A sugarcane ShERF1b gene, protein, and applications

By cloning and overexpressing the sugarcane ShERF1b gene, the mechanism of sugar accumulation in sugarcane was elucidated, solving the problem of insufficient analysis of the molecular network of sugar accumulation in sugarcane in the existing technology. This resulted in a significant increase in sugar content in sugarcane, thereby enhancing the economic value and sugar production efficiency of sugarcane.

CN120350031BActive Publication Date: 2025-10-31SANYA RES INST OF CHINESE ACAD OF TROPICAL AGRI +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510854643.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-25
Publication Date
2025-10-31
Estimated Expiration
2045-06-25

AI Technical Summary

Technical Problem

Current technologies lack a systematic and in-depth analysis of the molecular network of sugar accumulation in sugarcane, making it difficult to screen for effective regulatory genes to increase the sugar content of sugarcane.

Method used

The sugarcane ShERF1b gene was cloned, and its overexpression and gene editing vectors were constructed. Through genetic transformation of sugarcane, the molecular mechanism by which it regulates sugar accumulation in sugarcane was analyzed. ShERF1b was screened as a key regulatory transcription factor gene and overexpressed to increase sugar accumulation.

Benefits of technology

Overexpression of the ShERF1b gene significantly improved the sugar accumulation capacity of sugarcane, providing a theoretical basis and genetic resources for the improvement of high-sugar sugarcane varieties, and enhancing sugar production efficiency and economic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120350031B_ABST
    Figure CN120350031B_ABST
Patent Text Reader

Abstract

This invention provides a sugarcane ShERF1b Genes, proteins, and applications belong to the field of biotechnology, and specifically disclose sugarcane... ShERF1b Application of genes in enhancing sugar accumulation. This invention screens genes that are specifically upregulated in mature sugarcane stem nodes and are potential key regulatory transcription factors controlling sugar accumulation. ShERF1b And cloned cultivated sugarcane ShERF1b The full-length gene was constructed, and overexpression and gene editing vectors were constructed. These vectors were then genetically transformed into cultivated sugarcane to elucidate the gene function regulating sugar accumulation in sugarcane. Simultaneously, downstream target genes were isolated using immunoprecipitation to analyze the molecular pathways and networks regulating sugar accumulation in sugarcane, thus providing a preliminary understanding of the gene's role in this process. ShERF1b The molecular mechanism regulating sugar accumulation in sugarcane provides a theoretical basis and genetic resources for the improvement of high-sugar sugarcane varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and relates to plant transgenic biotechnology breeding, particularly to a sugarcane... ShERF1b Genes, proteins, and applications. Background Technology

[0002] Sugar content is one of the key factors determining the quality and economic value of sugarcane. In sugar production, sugarcane varieties with high sugar content can effectively improve sugar production efficiency and reduce production costs, which is of vital importance for ensuring sugar supply and enhancing the economic benefits of the sugar industry. At the same time, high-sugar sugarcane varieties also have potential applications in the energy sector, serving as an important raw material source for the development of the bioenergy industry.

[0003] To elucidate the molecular mechanisms of sugar accumulation in sugarcane, numerous researchers have used methods such as differential expression analysis and gene co-expression network analysis to screen for candidate genes that play important regulatory roles in the process. These genes include transcription factor genes, such as those related to hormone signal transduction and light signal regulation, which play a crucial role in regulating the expression of genes related to sugar accumulation. Although some progress has been made in the research on sugar accumulation and the screening of key genes, a systematic and in-depth analysis of the molecular network of action involved in sugar accumulation is still lacking. Summary of the Invention

[0004] To address the above problems, the present invention provides a sugarcane ShERF1b Genes, proteins, and applications.

[0005] A type of sugarcane ShERF1b Genes, the ones mentioned ShERF1b The coding sequence of the gene is SEQ ID NO: 1; ShERF1b Genes are related to the ability to accumulate sugar.

[0006] A sugarcane ShERF1b protein, wherein the ShERF1b protein is as described above. ShERF1b The protein encoded by the gene has the amino acid sequence shown in SEQ ID NO: 2.

[0007] A primer pair, said primer pair being used for PCR amplification of the above... ShERF1b The primer pair includes: upstream primer ERF1b-F:GAGCAGAGGCAGAGGCAGAGCAGTA;

[0008] Downstream primer ERF1b-R: GGTAGCACAGCACGGATCAGATTCA.

[0009] A type of containing ShERF1bThe plasmid containing the gene ShERF1b Gene plasmids are made using the above methods. ShERF1b Genes are obtained by ligating them into cloning vectors (such as pCAMBIA1300 plasmid).

[0010] A type of containing ShERF1b Recombinant vectors containing genes ShERF1b Recombinant gene vectors (such as pCAMBIA3300-ERF1b-FLAG plant expression vector, CBP-ZmUBI-Cas9-ERF1b gene editing vector, etc.) utilize vectors containing... ShERF1b The PCR amplification product of the gene is ligated into a vector to obtain the result; or, a plasmid is used as the basic backbone for constructing the experimental vector, two target sites ERF-T1 and ERF-T2 are designed using online software, driven by an independent U6-2 promoter, and then assembled into an insert fragment "Promotor-target-SgRNA" using the Overlap PCR method. The assembled insert fragments of the two targets are then inserted into the backbone vector using Infusion seamless ligation technology to obtain the result.

[0011] The ShERF1b The coding sequence of the gene is shown in SEQ ID NO: 1.

[0012] A type of containing ShERF1b The strain containing the gene ShERF1b The strain containing the gene is ShERF1b Agrobacterium or containing genes ShERF1b Genetically modified E. coli.

[0013] One of the above ShERF1b The application of genes in enhancing the ability to accumulate sugar, wherein the application is to... ShERF1b Genes were used in sugarcane to enhance its ability to accumulate sugar.

