Biomedical application of 3, 29-dibenzoyl karounitriol

By using drugs prepared by 3,29-dibenzoyl lycopene glycol, the problem of difficulty in preventing and controlling pig coronavirus in the prior art was solved, effective inhibition and prevention of PEDV, TGEV and PDCoV were achieved, and the replication and expression of the virus in host cells was reduced.

CN120361017AActive Publication Date: 2025-07-25YANGZHOU UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510626080.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-15
Publication Date
2025-07-25
Estimated Expiration
2045-05-15

AI Technical Summary

Technical Problem

Existing vaccines and clinical treatment methods are difficult to effectively prevent and control swine epidemic diarrhea virus (PEDV), swine infectious gastroenteritis virus (TGEV) and swine delta coronavirus (PDCoV), especially for newborn piglets, with a high mortality rate and a lack of specific antiviral drugs.

Method used

3,29-dibenzoyl lycopene glycol is used as the active ingredient to prepare drugs that inhibit the replication of coronavirus at a concentration of no less than 8μM. The dosage form includes granules, tablets, capsules, etc., to prevent and treat intestinal diseases of livestock caused by coronavirus.

Benefits of technology

It significantly inhibits the replication of PEDV, TGEV and PDCoV, reduces viral titer and protein expression, and prevents PEDV infection, provides an effective prevention and treatment plan and has good application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120361017A_ABST
    Figure CN120361017A_ABST
Patent Text Reader

Abstract

The invention discloses biomedical application of 3, 29-dibenzoyl karounitriol, and particularly relates to application of 3, 29-dibenzoyl karounitriol in inhibition of physiological activities of coronavirus and application of 3, 29-dibenzoyl karounitriol in preparation of drugs for preventing and treating coronavirus infectious diseases. The invention proposes that the triterpenoid 3, 29-dibenzoyl karounitriol can inhibit the replication of porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus and porcine delta coronavirus for the first time; experimental data show that the compound can effectively prevent and treat porcine epidemic diarrhea and has a good application prospect in the domestic pig breeding industry.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to terpenoid compounds, and in particular to the biomedical use of 3,29-dibenzoyl trichosantol. Background Art

[0002] As an important economic animal, pigs have been frequently invaded by various coronaviruses in recent years. Among them, porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus of swine (TGEV), and porcine deltacoronavirus (PDCoV) are three typical enteropathogenic coronaviruses. PEDV and TGEV belong to the genus Alphacoronavirus, while PDCoV is classified into the genus Deltacoronavirus. All three are enveloped single-stranded positive-sense RNA viruses. The high variability of their genomes leads to the virus being prone to recombination or mutation, and even the possibility of cross-species transmission: It has been reported that porcine deltacoronavirus has zoonotic infectivity (Lednicky, John A et al. “Independent infections of porcine deltacoronavirus among Haitian children.” Nature vol. 600, 7887 (2021): 133 - 137.), which significantly increases the difficulty of prevention and control.

[0003] These viruses mainly attack the intestinal epithelial cells of domestic pigs, causing severe watery diarrhea, vomiting, and dehydration. In particular, the lethality rate of neonatal piglets can reach 100%, bringing billions of dollars in economic losses to the global pig industry every year. Although the research and development of vaccines continue to advance, existing vaccines (such as PEDV inactivated vaccines or attenuated live vaccines) are difficult to achieve complete protection in the field due to problems such as virus antigen drift and insufficient mucosal immune response, and the vaccinated pig herds may still experience outbreaks; the research and development of vaccines against TGEV and PDCoV is even slower, and no mature commercial products have been formed. At the same time, clinical treatment methods are extremely scarce. Currently, only supportive therapies such as fluid replacement and electrolyte balance are relied on, and there is a lack of specific antiviral drugs, making the prevention and control of the virus fall into a double dilemma of “difficult prevention and lack of treatment”.

[0004] Under this background, natural compounds have become an important breakthrough in the development of antiviral drugs due to their structural diversity and low toxicity. Triterpenoid compounds, as one of the core families of natural products, have shown broad-spectrum antiviral potential. For example, the inhibitory effects of glycyrrhizic acid on HIV and SARS-CoV-2, and the anti-influenza virus activity of betulinic acid have all been confirmed. However, there is currently no research on the prevention and treatment of swine-susceptible coronaviruses using triterpenoid compounds. Summary of the Invention

[0005] Objective of the Invention: The objective of the present invention is to provide the application of 3,29-dibenzoyl trichosantol in inhibiting coronaviruses and in preparing drugs for preventing and treating coronavirus infectious diseases.

