is 1-3:2-4:1-3:1-3:1.

[0060] Preferably, the minimum detectable concentration of the kit for seven pathogens, namely canine distemper virus, canine adenovirus type 2, canine parainfluenza virus, canine influenza virus, canine respiratory coronavirus, SARS-CoV-2, and Bordetella bronchiseptica, is 0.1 copies / uL.

[0061] The beneficial effects of this application are:

[0062] This application provides a multiplex qPCR kit that can simultaneously detect canine distemper virus (CDV), canine adenovirus type 2 (CAV-2), canine parainfluenza virus (CPIV), canine influenza virus (CIV), canine respiratory coronavirus (CRcoV), SARS-CoV-2, and Bordetella bronchiseptica (Bb), and has the advantages of good detection specificity, high sensitivity, and good repeatability. Using the kit to detect canine distemper virus (CDV), canine adenovirus type 2 (CAV-2), canine parainfluenza virus (CPIV), canine influenza virus (CIV), canine respiratory coronavirus (CRcoV), SARS-CoV-2, and Bordetella bronchiseptica (Bb) is simple in operation and time-consuming, and the above six common respiratory infection pathogens can be detected at one time through a two-tube reaction system, and the detection results are accurate, which is suitable for the rapid clinical detection of respiratory pathogens and helps for timely and correct treatment of the infected pathogens. Description of the Drawings

[0063] Figure 1 For detecting the applicable concentration range of qPCR primers and probes in reaction solution A1;

[0064] Figure 2 For detecting the applicable concentration range of qPCR primers and probes in reaction solution A2

[0065] Figure 3 For the CDV multiplex real-time fluorescence quantitative PCR amplification curve and standard curve;

[0066] Figure 4 For the CAV-2 multiplex real-time fluorescence quantitative PCR amplification curve and standard curve;

[0067] Figure 5 For the CPIV multiplex real-time fluorescence quantitative PCR amplification curve and standard curve;

[0068] Figure 6 are the CIV multiplex real-time fluorescence quantitative PCR amplification curve and standard curve;

[0069] Figure 7 are the CRCOV multiplex real-time fluorescence quantitative PCR amplification curve and standard curve;

[0070] Figure 8 are the SARS-COV-2 multiplex real-time fluorescence quantitative PCR amplification curve and standard curve;

[0071] Figure 9 are the Bb multiplex real-time fluorescence quantitative PCR amplification curve and standard curve;

[0072] Figure 10 is the amplification curve for the accuracy test of reaction solution A1

[0073] Figure 11 is the amplification curve for the accuracy test of reaction solution A2;

[0074] Figure 12 is the primer specificity melting curve;

[0075] Figure 13 is the detection comparison result between the single qPCR reaction system and the multiplex qPCR reaction system described in Example 2. Detailed implementation manners

[0076] In the description of this application, it should be noted that for those not specifying specific conditions in the examples, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. For reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0077] Example 1

[0078] 1. Design of multiplex qPCR primers and probes and establishment of detection method

[0079] In this application, by comparing the sequences of canine distemper virus (CDV), canine adenovirus type 2 (CAV-2), canine parainfluenza virus (CPIV), canine influenza virus (CIV), canine respiratory coronavirus (CRcoV), severe acute respiratory syndrome coronavirus 2 (SARS-COV-2), and Bordetella bronchiseptica (Bb), through processes such as primer design, experimental verification and screening, and adjustment and re-verification, a set of multiplex qPCR primers and probes for simultaneous detection were obtained. The primer and probe sequences are shown in Table 1, and the corresponding detection method was established:

[0080] Table 1 Multiplex qPCR primer and probe sequences

[0081]

[0082]

[0083] 2. Establishment of Detection Method

[0084] Based on the multiplex qPCR primers and probes shown in Table 1, the present application constructed corresponding detection methods by using plasmids containing the target genes of canine distemper virus (CDV), canine adenovirus type 2 (CAV-2), canine parainfluenza virus (CPIV), canine influenza virus (CIV), canine respiratory coronavirus (CRcoV), severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and Bordetella bronchiseptica (Bb). The primers and probes shown in Table 1 were divided into two groups, and the above seven different respiratory infection pathogens were detected at one time through a two-tube reaction system.

