Application of blue light receptor gene ZmZTLb in regulation and control of flowering time of corn

Abstract

The invention discloses application of a blue light receptor gene ZmZTLb in regulation and control of flowering time of corn, and belongs to the technical field of biology. According to the invention, corn ZmZTLb gene knockout and overexpression strains are respectively obtained through a CRISPER / Cas9 technology and a gene engineering technology, the flowering time of different strains under natural long and short sunshine is further verified, and it is proved that the flowering period of the ZmZTLb knockout strain is obviously advanced compared with that of a wild type under the condition of natural long sunshine, and the yield of the ZmZTLb gene knockout strain is obviously increased. And the flowering period of the ZmZTLb overexpression strain is obviously delayed under the conditions of long sunlight and short sunlight. Meanwhile, the invention reveals that the accumulation of ZmZTLb protein in corn is induced by blue light, after the corn ZmZTLb is knocked out, the expression quantity of flowering genes such as ZCN7, ZCN8 and ZCN12 is obviously increased, and the tasseling period, the spinning period and the pollen scattering period of the corn are obviously shortened, so that the flowering time is obviously advanced. The invention provides a theoretical basis for innovation of corn germplasm resources.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to an application of a blue light receptor gene ZmZTLb in regulating the flowering time of maize. Background Art

[0002] Maize (Zea mays) is a typical short-day crop. Through long-term domestication and improvement by humans, the planting range of maize has covered vast temperate and tropical planting areas. When maize is planted in temperate regions, it is necessary to reduce its photoperiod sensitivity to adapt to the natural long-day conditions, so that maize can transition from the vegetative stage to the reproductive stage more quickly. Research shows that planting maize with photoperiod-sensitive materials under long-day conditions will delay the flowering and maturity time, resulting in a reduction in maize yield. Therefore, regulating the flowering period and reducing photoperiod sensitivity are the keys to the spread of maize in temperate regions.

[0003] Flowering is a key step in plant development, which is the process of plants transitioning from vegetative growth to reproductive growth. Plants flower at specific times of the year, influenced by various endogenous and exogenous factors such as growth temperature, water supply, photoperiod, and plant hormones, to ensure that plants flower at the most suitable time. Photoperiod is the alternating change in the duration of light and darkness in the day-night cycle, which affects plant flowering. The ZTL / FKF1 / LKP2 (LFKs) family is involved in the regulation of the circadian rhythm and flowering time in Arabidopsis thaliana under blue light induction. The ZTL / FKF1 / LKP2 family contains three functional domains: LOV (Light, Oxygen, or Voltage), F-box, and Kelch repeats. The LOV domain of the ZTL / FKF1 / LKP2 family is a member of the PAS domain superfamily, specifically responsible for blue light sensing. It binds flavin mononucleotide (FMN) non-covalently in the dark. Under blue light induction, a partial conformational change in its protein occurs, leading to a change in kinase activity. FKF1-LOV forms a stable dimer, and this binding is not dissociated by light excitation. The F-box domain participates in the formation of the SKP1 / CUL1 / F-box (SCF) ubiquitin ligase complex by binding to members of the ASK protein family. The kelch repeat domain consists of 5-7 tandem repeats of the kelch motif and forms a β-propeller structure, which is a typical protein interaction domain. F-box proteins participate in the recognition and binding of target proteins through their kelch domains in the SCF complex, promoting the ubiquitination and degradation of target proteins. These three functional domains endow ZTL / FKF1 / LKP2 with the ability to participate in light signal transduction in plants as a blue light receptor and regulate plant growth and development. ZTL plays an important regulatory role in the input of light signals to the circadian clock and the regulation of the expression of downstream flowering time genes. However, the ZTL family contains many genes. Therefore, in-depth study of the biological functions and molecular regulatory mechanisms of different genes in the maize blue light receptor protein ZTL family is of great significance for reducing the photoperiod sensitivity of maize and promoting the extensive utilization of tropical and subtropical maize germplasm resources. Summary of the Invention

[0004] The object of the present invention is to provide an application of the blue light receptor gene ZmZTLb in regulating the flowering time of maize to solve the problems existing in the above-mentioned prior art. The present invention respectively obtained maize ZmZTLb gene knockout and overexpression lines through CRISPER / Cas9 technology and genetic engineering technology, and further verified the flowering time of different lines under natural long and short day lengths. It was confirmed that under natural long day conditions, compared with the wild type, the flowering period of the ZmZTLb knockout line was significantly advanced, while the flowering period of the ZmZTLb overexpression line was significantly delayed under both natural long day and natural short day conditions. The present invention provides a theoretical basis for the innovation of maize germplasm resources.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides the application of the maize ZmZTLb gene or related biological materials in regulating the flowering time of maize. Overexpressing the ZmZTLb gene delays the flowering time of maize under natural long-day and short-day conditions; reducing the expression level of the ZmZTLb gene advances the flowering time of maize under natural long-day conditions; the CDS sequence of the ZmZTLb gene is shown in SEQ ID NO.2.