[0014] The ShERF1b The coding sequence of the gene is shown in SEQ ID NO: 1.

[0015] Furthermore, the application is overexpression ShERF1b Genes designed to enhance the ability to accumulate sugar.

[0016] A plant breeding method to improve sugar accumulation capacity involves modifying sugarcane... ShERF1b Gene overexpression is used to obtain sugarcane with high sugar accumulation capacity;

[0017] The ShERF1b The coding sequence of the gene is shown in SEQ ID NO: 1.

[0018] One planting method to enhance sugar accumulation is to plant... ShERF1b Gene overexpression in plants enhances their ability to accumulate sugars;

[0019] The ShERF1b The coding sequence of the gene is shown in SEQ ID NO: 1.

[0020] A sugarcane of the present invention ShERF1b The beneficial effects of genes, proteins, and applications are as follows:

[0021] This invention utilizes transcriptome analysis to elucidate the molecular network of sugar accumulation in tropical sugarcane stalks. Based on the screening of key candidate genes for sugar accumulation, and to further elucidate the molecular mechanism of sugar accumulation in cultivated sugarcane stalks, it identifies potential key regulatory transcription factors specifically upregulated in mature sugarcane nodes that regulate sugar accumulation. ShERF1b And cloned cultivated sugarcane ShERF1b The full-length gene was constructed, and overexpression and gene editing vectors were constructed. These vectors were then genetically transformed into cultivated sugarcane to elucidate the gene function regulating sugar accumulation in sugarcane. Simultaneously, downstream target genes were isolated using immunoprecipitation to analyze the molecular pathways and networks regulating sugar accumulation in sugarcane, thus providing a preliminary understanding of the gene's role in this process. ShERF1b The molecular mechanism regulating sugar accumulation in sugarcane provides a theoretical basis and genetic resources for the improvement of high-sugar sugarcane varieties. Attached Figure Description

[0022] Figure 1 Among the different sugarcane varieties in Example 1 of this invention ShERF1b Full-length sequence amplification results;

[0023] Figure 2 It is the conserved DNA domain of ShERF1b in sugarcane in Example 1 of this invention;

[0024] Figure 3 This is an analysis of the conservation of the ShERF1b amino acid sequence in different sugarcanes in Example 1 of the present invention;

[0025] Figure 4 This is a phylogenetic tree of ERF1b amino acid sequences in different plant species in Example 1 of this invention;

[0026] Figure 5 This is an analysis of the ShERF1b gene expression patterns in different tissues of sugarcane in Example 2 of the present invention;

[0027] Figure 6 This is in embodiment 3 of the present invention ShERF1b1 and ShERF1b2 Schematic diagram of the GFP fusion vector;

[0028] Figure 7 This is the subcellular localization analysis of ShERF1b in sugarcane protoplast cells in Example 3 of the present invention;

[0029] Figure 8 This is the enzyme digestion verification of the pCAMBIA3300-ShERF1b overexpression vector in Example 4 of the present invention; wherein, the left band is the marker, the middle band is the pCAMBIA3300-ShERF1b overexpression vector, and the right band is the pCAMBIA3300 plant expression vector;

[0030] Figure 9 This is the PCR detection result of Agrobacterium positive clone transformed by pCAMBIA3300-ShERF1b in Example 4 of the present invention; where the leftmost is the marker, and the nine bands on the right are all Agrobacterium strains transformed by the pCAMBIA3300-ShERF1b overexpression vector;

[0031] Figure 10 This is an enzyme digestion verification diagram of the ShERF1b gene editing vector in Example 4 of the present invention; wherein, the left band is the marker, and the right band is the CBP-ZmUBI-Cas9-ERF1b gene editing vector;

[0032] Figure 11 This is the PCR detection result of Agrobacterium positive clones transformed by the ShERF1b gene editing vector in Example 4 of the present invention; where the leftmost is the marker, and the 24 bands on the right are all Agrobacterium strains transformed by the CBP-ZmUBI-Cas9-ERF1b gene editing vector;

[0033] Figure 12 This is part of Embodiment 4 of the present invention. ShERF1b-Flag Genetic transformation of sugarcane using fusion genes;

[0034] Figure 13 This is part of Embodiment 4 of the present invention. ShERF1b-Flag Results of PCR detection of the Bar gene and target fragment integration in transgenic herbicide-resistant positive plants; the top image shows the Bar gene detection results, and the bottom image shows the target fragment integration PCR detection results; in both images, M represents Marker, CK+ represents vector plasmid as template, CK- represents non-transgenic plant DNA as template, H2O represents blank control as template, and 1-19 represent 19 plants respectively. ShERF1b-Flag Genetically modified herbicide-resistant positive plants;

[0035] Figure 14 It is a CPB-ERF-Cas9 PCR positive result in Example 4 of this invention. ShERF1bResults of gene-edited sugarcane Bar gene and genome integration PCR detection; the top image shows the Bar gene detection results, and the bottom image shows the target fragment integration PCR detection results; in both images, M represents Marker, CK+ represents vector plasmid as template, CK- represents non-transgenic plant DNA as template, H2O represents blank control as template, and 1-10 represent 10 plants that were positive for bar gene PCR and CPB-ERF-Cas9 PCR, respectively. ShERF1b Gene-edited sugarcane;

[0036] Figure 15 This is in embodiment 4 of the present invention. ShERF1b-FLAG sugarcane ShERF1b Expression level analysis; where CK represents non-GMO sugarcane, and F2, F8, and F10 are the corresponding... Figure 13 The three strains numbered 2, 8, and 10;

[0037] Figure 16 This is in embodiment 4 of the present invention. ShERF1b-FLAG Transgenic sugarcane lines and ShERF1b Statistical data on plant height of gene mutant plants; the left figure is a comparison chart of sugarcane plant height; the right figure is a statistical chart of plant height data.