[0085] The reaction system is as follows: 20 μL of qPCR reaction solution A1 or qPCR reaction solution A2, and 5 μL of nucleic acid of the sample to be tested. Among them, the qPCR reaction solution A1 contains multiplex qPCR primers and probes for detecting canine adenovirus type 2 (CAV-2), canine influenza virus (CIV), Bordetella bronchiseptica (Bb), and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), as well as a qPCR reaction buffer; the qPCR reaction solution A2 contains multiplex qPCR primers and probes for detecting canine distemper virus (CDV), canine parainfluenza virus (CPIV), and canine respiratory coronavirus (CRcoV), as well as a qPCR reaction buffer.

[0086] The reaction program is as follows: 50 °C for 2 min, 95 °C for 5 min, 1 cycle; 95 °C for 5 sec, 60 °C for 35 sec (collect fluorescence), 45 cycles.

[0087] The present application also optimized the concentrations of the primers and probes in the qPCR reaction solution A1 and qPCR reaction solution A2. Under the condition that the concentrations of other components remained unchanged, the concentrations of the qPCR primers and probes in the qPCR reaction solution A1 and qPCR reaction solution A2 were respectively diluted to 0.1 μM, 0.5 μM, and 1 μM for qPCR detection to find the applicable concentrations for qPCR detection.

[0088] As Figure 1-2 shown, in the constructed reaction system, the applicable concentration range of the multiplex qPCR primers and probes is 0.1 - 1 μM; they are all applicable within the above concentration range and the detection efficiencies have little difference.

[0089] Example 2

[0090] Multiplex qPCR Kit for Detecting 7 Kinds of Respiratory Pathogens

[0091] Based on the multiplex qPCR primers, probes and detection methods described in Example 1, the present application also provides a usable multiplex qPCR kit.

[0092] 1. Composition of the kit

[0093] The multiplex qPCR kit for detecting multiple respiratory pathogens includes qPCR reaction solution A1, qPCR reaction solution A2, enzyme mixture, positive control and negative control.

[0094] Among them, qPCR reaction solution A1 contains multiplex qPCR primers and probes for detecting canine adenovirus type 2 (CAV-2), canine influenza virus (CIV), Bordetella bronchiseptica (Bb), and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) (shown in Table 1) and qPCR reaction buffer;

[0095] qPCR reaction solution A2 contains multiplex qPCR primers and probes for detecting canine distemper virus (CDV), canine parainfluenza virus (CPIV), and canine respiratory coronavirus (CRcoV) (shown in Table 1) and qPCR reaction buffer;

[0096] The qPCR reaction buffer has a MgCl2 concentration of 2 - 5 mM, a KCL concentration of 20 - 50 mM, and a Tris-HCL concentration of 20 - 50 mM;

[0097] The enzyme mixture contains dNTPs, Taq enzyme and MMLV enzyme. The concentration of dNTPs is 0.2 - 0.4 mM. The concentration ratio of dATP:dUTP:dCTP:dGTP:dTTP in the dNTPs is 2:3:2:2:1. The concentration of Taq enzyme is 2.5 - 10 U, and the concentration of MMLV enzyme is 2.5 - 10 U;

[0098] The positive control is a plasmid containing the target gene to be measured;

[0099] The negative control is sterilized water.

[0100] 2. Usage method of the kit

[0101] The present application also provides a usage method of the kit, including the following steps:

[0102] (1) Extract nucleic acid from the sample to be tested; in the examples of the present application, the reagent used to extract sample nucleic acid is a nucleic acid extraction or purification reagent (registration number: Su Xi Bei 20190009) produced by Wuxi Bioteke Biotechnology Co., Ltd. The positive control and negative control are simultaneously involved in the extraction;