[0007] Optionally, the related biological materials include vectors that inhibit or overexpress the expression of the ZmZTLb gene.

[0008] The present invention also provides a method for advancing the flowering time of maize, including the step of inhibiting the expression of the ZmZTLb gene in maize to reduce the expression level of the ZmZTLb gene in maize; the CDS sequence of the ZmZTLb gene is shown in SEQ ID NO.2.

[0009] Optionally, the flowering time is the flowering time under natural long-day and short-day conditions.

[0010] The present invention also provides a method for delaying the flowering time of maize, including the step of overexpressing the ZmZTLb gene in maize to increase the expression level of the ZmZTLb gene in maize; the CDS sequence of the ZmZTLb gene is shown in SEQ ID NO.2.

[0011] Optionally, the flowering time is the flowering time under natural long-day and short-day conditions.

[0012] The present invention also provides a method for cultivating maize with an advanced flowering time, including the step of inhibiting the expression of the ZmZTLb gene in maize to obtain maize with a reduced expression level of the ZmZTLb gene.

[0013] Optionally, the flowering time is the flowering time under natural long-day and short-day conditions.

[0014] The present invention also provides a method for cultivating maize with a delayed flowering time, including the step of overexpressing the ZmZTLb gene in maize to obtain maize with an increased expression level of the ZmZTLb gene.

[0015] Optionally, the flowering time is the flowering time under natural long-day and short-day conditions.

[0016] The present invention discloses the following technical effects:

[0017] The present invention respectively obtained maize ZmZTLb gene knockout and overexpression lines through CRISPER / Cas9 technology and genetic engineering technology, and further verified the flowering time of different lines under natural long and short day lengths. It was confirmed that under natural long day conditions, compared with the wild type, the flowering period of the ZmZTLb knockout line was significantly advanced, while the flowering periods of the ZmZTLb overexpression lines were significantly delayed under both natural long day and natural short day conditions. At the same time, the present invention revealed that the accumulation of ZmZTLb protein in maize was induced by blue light. After knocking out maize ZmZTLb, the expression levels of flowering genes such as ZCN7, ZCN8, and ZCN12 were significantly up-regulated, and the tasseling stage, silking stage, and pollen shedding stage of maize were significantly shortened, thus significantly advancing the flowering time. The present invention provides a theoretical basis for the innovation of maize germplasm resources. Brief Description of the Drawings

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0019] Figure 1 Identification of ZmZTLb overexpression and knockout transgenic maize lines; among them, A is the gene structure schematic diagram of ZmZTLb; B is the PAM sequence information of the ZmZTLb knockout mutant; C is the relative expression level of ZmZTLb in the gene knockout mutant line; D is the relative expression level of ZmZTLb in the gene overexpression line; E is the expression level of ZmZTLb protein in the gene overexpression line;

[0020] Figure 2 Protein expression levels of 14-day-old overexpressing ZmZTLb maize transgenic materials after 3 days of treatment with different colored lights. Among them, WT represents wild-type maize, OE3# and OE4# are overexpressing ZmZTLb maize transgenic materials, W represents white light, R represents red light, and B represents blue light;

[0021] Figure 3Flowering time phenotype analysis of ZmZTLb overexpression and knockout lines under long-day (LD) and short-day (SD) conditions; among them, A shows the flowering phenotypes of ZmZTLb overexpressing plants (OE3#), wild type (WT), and ZmZTLb knockout (KO1#) under long-day conditions in the Sichuan maize field. The scale bar is 20 cm; B - D sequentially show the days to tasseling (DTT), days to anthesis (DTA), and days to silking (DTS) of ZmZTLb overexpressing plants (OE3# and OE5#), wild type (WT), and ZmZTLb knockout (KO1# and KO2#) plants grown under natural short-day (daylight hours ~ 11.5 h / day, Hainan) and natural long-day (daylight hours ~ 13.5 h / day, Sichuan) conditions. Data for individual plants are represented by discrete points, and the data are expressed as the mean ± standard deviation of three replicates. The P value was determined using a t-test;