[0038] Figure 17 This is in embodiment 4 of the present invention. ShERF1b-FLAG Transgenic sugarcane lines and ShERF1b Statistical analysis of stem diameter data for gene mutant plants; the left image shows a comparison of sugarcane stem diameters; the right image shows statistical data on stem diameters.

[0039] Figure 18 This is in embodiment 4 of the present invention. ShERF1b-FLAG Transgenic sugarcane lines and ShERF1b Statistical analysis of the number of effective stems in gene mutant plants;

[0040] Figure 19 This is in embodiment 4 of the present invention. ShERF1b-FLAG Transgenic sugarcane lines and ShERF1b Results of hammer test on sugarcane juice from gene mutant plants;

[0041] Figures 16-19 In the diagram, CK represents non-GMO sugarcane, and OE, OE1~OE3 all represent... ShERF1b-FLAG Sugarcane transgenic lines; GE, GE1~GE3 all represent ShERF1b Mutant plants. Detailed Implementation

[0042] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Many specific details are set forth in the following description to provide a thorough understanding of the present invention. However, the present invention can also be implemented in other ways different from those described herein. Those skilled in the art can make similar extensions without departing from the spirit of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below. The present invention will be further described in detail below with reference to specific embodiments to enable those skilled in the art to understand it.

[0043] Plant materials: Sugarcane varieties LA, SP80, Badila, Co285, Kassoer, Cheribon, POJ2878, EK28, ROC22, 1202, 1301, 1305, YN82-114, and FN094095 were planted at the Haikou Campus of the Institute of Tropical Biotechnology, Chinese Academy of Tropical Agricultural Sciences.

[0044] Example 1 Sugarcane ShERF1b Full-length gene sequence cloning and bioinformatics analysis

[0045] I. Sugarcane ShERF1b Full-length gene sequence cloning

[0046] Transcriptome sequencing analysis of the high and low sugar stem nodes of the tropical species Badila (Jun-Gang, Wang, Ting-Ting, et al. Culm transcriptome sequencing of Badila (Saccharum officinarum L.) and analysis of major genes involved in sucrose accumulation.[J]. Plant physiology and biochemistry: PPB, 2019, 144:455-465) was performed to obtain... ERF1b Some known gene sequences were found by searching the genome databases of AP85-441 (a type of dermatitis) and New Taiwan Sugar 22. ShERF1b Full-length genome sequence ShERF1b The gene's coding sequence is SEQ ID NO: 1. Sequence analysis... ShERF1b The genome sequence contained no introns. Therefore, sugarcane leaf genomic DNA was used as a template for PCR amplification. Primer 5 was used as the design. ShERF1b The full-length gene amplification primers include: upstream primer ERF1b-F: GAGCAGAGGCAGAGGCAGAGCAGTA and downstream primer ERF1b-R: GGTAGCACAGCACGGATCAGATTCA.

[0047] Total DNA was extracted from young leaves of sugarcane varieties LA, SP80, Badila, Co285, Kassoer, Cheribon, POJ2878, EK28, ROC22, 1202, 1301, 1305, YN82-114, and FN094095 using the CTAB method. The total DNA from these sugarcane varieties was then used as a template for further analysis. ShERF1b Full-length sequence PCR amplification, wherein the PCR amplification system is as follows:

[0048] Table 1 PCR amplification system

[0049]

[0050] PCR amplification program: 95℃ for 7 min; 95℃ for 40 s, 60℃ for 40 s, 72℃ for 1 min, 35 cycles; extension at 72℃ for 10 min. The resulting PCR amplification products were subjected to 1% agarose gel electrophoresis, gel extraction and recovery, and ligated into the pMD19-T vector (to obtain...). ShERF1b The pMD19T plasmid was sent to Sangon Biotech Co., Ltd. for sequencing.

[0051] II. Sugarcane ShERF1b Gene sequence bioinformatics analysis

[0052] The sequence obtained from sequencing was analyzed using the Open Reading Frame Finder software on the NCBI website to determine the reading frame and the amino acid sequence encoding the protein. The amino acid sequence is SEQ ID NO: 2. A BLAST search was performed using the NCBI website's BLASTP to obtain... ShERF1b Conserved domains; using DNAMAN 8.0, comparative analysis of ShERF1b homologous sequences in different sugarcane varieties and closely related species such as sorghum and maize was conducted to obtain the conserved DNA-binding domains of ShERF1b; and using MEGA-X software, a genetic phylogenetic tree of ERF1b in different plant species was constructed.

[0053] Based on the portion obtained from transcriptome sequencing ShERF1b Based on the sequence and sugarcane genome data, primers were designed to amplify sequences from 14 different sugarcane varieties: LA, SP80, Badila, Co285, Kassoer, Cheribon, POJ2878, EK28, ROC22, 1202, 1301, 1305, YN82-114, and FN094095. ShERF1b Full-length DNA sequence (see) Figure 1 ), and found differences between different varieties and within the same variety ShERF1b The sequence lengths differ (see Table 2).

[0054] Table 2. Statistical analysis of ShERF1b coding sequence information in different sugarcane varieties

[0055]

[0056] Amino acid sequence homology alignment of ShERF1b revealed that ShERF1b belongs to the AP2 superfamily and contains a conserved 70-amino acid AP2 DNA-binding domain (see [link to article]). Figure 2 Homology comparison of the ShERF1b amino acid sequences in different varieties showed a homology of 97.02%. The AP2 DNA-binding conserved domain was located at positions 147-216, and the sequence differences were mainly found at positions 81, 112, and 223 (see [link to article]). Figure 3 ).