[0103] (2) Perform qPCR reaction; Take 10 μL of the nucleic acid sample obtained by extraction, add qPCR reaction solution A1 or qPCR reaction solution A2 (17 μL) and enzyme system mixture (3 μL), and perform amplification reaction in a real-time fluorescence PCR instrument; The reaction program is: 50 °C, 2 min, 95 °C, 5 min, 1 cycle; 95 °C, 5 sec, 60 °C, 35 sec (collect fluorescence), 45 cycles;

[0104] (3) Result determination; Sequentially select FAM, HEX, Texas Red, and Cy5 for the fluorescence channels. After qPCR, judge the negativity and positivity of the corresponding pathogen nucleic acid through the curves and Ct values of different fluorescence channels;

[0105] When the Ct value corresponding to each channel ≤ the positive judgment value and the amplification curve has an obvious exponential growth, the detection result of the corresponding channel is judged as positive; When 35 ≤ Ct value ≤ 40 for each channel and the amplification curve is not obvious, the detection of the corresponding channel needs to be repeated. If the result is still judged as positive, when Ct value > 40 or there is no Ct value, the corresponding channel is judged as negative; Specifically, as shown in Table 2:

[0106] Table 2 Determination Results of the Kit

[0107]

[0108]

[0109] If 35 < Ct value < 40, repeated verification should be carried out. If it holds for multiple times, it is positive, and the Ct values are all less than those of the negative control.

[0110] Example 3 Sensitivity Test

[0111] In this example, the detection sensitivity of the kit described in Example 2 was tested. As Figures 3-9 shown, the plasmids of canine distemper virus (CDV), canine adenovirus type 2 (CAV-2), canine parainfluenza virus (CPIV), canine influenza virus (CIV), canine respiratory coronavirus (CRcoV), severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and Bordetella bronchiseptica (Bb) with known values were used as the initial samples, and were respectively diluted to between 10 2 、10 3 、10 4 、10 5 、10 6 and 10 7 copies / μL as the samples to be tested, and sensitivity detection was carried out. The reaction system and reaction program were referred to Example 2, and the negativity and positivity of the corresponding pathogen nucleic acid were judged through the curves and Ct values of different fluorescence channels.

[0112] In Example 2 of the present application, the plasmids of canine distemper virus (CDV), canine adenovirus type 2 (CAV-2), canine parainfluenza virus (CPIV), canine influenza virus (CIV), canine respiratory coronavirus (CRcoV), severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and Bordetella bronchiseptica (Bb) were diluted to 10 1 、1、0.1 copies / uL respectively for sensitivity detection, and the test results are shown in Table 3. It can be seen from the test results that when the sample concentration is above 0.1 copies / uL, the Ct values of the samples of canine distemper virus (CDV), canine adenovirus type 2 (CAV-2), canine parainfluenza virus (CPIV), canine influenza virus (CIV), canine respiratory coronavirus (CRcoV), severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and Bordetella bronchiseptica (Bb) are all ≤ 40, and the amplification curves have obvious exponential growth, and the detection results are reliable, and 0.1 copies / uL can also be detected.

[0113] Table 3 Sensitivity Test

[0114]

[0115]

[0116] Example 4 Specificity Test

[0117] To detect the detection specificity of the method described in Example 2 of the present application, other common pathogens and physiological saline were selected in the present application for specificity testing. In the present application, physiological saline, parvovirus, and rabies virus were used as specific reference products to test the detection specificity of the kit constructed in Example 2 of the present application.

[0118] The detection results of other common pathogens and physiological saline are shown in Table 4. It can be seen therefrom that there is no amplification curve when the kit described in the present application detects other common pathogens, indicating that the detection specificity of the kit described in the present application is good and can be specifically detected.

[0119] Table 4 Specificity Test

[0120]

[0121]

[0122] Note: “+” indicates specificity, and “-” indicates no specificity

[0123] Example 5 Precision Test

[0124] In this example, the detection precision of the kit described in Example 2 was tested. After the quantified positive plasmid was used as the precision reference, the final concentrations of each pathogen in the precision reference were 10 2 and 10 4 copies / uL respectively. Referring to the usage method of the kit described in Example 2, 3 parallels were made for each template, and 3 replicates were made for each parallel, and the coefficient of variation of the precision reference at each concentration was calculated.