[0022] Figure 4 Quantitative verification of flowering-related genes in ZmZTLb transgenic lines; among them, A shows the relative expression level of ZmZCN7; B shows the relative expression level of ZmZCN8; C shows the relative expression level of ZmZCN12; the data are expressed as the mean ± standard deviation of three replicates; the P value was determined using a t-test;

[0023] Figure 5 Vector map of vector pCBC-DT1T2;

[0024] Figure 6 Vector map of vector pCAMBIA3301. Detailed implementation manners

[0025] The various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0026] It should be understood that the terms used in the present invention are only for describing specific embodiments and are not intended to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0027] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although only preferred methods and materials are described in this invention, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the said documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0028] Without departing from the scope or spirit of the present invention, various modifications and variations can be made to the specific embodiments of the specification of the present invention, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0029] Regarding the use of "comprising", "including", "having", "containing", etc. in this article, they are all open-ended terms, meaning including but not limited to.

[0030] Based on the maize whole-genome sequence published on the official website of maizegdb, the nucleotide sequence information of the ZmZTLb gene (gene number in maizegdb is GRMZM2G147800) was obtained. Based on this, the present invention designed the sgRNA sequence located at the editing target site using the CRISPER / Cas9 technology, constructed the ZmZTLb knockout mutant, and at the same time constructed the ZmZTLb overexpression vector using genetic engineering technology and genetically transformed the wild-type maize KN5585 to obtain the corresponding T0 generation transgenic seeds. The present invention screened and detected two types of ZmZTLb gene knockout lines with editing, and at the same time obtained two overexpression lines with expression levels significantly higher than that of the wild type. The biological functions of the wild-type KN5585 and the ZmZTLb gene knockout and overexpression lines in the regulation of maize flowering time were analyzed, thus providing a theoretical basis and gene resources for the germplasm resources of maize.

[0031] The biological materials used in the examples of the present invention are as follows:

[0032] Wild-type maize KN5585, provided by the Maize Research Institute of Sichuan Agricultural University.

[0033] Example 1 Construction of Transgenic Plants of Maize Gene ZmZTLb

[0034] Based on the maize whole-genome sequencing published on the official website of maizegdb, the nucleotide sequence information of the ZmZTLb gene (gene number in maizegdb is GRMZM2G147800) was obtained. The nucleotide sequence of the ZmZTLb gene is shown in SEQ ID NO.1, and the CDS sequence is shown in SEQ ID NO.2.

[0035] SEQ ID NO.1:

[0036] ATTGACAGTCGGTGGTGC

[0037] SEQ ID NO.2:

[0038]

[0039] Constructing a ZmZTLb knockout mutant using the CRISPR / Cas9 technology, the steps are as follows:

[0040] (1) Selecting a suitable guide-RNA targeting site within the CDS of the ZmZTLb gene: ZmZTLb-Target; then performing PCR amplification using the transfer vector pCBC-DT1T2 vector ( Figure 5 ) as a template, with primers DT1-BsF, DT1-F0, DT2-R0, and DT2-BsR. After obtaining the PCR product, recover the stock solution.

[0041] ZmZTLb-Target (SEQ ID NO.3): TGGAGGAAATTGACAGTCGGTGG;

[0042] DT1-BsF (SEQ ID NO.4): ATATATGGTCTCGATTGTGGAGGAAATTGACAGTCGGG TT;

[0043] DT1-F0 (SEQ ID NO.5): TGTGGAGGAAATTGACAGTCGGTGGGTTTTAGAGCTAG AAATAGC;

[0044] DT2-R0 (SEQ ID NO.6): AACCCGACTGTCAATTTCCTCCACAATCTCTTAGTCGAC TCTAC;

[0045] DT2-BsR (SEQ ID NO.7): ATTATTGGTCTCGAAACCCGACTGTCAATTTCCTCCAC.

[0046] Digest the recovered product and the transgenic vector pHEE401 with BsaI enzyme respectively, recover the digested products of both, and ligate them with T4 ligase to obtain an expression vector for knocking out the ZmZTLb gene.