[0057] Phylogenetic trees were constructed from the ShERF1b protein sequences of different sugarcane cultivars, original species, and different plant species. The results showed that the ShERF1b of the cultivar ROC22 had the highest homology with the ERF1b of the cultivar Zhe 1, and high homology with the ERF1b of tropical sugarcane, *Gesellus chinensis*, and *Saccharum spp.*. It also showed close phylogenetic relationships with the ERF1b of gramineous crops such as maize, wheat, and rice, forming a single large group. ERF1b from dicotyledonous plants such as Arabidopsis thaliana clustered into another group (see...). Figure 4 These findings indicate that sugarcane (Saccharum) is a species of sugarcane. ShERF1b They share high genetic homology, are closely related, and have similar functions.

[0058] Example 2: In sugarcane ShERF1b Gene expression pattern analysis

[0059] 100 mg of young leaves, mature leaves, old leaves, stem nodes, and roots from different parts of ROC22 sugarcane plants at the tillering, jointing, and maturity stages were collected and thoroughly ground into powder using liquid nitrogen. Total RNA was extracted using a plant total RNA extraction kit (Omega), and genomic DNA was digested using the kit's built-in DNase. The extracted RNA was then reverse transcribed into cDNA using a Fermentas cDNA first-strand reverse transcription kit. The reaction system is as follows:

[0060] Table 3. Reaction system for reverse transcription to synthesize cDNA

[0061]

[0062] The reaction conditions were: 65℃ for 5 minutes, followed by cooling on ice. Substances from Table 4 were added to the reaction mixture based on those in Table 3.

[0063] Table 4. Reaction system for reverse transcription to synthesize cDNA (II)

[0064]

[0065] The reaction was terminated at 42℃ for 60 min and 70℃ for 5 min. Store at -20℃ for later use.

[0066] The obtained product was detected by Q-PCR, in which... ShERF1b Expression detection primers: ERF1b-RTF: AGAATTCAAACAGCTCCCCG; ERF1b-RTR: TGCTGGAACTGGAAGGATGA. Internal reference gene expression detection primers: GADPH-F: CACGGCCACTGGAAGCA; GADPH-R: TCCTCAGGGTTCCTGATGCC. The Q-PCR amplification system is as follows:

[0067] Table 5. Q-PCR amplification system

[0068]

[0069] Q-PCR amplification program: 95℃ for 3 min; 95℃ for 10 s, 58℃ for 30 s, 72℃ for 30 s; 40 cycles. After amplification, the ct values ​​of the internal reference gene and the target gene were obtained separately. The method calculates the relative expression level of the target gene, and the results are shown in [the table below]. Figure 5 It can be seen that in sugarcane plants during the tillering stage, ShERF1b It is mainly expressed in actively growing tissues with meristematic zones, such as shoot tips, tillers, and roots, indicating that it plays an important role in the early rapid growth and development of sugarcane; in sugarcane plants at the jointing stage, ShERF1b It is mainly expressed in the shoot tip and may play an important role in the elongation of sugarcane stem nodes; in mature sugarcane plants, ShERF1b It is highly expressed mainly in the shoot tip, nodes 6-7 where sugar accumulates rapidly, nodes 12-13 of mature stems, and roots, indicating that it may be involved in regulating the sugar accumulation process in sugarcane stems.

[0070] Example 3: Subcellular localization analysis of sugarcane ShERF1b gene-encoded protein

[0071] 1) Construction of ShERF1b-GFP fusion vector

[0072] In ROC22 sugarcane ShERF1b -1、 ShERF1b -2. NcoI and SpeI restriction endonuclease sites are added to both ends of the open reading frame sequence, the stop codon is deleted, and a protective base is added before the restriction site, as shown below:

[0073]

[0074] by ShERF1bUsing the pMD19T plasmid as a template, PCR amplification was performed. The amplification system and PCR reaction procedure are as follows:

[0075] Table 6 PCR amplification reaction system

[0076]

[0077] The PCR reaction program was as follows: 98 ℃ for 7 min, 98 ℃ for 40 s, 60 ℃ for 40 s, 72 ℃ for 1 min, 30 cycles, 72 ℃ for 15 min.

[0078] The obtained PCR amplification products were subjected to agarose gel electrophoresis, followed by gel excision and recovery. The recovery procedure was performed according to the Magen gel recovery kit instructions. The gel-recovered fragments and the pCAMBIA1302 plasmid were then double-digested with restriction endonucleases NcoI and SpeI, respectively. The enzyme digestion reaction system is as follows:

[0079] Table 7 Enzyme digestion reaction system

[0080]

[0081] The double-digested vector and target were respectively ShERF1b The fragments were re-examined by gel electrophoresis and recovered. The recovered fragments were measured using a nucleic acid concentration analyzer, and the fragment-to-vector concentration ratio was calculated. Ligation was then performed using T4 ligase (Thermo Fisher Scientific: EL0014). The ligation system is as follows:

[0082] Table 8 Connection System

[0083]

[0084] Incubate at 25℃ for 1 hour. Take 10.0 μL of the ligation product for transformation of DH5α competent E. coli cells (Viodic No.: DL1001S).

[0085] Positive colonies were verified by PCR, plasmids were extracted, recombinant plasmids were verified by enzyme digestion, and sent to the company for sequencing to obtain the pCAMBIA1302-ERF1b-1-GFP and pCAMBIA1302-ERF1b-2-GFP fusion vectors, as follows: Figure 6 As shown. The enzyme digestion identification system is as follows:

[0086] Table 9 Enzyme digestion identification system

[0087]

[0088] 2) Subcellular localization of ShERF1b-GFP fusion protein

[0089] Rice seedlings that have grown for one to two weeks were collected, and tender leaves and stems were continuously shredded. Rice protoplast cells were extracted according to the method of Yoo et al. (Yoo et al. (2007). Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nature Protocol, 2(7), 1565-1572.). The pCAMBIA1302-ERF1b-1-GFP and pCAMBIA1302-ERF1b-2-GFP fusion plasmids were transfected into protoplast cells for transient expression. The cells were observed and photographed using a laser confocal microscope (Nikon C2-ER), and the images were combined using Photoshop software.