[0125] The coefficients of variation of the kit described in Example 2 of this application for precision references at different concentrations are shown in Table 5.

[0126] Table 5 Coefficients of variation of precision references at different concentrations

[0127]

[0128]

[0129] Example 6 Accuracy test

[0130] In this application, plasmids with low concentration (specific concentration 10 2 copies / uL) were prepared respectively, and detection was carried out by the method described in Example 2.

[0131] The detection results are as Figures 10-11 shown. The detection results of the kit described in Example 2 of this application for the corresponding positive references of each pathogen are all positive, the detection results are accurate, and when the sample to be tested is canine influenza virus, there are no amplification curves for the primers and probes of the remaining canine distemper virus (CDV), canine adenovirus type 2 (CAV-2), canine parainfluenza virus (CPIV), canine respiratory coronavirus (CRcoV), severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and Bordetella bronchiseptica (Bb) used for detection. It can be seen from this that the primers and probes in the reaction system have no cross-reaction with other pathogens.

[0132] Example 7 Actual detection of clinical samples

[0133] In this application, clinical samples of suspected upper respiratory tract infection cases were collected, and the actual detection of clinical samples was carried out with the kit described in Example 2.

[0134] Collect oropharyngeal swab clinical samples from 80 suspected cases of upper respiratory tract infection, and use nucleic acid extraction or purification reagents (registration number of medical device in Jiangsu and Wuxi: 20190009) produced by Wuxi Bioteke Biotechnology Co., Ltd. to extract the nucleic acids of the clinical samples to be tested respectively. The positive and negative control products in the kit are involved in the extraction synchronously. Take 5 μL of the extracted nucleic acid sample, and carry out an amplification reaction with reference to the usage method of the kit described in Example 2. After the qPCR is completed, judge the negativity and positivity of the nucleic acids of the corresponding pathogens through the curves and Ct values of different fluorescence channels. The judgment method is the same as that in Example 2.

[0135] Among the 80 detected clinical samples of suspected respiratory tract infection, a total of 7 clinical samples positive for canine parainfluenza virus, 6 clinical samples positive for canine respiratory coronavirus, 2 clinical samples positive for canine influenza virus, 1 clinical sample positive for canine distemper virus, 1 clinical sample positive for canine adenovirus, 1 clinical sample positive for novel coronavirus, and 1 clinical sample positive for Bordetella bronchiseptica were detected. The amplification results of the above positive clinical samples were sequenced in this application, and the sequencing alignment results were the same as the kit detection results, indicating that the detection accuracy rate of the kit described in this application reached 100%, further proving the clinical detection accuracy of the detection system and detection method for simultaneously detecting seven respiratory pathogens constructed in this application.

[0136] Comparative Example 1

[0137] In this application, a primer design software was used to design multiple sets of qPCR primers and probes for the target nucleic acid sequences of canine distemper virus (CDV), canine adenovirus type 2 (CAV-2), canine parainfluenza virus (CPIV), canine influenza virus (CIV), canine respiratory coronavirus (CRcoV), severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and Bordetella bronchiseptica (Bb) respectively. However, it was found through single-channel qPCR test detection that the specificity of individual primer pairs did not meet the requirements. For example, the primers for detecting canine influenza virus (CIV) designed in this application have the following sequences:

[0138] CIV-M-F1-115bp: TCCTGTCACCTTTAACTAA

[0139] CIV-M-R1-115bp: TCTCCATTCCCATTTAGG

[0140] Using the above primers, a dye-based qPCR detection was carried out with physiological saline as the sample, and as Figure 12 shown, non-specific amplification occurred and the melting peaks of the primer pair were not single.

[0141] Comparative Example 2

[0142] In addition, even for single primers and probes with good screening specificity and high sensitivity, they may not be applicable to the multiplex pathogen detection system. As shown below:

[0143] CDV-P-F2-85bp: GTCGGGGAATTTAGAATGA;

[0144] CDV-P-R2-85bp: CCATGAATCGCCTCAAAG.