[0006] Technical Solution: The present invention relates to the application of 3,29-dibenzoyl trichosantol in inhibiting the physiological activities of coronaviruses.

[0007] Preferably, in the said application, the concentration of 3,29-dibenzoyl trichosantol is not lower than 8 μM.

[0008] Preferably, the said application is to inhibit the replication of coronaviruses.

[0009] Preferably, the coronaviruses include porcine epidemic diarrhea virus, transmissible gastroenteritis virus of swine, and porcine deltacoronavirus.

[0010] The present invention relates to the application of 3,29-dibenzoyl trichosantol in preparing drugs for preventing and treating coronavirus infectious diseases.

[0011] Preferably, the coronaviruses include porcine epidemic diarrhea virus, transmissible gastroenteritis virus of swine, and porcine deltacoronavirus.

[0012] Preferably, the said application is for preparing drugs for preventing and treating livestock intestinal infectious diseases caused by coronaviruses.

[0013] Preferably, the livestock intestinal infectious diseases caused by coronaviruses include porcine epidemic diarrhea, transmissible gastroenteritis of swine, and porcine deltacoronavirus infection.

[0014] Preferably, the said drug contains 3,29-dibenzoyl trichosantol as an active ingredient and pharmaceutically acceptable excipients.

[0015] Preferably, the dosage form of the said drug is granule, tablet, capsule, oral liquid, pill, emulsion, suspension, injection, infusion or spray.

[0016] Advantageous Effects: Compared with the prior art, the present invention has the following remarkable advantages: 1. It is first proposed that the triterpenoid compound 3,29-dibenzoyl trichosantol can inhibit the replication of porcine epidemic diarrhea virus, transmissible gastroenteritis virus of swine, and porcine deltacoronavirus among coronaviruses; 2. It can effectively prevent and treat porcine epidemic diarrhea and has good application prospects in the domestic pig breeding industry. Description of the Drawings

[0017] Figure 1 It is a research result diagram for CCK8 detection of the cytotoxicity of 3,29-dibenzoyl trichosantol in IPEC-J2 and LLC-PK1 cells;

[0018] Figure 2Results of qRT-PCR detection of the effect of 3,29-dibenzoyltrichosanthin on the expression level of PEDV M gene in IPEC-J2 cells; **P<0.01, ns: no significant;

[0019] Figure 3 Results of qRT-PCR detection of the effect of different concentrations of 3,29-dibenzoyltrichosanthin on the expression level of TGEV N gene in IPEC-J2 cells; **P<0.01, ns: no significant;

[0020] Figure 4 Results of qRT-PCR detection of the effect of different concentrations of 3,29-dibenzoyltrichosanthin on the expression level of PDCoV N gene in LLC-PK1 cells; **P<0.01, ns: no significant;

[0021] Figure 5 Results of detection of the virulence of PEDV in IPEC-J2 cells with different concentrations of 3,29-dibenzoyltrichosanthin by TCID50 method; **P<0.01;

[0022] Figure 6 Results of detection of the virulence of TGEV in IPEC-J2 cells with different concentrations of 3,29-dibenzoyltrichosanthin by TCID50 method; **P<0.01;

[0023] Figure 7 Results of detection of the virulence of PDCoV in LLC-PK1 cells with different concentrations of 3,29-dibenzoyltrichosanthin by TCID50 method; **P<0.01;

[0024] Figure 8 Results of Western blot detection of the effect of different concentrations of 3,29-dibenzoyltrichosanthin on the expression level of PEDV N protein in IPEC-J2 cells;

[0025] Figure 9 Results of Western blot detection of the effect of different concentrations of 3,29-dibenzoyltrichosanthin on the expression level of TGEV N protein in LLC-PK1 cells;

[0026] Figure 10 Results of Western blot detection of the effect of different concentrations of 3,29-dibenzoyltrichosanthin on the expression level of PDCoV M protein in LLC-PK1 cells.

[0027] Figure 11 Flow chart of the experiment on 3,29-dibenzoyltrichosanthin for preventing pigs from being infected with PEDV;

[0028] Figure 12 Figure showing the research results of the copy number of PEDV M gene in pigs treated with different concentrations of 3,29-dibenzoyltrichosanthin by qRT-PCR, **P<0.01;

[0029] Figure 13 Figure showing the research results of the expression level of PEDV N protein in pigs treated with different concentrations of 3,29-dibenzoyltrichosanthin by Western blot;

[0030] Figure 14 Figure showing the research results of the expression level of PEDV N protein in pigs treated with different concentrations of 3,29-dibenzoyltrichosanthin by immunofluorescence. Detailed implementation mode

[0031] The technical solution of the present invention will be further described below.