[0090] To clarify the site of action of ShERF1b in sugarcane cells, this invention utilizes seamless cloning technology to clone ShERF1b from ROC22 sugarcane. ShERF1b-1 , ShERF1b-2 The reading frame was integrated into the N-terminus of the GFP in the pCAMBIA1302 vector. Further... ShERF1b-1-GFP , ShERF1b-2-GFP Transient protoplast expression was achieved using a fusion vector, and the results showed that… ShERF1b-1- GFP , ShERF1b-2-GFP The fusion proteins are all located in the nucleus (see Figure 7 This indicates that ShERF1b is a nuclear localization protein that may be involved in gene expression regulation in sugarcane cells.

[0091] Example 4 Sugarcane ShERF1b Regulating sugar accumulation in sugarcane

[0092] 1) ShERF1b Construction of overexpression plant expression vectors

[0093] First, we synthesized a 3×Flag nucleic acid sequence using gene synthesis technology, and then further utilized seamless cloning and ligation technology to... ShERF1b-FLAG The fusion sequence was ligated into the pCAMBIA3300 plant expression vector framework driven by the Ubi promoter. Double digestion with BamHI and SacI confirmed that the target fragment had been fully incorporated into pCAMBIA3300 (see [link to documentation]). Figure 8 The constructed vector pCAMBIA3300-ShERF1b was transformed into Agrobacterium strain EHA105 using the freeze-thaw method. Colony PCR was used for verification, and the PCR results showed that the target vector plasmid had been successfully transformed into Agrobacterium strain EHA105 (see...). Figure 9 ), as detailed below:

[0094] Following the same construction method as in Example 3, a 3×FLAG and nuclear localization NLS sequence were first added to the 5' end of the ORF sequence by PCR amplification, and a 3×His tag was added to the 3' end. The tagged sequences were then... ShERF1b BamHI and SacI restriction sites were added to both ends of the reading frame sequence. The reading frame sequence was then integrated into the pCAMBIA3300 plant expression vector, which already contained the downstream of the Ubi promoter, via restriction enzyme digestion and ligation. The primers for adding the restriction sites were: ERF1b-OEF: 5′-GGGGATCCATGGTGAGCAGCACCTC-3′, ERF1b-OER: 5′-GGGAGCTCTCAGATGGAGTGGCTCCGGCA-3′. The PCR product with the added restriction sites and the vector were double-digested, ligated, and transformed. Positive clones were sequenced to verify the inserted fragment. The correctly sequenced ligated vector was double-digested for verification, successfully constructing the pCAMBIA3300-ERF1b-FLAG plant expression vector. The constructed vector plasmid was transformed into Agrobacterium strain EHA105 using the freeze-thaw method for further genetic transformation.

[0095] 2) ShERF1b Construction of gene-editing plant expression vectors

[0096] Using plasmid CPB-ZmUbi-ShCas9 as the basic framework for constructing the experimental vector, two target sites, ERF-T1 and ERF-T2, were designed using online software and driven by independent U6-2 promoters. These were then assembled into an insert fragment, “Promotor-target-SgRNA,” using Overlap PCR. The assembled insert fragments of the two targets were then inserted into the backbone vector using Infusion seamless ligation technology, thus completing the gene editing vector construction. HindIII single enzyme digestion confirmed that the target fragments had been successfully integrated into the vector CPB-ZmUbi-ShCas9, yielding the CBP-ZmUBI-Cas9-ERF1b gene editing vector. Figure 10 The target vector plasmid was introduced into Agrobacterium EHA105 using the freeze-thaw method, and PCR detection confirmed that the plasmid had been successfully transformed into Agrobacterium strain EHA105. Figure 11 ), as detailed below:

[0097] Following the principles of CRISPR / Cas9 gene editing, firstly, conserved sgRNA sites in the genome were selected using CCTop. The secondary structure of the sgRNA was analyzed using CRISPRater, and the site-targeting editing efficiency of the sgRNA was analyzed using a CRISPR efficiency predictor. The designed sgRNA sequence was driven by the maize ZmU6-2 promoter, and the cassette expression cassette sequence of the ZmU6-2-driven sgRNA was directly synthesized by Nanjing GenScript Biotech Co., Ltd. Then, the target fragment was integrated into the CBP-ZmUBI-Cas9 vector, which already contained Cas9, using homologous recombination. Sequencing confirmed the correctness of the integrated target sequence, completing the construction of the CBP-ZmUBI-Cas9-ERF1b gene editing vector. ShERF1b The gene-editing vector plasmid was transferred into Agrobacterium strain EHA105 using the freeze-thaw method for further genetic transformation.

[0098] 3) ShERF1b Genetic transformation of sugarcane using overexpression and gene editing vectors

[0099] Tender shoot tips and leaves from sugarcane ROC22 were used as explants. Round slices were induced into embryogenic callus on MS containing 2,4-D. Granular embryogenic callus and callus containing 2,4-D were collected. ShERF1b Agrobacterium overexpression vector and containing ShERF1b Agrobacterium, a gene-editing vector, was co-transformed. The transformed callus tissue was placed on a proliferation medium containing PPT for selection. Callus particles that remained viable after selection were placed on a differentiation medium to differentiate into seedlings. The robust plantlets that grew from the differentiation were then subjected to rooting culture to obtain 30 seedlings. ShERF1b-Flag fusion vector sugarcane transgenic resistance positive seedlings ( Figure 12 ) and 15 CPB-ERF-Cas9 transgenic sugarcane resistance-positive seedlings, as detailed below:

[0100] (1) Selection and processing of sugarcane materials

[0101] Using the sugarcane variety ROC22 (New Taiwan Sugar) as the recipient material for genetic transformation, healthy, disease-free plants were selected. The outermost old leaves were removed layer by layer, and young leaves approximately 12 cm from the apical meristem were chosen as explants for callus induction. The selected explants were immersed in 75% alcohol for 5-8 minutes, then in 0.1% mercuric chloride for 8-10 minutes. After sterilization, they were washed 2-3 times with sterile ddH2O and dried. The outermost leaf sheath of the explant was removed, and it was then transversely sliced ​​into thin sections approximately 0.2-0.5 mm thick. These sections were placed on M1 solid medium and cultured in the dark at 22°C for 15-20 days. The medium was changed, and the plants were subcultured until embryogenic callus tissue grew. Highly viable embryogenic callus tissue was selected for genetic transformation.

[0102] (2) Activation of Agrobacterium strains containing plant expression vectors

[0103] Agrobacterium strains carrying the pCAMBIA3300-ERF1b-FLAG and CBP-ZmUBI-Cas9-ERF1b vectors were streaked onto YEP solid medium containing rifampicin, streptomycin, and kanamycin, and cultured upside down at 28°C for 2 days. Single colonies were picked and inoculated into YEP liquid containing the three antibodies, and cultured at 28°C and 225 rpm for 12-16 hours. The resulting bacterial cultures were then transferred to 80 mL of YEP liquid containing the three antibodies and cultured at 28°C and 230 rpm until OD reached the target value. 600 The concentration was increased to 0.4-0.6. The resulting bacterial culture was transferred to a new sterile centrifuge tube and centrifuged at 4000 rpm for 5 min at 4 °C. The supernatant was discarded, the remaining culture medium was aspirated, and 120 mL of MR liquid medium (AS 150 µmol / L) was added to resuspend the bacterial cells. The culture was then incubated at 28 °C and 200 rpm for 2 h to obtain the corresponding Agrobacterium-transformed infection solution.

[0104] (3) Agrobacterium infection of sugarcane embryonic callus

[0105] Select vigorous embryogenic callus from sugarcane callus and transfer them to sterilized filter paper for drying. Immerse the sugarcane callus in Agrobacterium infection solution for 30 minutes. Filter out the infection solution and place the Agrobacterium-infected callus on sterile filter paper for drying. Place the dried, infected callus on MS solid medium and incubate in the dark at 22°C for 5 days. After dark incubation, wash the tissue once with sterile water containing 200 mg / L kanamycin, then wash 2-4 times with sterile water without kanamycin, and wash once with liquid MS. Dry the callus on sterile filter paper using a colander. After drying, place the tissue on M2 solid medium containing 200 mg / L kanamycin and incubate in a constant temperature incubator at 28°C for approximately three weeks, until the embryogenic callus slowly differentiates into green seedlings.

[0106] (4) Screening Agrobacterium-transformed plants using PPT

[0107] The seedlings differentiated from the callus were transferred to a selection medium containing PPT and cultured for about 20 days. At this time, the PPT selection concentration was about 2.0 mg / L. During this process, the medium needed to be changed in time until the transformed seedlings were screened out.

[0108] (5) Rooting and hardening of resistant seedlings

[0109] The selected resistant plants were transferred to M3 solid culture medium for rooting culture. After the roots of the seedlings had fully grown, they were removed from the culture medium, cleaned, old leaves removed, disinfected, and then transplanted into crystal soil. The seedlings were marked and hardened off for one week. After they grew strong, they were planted in flower pots.

[0110] 4) ShERF1b PCR detection of integrated fragments in overexpressed and gene-edited plants and positive detection of bar gene-encoded protein expression.

[0111] The tissue culture bottle ShERF1b-Flag Sugarcane transgenic resistant positive seedlings and CPB-ERF-Cas9 transgenic resistant seedlings were subjected to a one-week acclimatization process with the seedlings exposed to open containers. They were then transplanted into crystal soil to adapt to the microbial growth environment. Once their root systems were stable, they were transplanted into seedling trays for further cultivation. Simultaneously, CPB-ERF-Cas9 transgenic resistant seedlings were also cultivated in seedling trays. When the seedlings in the trays had produced a significant number of leaves, young leaves were harvested for genomic DNA extraction. This DNA was then analyzed using the Bar gene primer and the Ubi promoter. ShERF1b Sequence primers for Bar gene, ShERF1b-Flag PCR detection of sugarcane genome integration fragments showed that in 30 plants ShERF1b-Flag Eighteen bar genes were detected in transgenic herbicide-resistant positive plants using PCR testing. ShERF1b Overexpression plants ( Figure 12 ), ShERF1b-Flag 17 gene-positive integration lines ( Figure 13 ), bar Positive gene PCR test and ShERF1b-Flag Plants that are gene-positive are named ShERF1b-FLAG Sugarcane; and 10 seedlings were obtained from 15 resistant seedlings. bar Positive gene PCR test and positive CPB-ERF-Cas9 PCR test ShERF1b Gene-edited sugarcane Figure 14 ), as detailed below:

[0112] When the seedlings planted in the plug trays have grown 3-4 leaves, take 0.1g of tender leaves and grind them into powder with liquid nitrogen. Extract the total DNA from the leaves using the CTAB method. Use the extracted DNA as a detection template and dilute it 10 times before use.