[0145] Specifically, replace the primers CDV-P-F2 / R2 for detecting canine distemper virus with CDV-F / R in the qPCR reaction solution A2 described in this application (the comparison results of the single and multiplex qPCR of the primer-probe group selected in this application are as Figure 13 shown), and use the nucleic acid of the positive sample as the sample for detection. The reaction system and conditions are the same as in Example 2. As shown in Table 6, this primer pair has better specificity and sensitivity for the target nucleic acid of the canine distemper virus gene in a single detection system. However, in the multiplex detection system, the amplification of the low-concentration nucleic acid of the canine distemper virus gene is significantly inhibited, and this primer cannot be applied to the multiplex detection system.

[0146] Table 6 Detection results of primer pairs

[0147]

[0148]

[0149] To sum up, the multiplex qPCR kit provided in Example 2 of this application can accurately detect seven viruses, namely canine distemper virus, canine adenovirus type 2, canine parainfluenza virus, canine influenza virus, canine respiratory coronavirus, novel coronavirus, and Bordetella bronchiseptica, simultaneously through a two-tube system, and the lowest detection concentration is 0.1 copies / uL; and when the concentration of the pathogen is 10 2 copies / uL or 10 4 copies / uL, the coefficient of variation is in the range of 1.04 - 1.29% or 0.51 - 0.68%. Thus, it can be seen that the kit of this application has high precision.

[0150] Furthermore, it can be seen from Comparative Examples 1 - 2 that when using the primers of other seven pathogens to replace the seven groups of primers in this application, such as using CIV-M-F1 / R1 to replace CIV-F / R, the melting peaks of the primer pairs are not single, and non-specific amplification occurs; or when using single primers and probes with good specificity and high sensitivity to replace the primers and probes in the multiplex qPCR kit of this application, the detection effect of the kit will also decline. Thus, it can be seen that this application can accurately detect the corresponding pathogens only through the specific combination of primer groups and probes, and the primer groups and probes of this application cannot be replaced.

[0151] The above embodiments are preferred embodiments of the present application, but the embodiments of the present application are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present application shall be equivalent replacement methods and are all included in the protection scope of the present application.

Claims

1. A multiplex primer-probe set, characterized in that, including a first primer set, a first probe, a second primer set, a second probe, a third primer set, a third probe, a fourth primer set, a fourth probe, a fifth primer set, a fifth probe, a sixth primer set, a sixth probe, a seventh primer set, and a seventh probe; The first primer set and the first probe are designed from a specific gene fragment of canine distemper virus; The second primer set and the second probe are designed from a specific gene fragment of canine adenovirus type 2; The third primer set and the third probe are designed from a specific gene fragment of canine parainfluenza virus; The fourth primer set and the fourth probe are designed from a specific gene fragment of canine influenza virus; The fifth primer set and the fifth probe are designed from a specific gene fragment of canine respiratory coronavirus; The sixth primer set and the sixth probe are designed from a specific gene fragment of novel coronavirus; The seventh primer set and the seventh probe are designed from a specific gene fragment of Bordetella bronchiseptica.