[0032] Example 1: Cytotoxicity of 3,29-dibenzoyltrichosanthin

[0033] IPEC-J2 cells and LLC-PK1 cells were seeded into 96-well plates at about 4000 cells / well. After 24 h, 3,29-dibenzoyltrichosanthin was diluted to different concentrations (1, 1.5, 2, 2.5, 5, 10, 20, 50, 100 μM) with DMEM medium and added to the 96-well plates, 100 μL per well. Blank cells were set as the control group, and 6 replicates were made for each concentration. After incubation for 24 h, 100 μL of Opti-MEM medium containing 10 μL of CCK-8 reagent was added to each well. After incubation in the dark for 2 h, the absorbance was measured at 450 nm with an enzyme-linked immunosorbent assay (ELISA) reader, and the cell viability was calculated.

[0034] The results are as Figure 1 shown. The CC50 value of 3,29-dibenzoyltrichosanthin in IPEC-J2 cells was 160.5 μM, and the CC50 value in LLC-PK1 cells was 187.8 μM.

[0035] Example 2: Inhibition of PEDV, TGEV, and PDCoV replication by 3,29-dibenzoyltrichosanthin

[0036] 1. Treatment with 3,29-dibenzoyltrichosanthin inhibits the expression of coronavirus structural protein genes

[0037] (1) IPEC-J2 cells and LLC-PK1 cells were seeded in 12-well plates. After the cells adhered, different concentrations of 3,29-dibenzoyltrichosanoyl diol (2, 5, 8, 12, 15 μM) were added and incubated for 24 h, and then PEDV, TGEV or PDCoV with an MOI of 1 was added respectively.

[0038] (2) After 24 h of virus infection, the virus supernatant was collected for later use. Then, Trizol was added to lyse the cells, and cell RNA was extracted according to the Trizol reagent extraction instructions, reverse transcribed into cDNA, and qPCR was performed using the cDNA as a template to detect the copy numbers of the PEDV M gene, TGEV N gene, and PDCoV N gene.

[0039] Among them, the 20 μL reverse transcription reaction system contained: 1000 ng of cDNA, 4 μL of 5x HiScriptⅢ qRT SuperMix, and ddH2O was added to make up to 20 μL. Reaction program: 37 °C, 15 min; 85 °C, 5 s; store at 4 °C for later use.

[0040] The 10 μL qPCR reaction system contained: 1 μL of cDNA, 0.2 μL of upstream primer, 0.2 μL of downstream primer, 5 μL of SYBRGreen Master Mix, and 3.6 μL of ddH2O. Reaction program: 95 °C for 5 min; 95 °C for 10 s, 60 °C for 30 s, 40 cycles.

[0041] The primer sequences for PEDV M gene amplification were: PEDV M-F: AGGTCTGCATTCCAGTGCTT, PEDV M-R: GGACATAGAAAGCCCAACCA; the primer sequences for TGEV N gene amplification were: TGEV N-F: CAATTCCCGTGGTCGGAAGA, TGEV N-R: TTTACGTTGGCCCTTCACCA; the primer sequences for PDCoV N gene amplification were: PDCoV N-F: CCCAGCTCAAGGTTTCAGAG, PDCoV N-R: ATTGGCACCAGTGCGAGACC.

[0042] The detection results of virus gene expression showed that, as Figure 2 shown, when the concentration of 3,29-dibenzoyltrichosanoyl diol was above 12 μM, the copy of the PEDV M gene could be significantly inhibited; as Figure 3 , 4 shown, 3,29-dibenzoyltrichosanoyl diol with a concentration above 8 μM could significantly reduce the copy numbers of TGEV and PDCoV.

[0043] 2. Treatment with 3,29-dibenzoyltrichosanoyl diol reduces the coronavirus titer

[0044] (1) Seed the cells at about 8000 cells / well in a 96-well plate. After the cells adhere to the wall, discard the supernatant. Continuously dilute the virus supernatant collected in the previous step by 10-fold gradient for a total of 8 gradients, and then add it to the 96-well plate.

[0045] (2) After culturing for 7 days, observe and record the positive rate of cytopathic effect in each well, and calculate the TCID50 value in each experimental group by the Reed-Muench method as the virus titer value.