[0047] Constructing an overexpression vector for overexpressing the maize ZmZTLb gene, including the following steps:

[0048] (1) Linearize the initial expression vector pCAMBIA3301-35S ( Figure 6 ); According to the multiple cloning sites of the plant expression vector 35S-pCAMBIA3301, digest 35S-pCAMBIA3301 with EcoRI and BsEII double enzymes, and obtain the linearized initial expression vector pCAMBIA3301-35S through double digestion;

[0049] (2) Amplify the maize constitutive promoter Ubi using amplification primers; introduce an NcoI restriction site downstream of it. The nucleotide sequences of the amplification primers are shown in SEQ ID NO.8 and SEQ ID NO.9 as follows:

[0050] Forward primer (SEQ ID NO.8): 5'-CATGATTACGAATTCCTGCAGTGCAGCGTGA-3';

[0051] Reverse primer (SEQ ID NO.9): 5'-TTCGAGCTGGTCACCCCATGGCTGCAGAAGTAACACCA A-3’;

[0052] (3) Insert the target fragment of the UBI promoter into the linearized initial expression vector pCAMBIA3301-35S in step (1) to obtain the expression vector Ubi-pCAMBIA3301 containing the maize constitutive promoter Ubi;

[0053] (4) Amplify the 3×Flag and ZmZTLb genes using amplification primers to obtain the target fragment of 3×Flag-ZmZTLb;

[0054] The nucleotide sequences of the amplification primers are shown in SEQ ID NO.10 and SEQ ID NO.11:

[0055] 3×Flag-ZmZTLb F (SEQ ID NO.10): 5'-CCACAATGAAGACGTCCCATGGGGTGACCAT GGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAGATGGAGTGGGACAGCG-3';

[0056] 3×Flag-ZmZTLb R (SEQ ID NO.11): 5'-TTCGAGCTGGTCACCCCATGGTCAGACTAATGAGCTT-3’;

[0057] (5) Insert the target fragment of 3×Flag-ZmZTLb into the linearized (cut with NcoI) initial expression vector Ubi-pCAMBIA3301 in step (3) to obtain the expression vector Ubi-pCAMBIA3301-3×Flag-ZmZTLb overexpressing the maize ZmZTLb gene;

[0058] In the present invention, the 3×Flag-ZmZTLb target fragment, the linearized expression vector Ubi-pCAMBIA3301, and the reaction solution are mixed and reacted to obtain the expression vector Ubi-pCAMBIA3301-3×Flag-ZmZTLb, and the reaction solution includes 5×CEⅡ Buffer and ExnaseⅡ.

[0059] The knockout vector and the overexpression vector respectively infect the immature embryos of wild-type maize KN5585 by the method of Agrobacterium-mediated maize immature embryo transformation, using BASTA as the screening resistance, culturing and obtaining the T0 generation knockout mutants and overexpression lines of the ZmZTLb gene and obtaining seeds.

[0060] Example 2 Detection of Transgenic Homozygous Maize Plants

[0061] The transgenic seeds obtained above are germinated and planted in maize nutrient soil, and the leaves of the plants are taken to extract DNA when they are grown to two leaves and one core. Primers located near the target of the ZmZTLb gene, ZmZTLb-F: CCAACTCCAGTAGGCAAGGG (SEQ ID NO.12) and ZmZTLb-R: CCATTCAGGCATGACAGGGT (SEQ ID NO.13), are designed to amplify the genomic DNA sequence near the gene target.

[0062] Using the DNA of maize mutants and wild-type as templates, PCR amplification is carried out using the high-fidelity polymerase KOD one. The reaction system for PCR amplification is: 10 μL of KOD one PCR mix, 0.5 μL of both upstream and downstream primers, 1 μL of DNA template, and supplemented with 8 μL of double-distilled water to make up to 20 μL. The amplification program is: pre-denaturation at 98°C for 3 min, denaturation at 98°C for 10 sec, annealing at 56°C for 10 sec, extension at 72°C for 30 sec, 38 cycles, final extension at 72°C for 5 min, 12°C ∞. The amplified PCR products are electrophoresed on 1% agarose gel and sent to Chengdu Youkang Biotechnology Co., Ltd. for sequencing. The sequencing results of the mutants are compared with the sequencing results of the wild-type (KN5585), and two different editing types of homozygous mutant materials are successfully identified, as shown in Figure 1 A-B. The KO+1bp editing type is the insertion of 1bp (T) between the 1105th and 1106th bases of the sequence shown in SEQ ID NO.1, and the KO-18bp editing type is the deletion of 18bp (ATTGACAGTCGGTGGTGC, SEQ ID NO.14) between the 1097th and 1116th bases of the sequence shown in SEQ ID NO.1. The qPCR detection results show that the expression level of the knockout lines is significantly lower than that of the WT ( Figure 1 C).