2. The multiplex primer-probe set according to claim 1, wherein The first primer set includes a first forward primer and a first reverse primer. The nucleotide sequence of the first forward primer is as shown in SEQ ID NO: 1, the nucleotide sequence of the first reverse primer is as shown in SEQ ID NO: 2, and the nucleotide sequence of the first probe is as shown in SEQ ID NO: 3; The second primer set includes a second forward primer and a second reverse primer. The nucleotide sequence of the second forward primer is as shown in SEQ ID NO: 4, the nucleotide sequence of the second reverse primer is as shown in SEQ ID NO: 5, and the nucleotide sequence of the second probe is as shown in SEQ ID NO: 6; The third primer set includes a third forward primer and a third reverse primer. The nucleotide sequence of the third forward primer is as shown in SEQ ID NO: 7, the nucleotide sequence of the third reverse primer is as shown in SEQ ID NO: 8, and the nucleotide sequence of the third probe is as shown in SEQ ID NO: 9; The fourth primer set includes a fourth forward primer and a fourth reverse primer. The nucleotide sequence of the fourth forward primer is as shown in SEQ ID NO: 10, the nucleotide sequence of the fourth reverse primer is as shown in SEQ ID NO: 11, and the nucleotide sequence of the fourth probe is as shown in SEQ ID NO: 12; The fifth primer set includes a fifth forward primer and a fifth reverse primer. The nucleotide sequence of the fifth forward primer is as shown in SEQ ID NO: 13, the nucleotide sequence of the fifth reverse primer is as shown in SEQ ID NO: 14, and the nucleotide sequence of the fifth probe is as shown in SEQ ID NO: 15; The sixth primer set includes a sixth forward primer and a sixth reverse primer. The nucleotide sequence of the sixth forward primer is as shown in SEQ ID NO: 16, the nucleotide sequence of the sixth reverse primer is as shown in SEQ ID NO: 7, and the nucleotide sequence of the sixth probe is as shown in SEQ ID NO: 18; The seventh primer set includes a seventh forward primer and a seventh reverse primer. The nucleotide sequence of the seventh forward primer is as shown in SEQ ID NO: 19, the nucleotide sequence of the seventh reverse primer is as shown in SEQ ID NO: 20, and the nucleotide sequence of the seventh probe is as shown in SEQ ID NO:

21.

3. The multiplex primer-probe set according to claim 1, wherein The 5'-end of the first probe is labeled with a fluorescent group HEX, and the 3'-end is labeled with a quenching group BHQ1; The 5'-end of the second probe is labeled with a fluorescent group FAM, and the 3'-end is labeled with a quenching group BHQ1; The 5'-end of the third probe is labeled with a fluorescent group FAM, and the 3'-end is labeled with a quenching group BHQ1; The 5'-end of the fourth probe is labeled with a fluorescent group HEX, and the 3'-end is labeled with a quenching group BHQ1; The 5'-end of the fifth probe is labeled with a fluorescent group CY5, and the 3'-end is labeled with a quenching group BHQ3; The 5'-end of the sixth probe is labeled with a fluorescent group Texas Red, and the 3'-end is labeled with a quenching group BHQ2; The 5'-end of the seventh probe is labeled with a fluorescent group CY5, and the 3'-end is labeled with a quenching group BHQ3.

4. Use of the multiplex primer probe set according to any one of claims 1-3 in the preparation of a multiplex qPCR kit.

5. A kit, characterized in that, The kit includes a qPCR reaction solution A1 and a qPCR reaction solution A2 containing the multiplex probe primer set according to any one of claims 1-3; Among them, the qPCR reaction solution A1 contains multiplex qPCR primers and probes for detecting canine adenovirus type 2, canine influenza virus, Bordetella bronchiseptica, and novel coronavirus; The qPCR reaction solution A2 contains multiplex qPCR primers and probes for detecting canine distemper virus, canine parainfluenza virus, and canine respiratory coronavirus.

6. The kit according to claim 5, characterized in that, The concentrations of the primers and probes contained in the qPCR reaction solution A1 and the qPCR reaction solution A2 are both 0.1-1 μM.

7. The kit according to claim 5, wherein It also includes an enzyme system mixture, a positive control product, and a negative control product.

8. The kit according to claim 7, wherein The enzyme system mixture is dNTPs, Taq enzyme, and MMLV enzyme, and the concentration of dNTPs is 0.2-0.4 mM, the concentration of Taq enzyme is 2.5-10 U, and the concentration of MMLV enzyme is 2.5-10 U; The positive control product is a plasmid containing the target gene to be detected; The negative control product is sterile water.

9. The kit according to claim 8, characterized in that, The dNTPs in the enzyme system mixture are composed of five substances: dATP, dUTP, dCTP, dGTP, and dTTP, and the concentration ratio of dATP: dUTP: dCTP: dGTP: dTTP is 1-3: 2-4: 1-3: 1-3:

1.

10. The kit according to claim 5, characterized in that The minimum detectable concentration of the kit for seven pathogens including canine distemper virus, canine adenovirus type 2, canine parainfluenza virus, canine influenza virus, canine respiratory coronavirus, novel coronavirus, and Bordetella bronchiseptica is 0.1 copies / uL.

Images