[0046] The results show that, as Figure 5 shown, compared with the control group, when the concentration of 3,29-dibenzoyltrichosanoyl alcohol is 12 μM or higher, the PEDV virus titer will decrease significantly; as Figure 6 、 7 shown, 3,29-dibenzoyltrichosanoyl alcohol with a concentration of more than 8 μM can significantly reduce the TGEV and PDCoV virus titers. The above results indicate that 3,29-dibenzoyltrichosanoyl alcohol can inhibit the replication of the three viruses in host cells.

[0047] 3. Treatment with 3,29-dibenzoyltrichosanoyl alcohol inhibits the expression of coronavirus structural proteins

[0048] (1) Seed the cells in a 6-well plate. After the cells adhere to the wall, discard the culture medium and replace it with DMEM medium containing 2, 5, 8, 12, 15 μM of 3,29-dibenzoyltrichosanoyl alcohol. After culturing for 24 h, discard the supernatant, and inoculate PEDV, TGEV, and PDCoV viruses for infection at a multiplicity of infection (MOI) = 1. After 24 h, extract the total protein using RIPA lysis buffer.

[0049] (2) After determining the protein concentration by the BCA method, perform western blot experiments with a protein loading amount of 20 μg for each sample. Electrophoresis is carried out using 1× Tris-glycine-SDS (TGS) electrophoresis buffer, and stop electrophoresis when the blue bromophenol blue completely runs out. Transfer the protein to the PVDF membrane at a constant current of 300 mA for 1 h in Tris-glycine-methanol transfer buffer. Block with 5% skim milk at room temperature for 2 h. After washing three times with PBST, add the diluted GAPDH (1:5000) and PEDVN (1:1000) respectively, and incubate overnight at 4 °C. After washing three times with PBST, add the goat anti-mouse secondary antibody (1:5000) and incubate at room temperature for 2 h. After washing three times, develop the image using ECL developer.

[0050] The results show that, as Figure 8As shown, compared with the control group, when the concentration of 3,29-dibenzoyl trichosantol was 12 μM or above, the expression of PEDV N protein could be inhibited; as Figure 9 、 10 shown, 3,29-dibenzoyl trichosantol at a concentration of 8 μM or above could inhibit the expression of TGEV and PDCoV viral proteins. The above results further demonstrated that 3,29-dibenzoyl trichosantol could significantly inhibit the replication of the three viruses in host cells.

[0051] Example 3: Prevention of PEDV Infection by 3,29-Dibenzoyl Trichosantol

[0052] 1. Eighteen experimental large white pigs were raised in a sterile environment. During the experiment, the indoor temperature was maintained at 24 ± 2 °C. All pigs were allowed to eat and drink freely. All pigs were randomly assigned to a PBS control group (Mock), a 5 mg / kg 3,29-dibenzoyl trichosantol treatment group (5 mg / kg DIKA), a 10 mg / kg 3,29-dibenzoyl trichosantol treatment group (10 mg / kg DIKA), a PBS + PEDV infection treatment group (PEDV), a 5 mg / kg 3,29-dibenzoyl trichosantol + PEDV infection treatment group (5 mg / kg DIKA + PEDV), and a 10 mg / kg 3,29-dibenzoyl trichosantol + PEDV infection treatment group (10 mg / kg DIKA), with 3 pigs in each group;

[0053] 2. All pigs were orally administered PBS or a 3,29-dibenzoyl trichosantol solution once a day according to the doses of the above groups for a total of two times. After 2 days, the large white pigs in the PBS + PEDV infection treatment group and the 3,29-dibenzoyl trichosantol + PEDV infection treatment group were orally administered 300 μL of PEDV with a virus titer of 10 4.5 along with milk powder, and the large white pigs in the control group and the 3,29-dibenzoyl trichosantol treatment group were orally administered 300 μL of PBS along with milk powder;

[0054] 3. After 3 days of treatment, intestinal tissues of pigs in all groups were collected under the guidance of a veterinarian. Some were stored in fixative, and some were stored in a -80 °C refrigerator for subsequent use.

[0055] 3.1. The copy number of the PEDV M gene in the collected pig intestinal tissues was determined by qRT-PCR, and the primers were the same as in Example 1.

[0056] The qRT-PCR reaction system is shown in Table 1, and the reaction conditions are shown in Table 2.