[0063] By extracting the RNA of the positively overexpressing plants and reverse-transcribing it into cDNA, using WT as a control and maize ZmACTIN as an internal reference, the qPCR detection of the target gene was carried out. The results are as Figure 1 shown in D: The expression levels of ZmZTLb in all positively overexpressing plants were significantly increased. Among them, the expression levels of OE3# and OE5# lines were more than 10 times that of the WT line. Total proteins of transgenic maize leaves were extracted and Western blot detection of the proteins was carried out using Flag antibody. The results are as Figure 1 shown in E, and the expression abundance of ZmZTLb in the two overexpressing materials of OE3# and OE5# was significantly increased..

[0064] Example 3 Blue light promotes the accumulation of ZmZTLb protein

[0065] ZTL is a blue light photoreceptor that binds to its targets in a blue light-dependent manner. Therefore, in this invention, the overexpressed ZmZTLb transgenic materials were cultured under different colored lights (white, red, and blue) for 14 days, and then total proteins of the leaves were extracted to detect the expression of ZmZTLb under different light quality conditions. The results are as Figure 2 shown, and the expression level of ZmZTLb protein increased significantly under blue light. This result confirmed that ZmZTLb protein is a blue light photoreceptor, which is induced by blue light and accumulates protein.

[0066] Example 4 Identification of the flowering period phenotypes of maize ZmZTLb overexpression and knockout materials under natural long-day conditions

[0067] The knockout lines KO1# (KO + 1bp editing type) and KO2# (KO - 18bp editing type) of ZmZTLb, overexpression lines OE3# and OE5#, and wild type WT were planted in two places: Chengdu, Sichuan (103°81′ E, 30°97′ N, natural long-day conditions) and Sanya, Hainan (109°31′ E, 18°14′ N, natural short-day conditions). The flowering period phenotypes are as Figure 3 shown in A - D. Compared with the wild type, the flowering time of KO1# and KO2# was significantly advanced under natural long-day conditions. Under the same conditions, compared with WT, the flowering periods of the overexpression lines were significantly delayed under both long-day and short-day conditions, indicating that ZmZTLb responds to long-day and short-day conditions and regulates the flowering of maize.

[0068] Example 5 Quantitative verification of flowering-related genes in maize ZmZTLb transgenic lines

[0069] The expression levels of three genes ZNC7, ZNC8, and ZCN12 that promote maize flowering were detected respectively in overexpression, wild type, and knockout lines under long-day conditions. The results are as Figure 4As shown in A-C, the expression levels of the three genes in the knockout lines were significantly higher than those in the overexpression and wild-type lines, which was consistent with the phenotype in Example 4 that the flowering period of the knockout lines was significantly earlier than that of the overexpression materials, indicating that ZmZTLb delays maize flowering by regulating the expression of flowering-related genes.

[0070] The above embodiments are only described as the preferred embodiments of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of the maize ZmZTLb gene or related biological materials in regulating maize flowering time, characterized in that, Overexpressing the ZmZTLb gene, the flowering time of the maize is significantly delayed under natural long-day and short-day conditions; reducing the expression level of the ZmZTLb gene, the flowering time of the maize is significantly advanced under natural long-day conditions; the CDS sequence of the ZmZTLb gene is shown in SEQ ID NO.

2.

2. The application according to claim 1, wherein The related biological material includes a vector that inhibits or overexpresses the expression of the ZmZTLb gene.

3. A method for promoting the early flowering time of maize, characterized in that, It includes the step of inhibiting the expression of the ZmZTLb gene in maize to reduce the expression level of the ZmZTLb gene in maize; the CDS sequence of the ZmZTLb gene is shown in SEQ ID NO.

2.

4. The method according to claim 3, wherein The flowering time is the flowering time under natural long-day and short-day conditions.

5. A method for delaying the flowering time of corn, characterized in that, It includes the step of overexpressing the ZmZTLb gene in maize to increase the expression level of the ZmZTLb gene in maize; the CDS sequence of the ZmZTLb gene is shown in SEQ ID NO.

2.

6. The method according to claim 5, wherein The flowering time is the flowering time under natural long-day and short-day conditions.

7. A method for cultivating maize with an earlier flowering time, characterized in that, It includes the step of inhibiting the expression of the ZmZTLb gene in maize to obtain maize with a reduced expression level of the ZmZTLb gene.

8. The method according to claim 7, wherein The flowering time is the flowering time under natural long-day and short-day conditions.

9. A method for cultivating maize with delayed flowering time, characterized in that, It includes the step of overexpressing the ZmZTLb gene in maize to obtain maize with an increased expression level of the ZmZTLb gene.

10. The method according to claim 9, characterized in that, The flowering time is the flowering time under natural long-day and short-day conditions.

Images