[0113] (1) First, the integration of the herbicide-resistant bar gene into the transgenic plants was detected. Bar gene detection primers: Bar409-F: CGAGACAAGCACGGTCAACT; Bar409-R: CTGCCAGAAACCCACGTCAT. ShERF1b Primers for PCR detection of overexpressing plants: the upstream primer is set in the Ubi promoter region, and the downstream primer is set in... ShERF1b Reading area settings: ERF1b-OEF: GGCGGTCGTTCATTCGTTC; ERF1b-OER: TGCCATTATTCGCCTCTGCT. (For...) ShERF1b CRISPR region integration was detected in gene-edited plants using the following primers: CRISPR-F: GCAAGGCGATTAAGTTGGGT; CRISPR-R: AGACATGCAATGCTCATTATCTC. The PCR reaction system is as follows:

[0114] Table 10 PCR Reaction System

[0115]

[0116] PCR amplification program: 95℃ for 5 min; 95℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, 35 cycles; extension at 72℃ for 5 min. PCR amplification products were subjected to 1% agarose gel electrophoresis, gel excision and recovery, and sent to Sangon Biotech Co., Ltd. for sequencing verification.

[0117] right ShERF1b Overexpression and gene-edited plants were first subjected to bar gene integration PCR detection, and then the result was considered as a successful transfection. Bar Using the DNA of transformed plants as a template, overexpression and gene-edited fragment integration detection were performed to determine the integrity of the integrated fragment region and obtain... bar Positive gene PCR test ShERF1b Overexpression and gene-edited plants.

[0118] 5) ShERF1b In overexpressing transgenic sugarcane plants ShERF1b Expression level detection

[0119] Pick Figure 13 Young leaves (0.1g each) from three plant lines (numbered 2, 8, and 10) were chopped, thoroughly ground into powder using liquid nitrogen, and total RNA was extracted using an Omega plant total RNA extraction kit. Genomic DNA was then digested using the kit's DNase. cDNA was synthesized via reverse transcription using a Fermentas cDNA first-strand reverse transcription kit. ShERF1b The specific method for expression detection was the same as that in Example 2. The results showed that the expression in the sugarcane leaves of the three lines... ShERF1b All genes showed significantly upregulated expression, indicating ShERF1b-FLAG sugarcane ShERF1b All genes were overexpressed, and successful results were obtained. ShERF1b Transcriptional overexpression ShERF1b-FLAG Sugarcane transgenic lines ( Figure 15 ).

[0120] 6) ShERF1b Analysis of mutation types in gene-edited plants

[0121] ShERF1b Mutation analysis of target sites in gene-edited sugarcane plants is primarily performed using Hi-TOM sequencing technology. The Hi-TOM method requires only two steps of standard PCR to construct a multi-sample mixed sequencing library. After obtaining the sequencing data, simply upload it to the Hi-TOM online analysis website (http: / / www.hi-tom.net / hi-tom / ) to obtain detailed mutation sequences and corresponding genotype information for each site in each sample.

[0122] (1) Target site PCR amplification

[0123] According to standard PCR primer design principles, the target site should be 10-100 bp away from both primers, and the total amplification length should generally not exceed 300 bp. Bridging sequences should be added to both primers. Target band-specific primers are named as follows: Fx: ggagtgagtacggtgtgcACCCRTCATCCTTCCAGTTCC / Rx: gagttggatgctggatggTGTCCAGCAGCGCCATYTC. Primers need to be validated for specificity before proceeding to the next step. Perform standard PCR amplification using the primers, and take 3-5 μL of the PCR product for electrophoresis detection. (When using a 96-well plate, be sure to record the well position corresponding to each sample to ensure consistency with sequencing results). Perform PCR amplification using Taq polymerase. The PCR reaction system is as follows:

[0124] Table 11 PCR Reaction System

[0125]

[0126] The PCR reaction procedure is as follows:

[0127] Table 12 PCR reaction procedure

[0128]

[0129] (2) Second round of PCR

[0130] Add F1-F12, RA-RH (adapter sequences for well localization of each sample), and the universal sequence for HiTom-2PF / 2PR sequencing to both ends of the sequence. The 20 primers (original concentration 10 μM, including HiTom-F1~F12 and HiTom-RA~RH) need to be diluted 50-fold before use. Add 5 μL of the corresponding F primer, 5 μL of the R primer, and 90 μL of ddH2O to each well. Mix well, centrifuge, cap, and store at 4°C for use. The HiTom-2PF / 2PR concentration is 10 μM and does not require dilution. See Table 13 for the specific sequences of the primers.

[0131] Table 13 Primer sequence list used in Hi-TOM sequencing

[0132]

[0133] The PCR reaction system is as follows:

[0134] Table 14 PCR Reaction System

[0135]

[0136] For HiTom-F1~F12 and HiTom-RA~RH, use a multi-channel pipette to add 2 μL of the diluted mixture to the corresponding well. For the first round of PCR products, also use a multi-channel pipette to add 1 μL of the product to the 96-well plate for the second round of PCR, following the sample arrangement recorded in the first round of PCR. The PCR reaction procedure is as follows:

[0137] Table 15 PCR Reaction Procedure

[0138]

[0139] (3) Electrophoresis detection

[0140] Aspirate 3 μL of the second-round PCR product from each well and perform 1% agarose gel electrophoresis to verify the size of the amplified target band.

[0141] (4) Mixed samples and gel recovery sent for sequencing

[0142] Mix all remaining second-round products from each of the 96 wells into a 2 mL centrifuge tube and mix thoroughly. Take 50 μL of the mixture from each of the different 96-well plates containing different genes, mix them together, perform agarose gel electrophoresis, and then recover the gel at a concentration of at least 200 ng / μL and a volume of at least 20 μL. Number the recovered products and send them for sequencing.

[0143] (5) Results Analysis

[0144] Download the compressed file from the link provided by the sequencing company and upload it to the website (http: / / www.hi-tom.net / hi-tom / ) for data analysis. Based on the reference data, analyze the mutation types at the edit sites. SNP refers to base substitution, I to base insertion, D to base deletion, and large indel to large fragment insertion. The numbers before I and D represent the number of inserted or deleted bases. Find the corresponding samples with deletions, insertions, or large fragment insertions, and then compare them with the reference sequence to ultimately identify plants with insertions, deletions, or large fragment insertions at the target site.