[0057] Table 1 qRT-PCR Reaction System

[0058] Composition Volume SYBR Green Master Mix 5 μL 10 μM Forward Primer 0.2 μL 10 μM Reverse Primer 0.2 μL DNA Template 1 μL <![CDATA[ddH2O]]> Make up to 10 μL

[0059] Table 2 qRT-PCR reaction conditions

[0060]

[0061] Three repeated qPCR reactions were used to obtain the average Ct value of the PEDV M gene in the collected porcine intestinal tissues, and the PEDV copy number was identified according to the standard curve.

[0062] The results were as Figure 12 shown. When 3,29-dibenzoyltrichosanthin was added, the virus copy number could be significantly reduced. When the concentration of 3,29-dibenzoyltrichosanthin was 5 mg / kg, the virus copy number decreased extremely significantly. The above results indicate that 3,29-dibenzoyltrichosanthin can prevent PEDV.

[0063] 3.2. Detect the expression level of PEDV N protein in all pigs (specific samples) by western blot. The protein concentration was detected by the BCA method to keep the protein loading amount consistent at 20 μg. The specific steps of WB were the same as those in Example 2.

[0064] The results were as Figure 13 shown. When 3,29-dibenzoyltrichosanthin was added, the expression of PEDV N protein could be significantly reduced. When the concentration of 3,29-dibenzoyltrichosanthin was 5 mg / kg, the expression of PEDV N protein was lower than that at 10 mg / kg. The above results indicate that 3,29-dibenzoyltrichosanthin can prevent and treat PEDV infection.

[0065] 4. The porcine intestinal tissues stored in the fixative were dehydrated, embedded and sectioned with a thickness of 2 μm, immersed in 0.01 M sodium citrate solution, heat repaired and then cooled naturally;

[0066] 3% H2O2 was dropped on the surface of the sectioned tissue and incubated at room temperature for 20 min to remove endogenous peroxidase; after rinsing, 5% goat serum was dropped and incubated at room temperature for 1 h for blocking;

[0067] The mouse-derived PEDV N protein primary antibody was diluted to the working concentration, dropped on the tissue surface, placed in a wet box, and incubated statically at 4°C for 18 h, then rinsed 3 times with PBS, 5 min each time;

[0068] The goat anti-mouse secondary antibody was diluted to the working concentration, dropped on the tissue surface, placed in a wet box, and incubated statically at 37°C for 1 h, then rinsed 3 times with PBS, 5 min each time;

[0069] Observation was carried out after sealing with a DAPI-containing mounting medium.

[0070] The results were as Figure 14As shown, when 3,29-dibenzoyltrichosanthin is added, it can significantly reduce the expression of PEDV N protein. When the concentration of 3,29-dibenzoyltrichosanthin is 5 mg / kg, the expression of PEDV N protein is lower than that at 10 mg / kg. The above results indicate that 3,29-dibenzoyltrichosanthin can prevent and control PEDV infection.

Claims

1. Use of 3,29-dibenzoyl trichosanicdiol in inhibiting physiological activities of coronaviruses.

2. The application according to claim 1, characterized in that In the above use, the concentration of 3,29-dibenzoyl trichosanicdiol is not lower than 8 μM.

3. The application according to claim 1, wherein The above use is to inhibit coronavirus replication.

4. The application according to any one of claims 1 to 3, characterized in that The above coronaviruses include porcine epidemic diarrhea virus, transmissible gastroenteritis virus of swine, and porcine deltacoronavirus.

5. Use of 3,29-dibenzoyl trichosanicdiol in preparing a drug for preventing and treating coronavirus infectious diseases.

6. The application according to claim 5, wherein The above coronaviruses include porcine epidemic diarrhea virus, transmissible gastroenteritis virus of swine, and porcine deltacoronavirus.

7. The application according to claim 5, wherein The above use is for preparing a drug for preventing and treating livestock intestinal infectious diseases caused by coronaviruses.

8. The application according to claim 7, wherein The livestock intestinal infectious diseases caused by the above coronaviruses include porcine epidemic diarrhea, transmissible gastroenteritis of swine, and porcine deltacoronavirus infection.

9. The application according to claim 5, wherein The above drug contains 3,29-dibenzoyl trichosanicdiol as an active ingredient and pharmaceutically acceptable excipients.

10. The application according to claim 9, characterized in that, The dosage form of the above drug is granules, tablets, capsules, oral liquids, pills, emulsions, suspensions, injections, infusions or sprays.

Citation Information

Patent Citations

  • Application of 3, 29-dibenzoyl rarounitriol in preparation of drugs for resisting esophagus cancer

    CN111700896A