[0145] By extraction ShERF1b Genomic DNA from sugarcane leaves was edited using gene editing. Primers were designed to amplify two target site sequences via PCR, followed by Hi-TOM high-throughput sequencing. The results showed that in the first target site sequence, deletion mutations were predominant, including 1bp, 3bp, 4bp, 20bp, 25bp, and large-fragment deletions (D), as well as 1bp insertion (I) mutations. In the second target site sequence, insertion mutations were dominant, mainly 6bp and 12bp insertions, with 6bp deletion mutations also present. The GE1 mutant line ShERF1b showed 100% mutation rate, while the GE2 and GE3 mutant lines had a mutation rate of 90% (Table 16). This indicates that gene editing of sugarcane using the ShERF1b gene was successfully achieved. ShERF1b Gene mutation, to obtain ShERF1b Mutant plants.

[0146] Table 16 ShERF1b Analysis of mutation types at target sites in gene-edited plants

[0147]

[0148] 7) ShERF1b Field agronomic trait determination of transgenic sugarcane with overexpression and gene editing

[0149] Will ShERF1b-FLAG Transgenic sugarcane lines and ShERF1b The mutant plant seedlings were planted in the transgenic plant experimental field. After growing for one year and maturing, the main stem and tillering stem segments with buds were taken in the second year and replanted for propagation to conduct phenotypic analysis and field trait statistics.

[0150] Once the transgenic plants grown in pots had developed numerous stem segments, the budded stem segments were cut into plots and planted in the field, with each plot spaced 5 meters apart. During the jointing stage, before the sugarcane lodged, the plant height, stem diameter, and number of effective stems were measured. Plant height was measured using a measuring tape from the base of the sugarcane to the leaf fork; stem diameter was measured using calipers at the middle 13-15 nodes; the number of effective stems was the total number of effective stems in each plot. At maturity, sap was collected from approximately the middle 13-15 nodes of the sugarcane stalk using an awl, and dripped onto a dipstick. The dipstick readings were recorded to obtain dipstick data for the control, overexpression, and gene-edited plants. The measurement data were statistically plotted using Origin software.

[0151] By analyzing the tillers that have already tillered after 5 months of growth ShERF1b-FLAG Transgenic sugarcane lines and ShERF1b The field phenotypes of gene mutant plants were observed and measured. Plant height, stem diameter, tiller number, and yield-related indicators of different transgenic sugarcane lines were determined. The results showed... ShERF1b-FLAG Sugarcane transgenic lines (abbreviated as transgenic lines) ShERF1b-OE Plant height was higher than control. ShERF1b Mutant plants (abbreviated as) ShERF1b-GE Plant height was significantly lower than control ( Figure 16 ); ShERF1b-OE The stem diameter of the strain was no different from that of the control. ShERF1b-GE The stem diameter of the strain was significantly lower than that of the control. Figure 17 Regarding the number of effective stems, ShERF1b-OE All strains were superior to the control. ShERF1b-GE The strain was significantly lower than the control ( Figure 18 ); for maturity ShERF1b-OE The results showed that the water content of sugarcane juice in sugarcane plants was measured. ShERF1b Overexpression significantly increased the sugarcane juice hardness. Figure 19 These research results indicate ShERF1b It is a key gene that regulates sugar accumulation and yield formation in sugarcane.

[0152] 8) ShERF1b Analysis of candidate target gene expression in sugar accumulation stem nodes of sugarcane plants after overexpression and gene editing

[0153] Take samples from the late stage of jointing ShERF1b Overexpression, ShERF1b Next-generation transcriptome sequencing was performed on stem and node tissues of sugar accumulation in gene-edited and control sugarcane plants. Transcriptome data from these tissues were obtained through assembly, and ChIP-seq was used to screen for... ShERF1b Action on downstream candidate target genes ShERF1b Statistical analysis was performed on transcript data from overexpression and gene editing in sugarcane stalks to determine... ShERF1b The effects of changes in gene function on these target genes.

[0154] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. Those skilled in the art can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A type of sugarcane ShERF1b Genes, characterized by, The ShERF1b The nucleotide sequence of the gene is SEQ ID NO:

1.

2. A sugarcane ShERF1b protein, characterized in that, The ShERF1b protein is as described in claim 1. ShERF1b The protein encoded by the gene has the amino acid sequence shown in SEQ ID NO:

2.

3. A type of... ShERF1b The plasmid of the gene is characterized by, The inclusion ShERF1b The gene plasmid is made using the method described in claim 1. ShERF1b Genes are obtained by ligating them into a cloning vector.

4. A type of... ShERF1b A gene recombination vector, characterized in that, The inclusion ShERF1b Gene recombination vectors utilize vectors containing... ShERF1b The PCR amplification product of the gene is ligated into a vector to obtain the gene. The ShERF1b The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

5. A type of... ShERF1b The strain of the gene is characterized by, The inclusion ShERF1b The strain containing the gene is ShERF1b Agrobacterium or containing genes ShERF1b Genetically modified E. coli; The ShERF1b The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

6. A claim 1 ShERF1b The application of genes in enhancing the ability to accumulate sugar is characterized by, The application is the overexpression of sugarcane. ShERF1b Genes to improve the sugarcane juice hardness; The ShERF1b The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

7. A plant breeding method for improving sugar accumulation capacity, characterized in that, The plant breeding method involves processing sugarcane. ShERF1b Gene overexpression is used to obtain sugarcane with high juice hardness; The ShERF1b The nucleotide sequence of the gene is shown in SEQ ID NO: 1.