Isaria cicadae miquel hybrid strain for high-yield spore powder and preparation method thereof

Abstract

The invention provides an Isaria cicadae Miquel hybrid strain with high yield of spore powder and a preparation method thereof, the Isaria cicadae Miquel hybrid strain with high yield of spore powder is preserved in Guangdong Microbial Culture Collection Center, the preservation number is GDMCC NO.65980, and the ITS sequence of the Isaria cicadae Miquel hybrid strain with high yield of spore powder is as shown in SEQ ID NO.1. The cordyceps sobolifera conidial powder collected and separated from Shoushan of Taiwan and Wuyi Mountain of Fujian is hybridized to breed the cordyceps sobolifera hybridized strain with high yield of conidial powder, so that the breeding period of the cordyceps sobolifera is greatly shortened. The hybrid strain inherits excellent characters of parent cordyceps sobolifera in Wuyi Mountain of Fujian and cordyceps sobolifera in Shoushan of Taiwan, not only can generate a large number of spores, but also has the characteristics of early grass growth, good regularity, early spore production, high yield and the like. According to the cordyceps sobolifera hybrid strain, the conidial powder content is remarkably increased, and then the breeding efficiency is improved.

Description

Technical Field

[0001] The invention relates to the technical field of agricultural microorganisms, and in particular to a cicada fungus hybrid strain with high spore powder yield and a preparation method thereof. Background Art

[0002] Isaria cicadae is an edible fungus belonging to the kingdom Fungi, phylum Ascomycota, subphylum Pezizomycotinae, class Hypocreales, family Cordyceps. It is mainly distributed in southern China, including Zhejiang, Jiangsu, Anhui, Fujian, Guangdong, Sichuan, Yunnan, Hunan, Hubei, Jiangxi, and Taiwan Province. The name of cicada flower first appeared in Lei Gong Pao Zhi Lun written by Lei Xiao during the Liu Song Dynasty of the Northern and Southern Dynasties, which has a history of more than 1,600 years. It is traditionally believed that it has the effects of dispersing wind-heat, clearing rashes, extinguishing wind and stopping spasms, and improving eyesight and removing cataracts. Cordyceps spores are the "seeds" of Cordyceps. They are very small (2 to 3 microns in diameter) and are powdered when collected, so they are called cicada flower Cordyceps spore powder. Spores have reproductive functions and gather the active essence of Cordyceps. They are the part with the highest nutritional active ingredients and the strongest efficacy of Cordyceps.

[0003] Cordyceps sinensis spore powder contains myriocin, N6-(2-hydroxyethyl) adenosine (HEA), cordyceps fibrinolytic enzyme, cordycepin, cordycepic acid, adenosine and other active ingredients. Modern research has found that it has a wide range of effects such as antipyretic and analgesic, sedative and hypnotic, anti-fatigue, anti-aging, antioxidant, anti-hypertensive, and hypoglycemic. In addition, Cordyceps sinensis spore powder also has the effect of bidirectionally regulating immune function. It can not only inhibit the proliferation of cancer cells and promote apoptosis, but also has anti-inflammatory and anti-fibrosis effects, can quickly reduce creatinine and urea nitrogen, can increase glomerular filtration rate, and has a protective effect on kidney cells. Therefore, Cordyceps sinensis alone is a complex natural compound medicine or natural pharmaceutical factory.

[0004] Compared with Cordyceps sinensis, Cordyceps sinensis spore powder has the advantages of higher active ingredients, more concentrated nutrition, stronger efficacy, higher safety, etc. Therefore, obtaining Cordyceps sinensis strains with high spore production is of great significance for preparing Cordyceps sinensis spore powder. Summary of the invention

[0005] The invention aims to provide a cicada fungus hybrid strain with high spore powder production and a preparation method thereof. The strain is bred by hybridization with cicada fungus from Wuyi Mountain in Fujian Province and cicada fungus from Shoushan Mountain in Taiwan Province as parents, and inherits the excellent traits of the two parents, has strong grass (fruiting body) production ability, good uniformity, and large spore production, can be used in the preparation of cicada fungus and Cordyceps sinensis spore powder products, and has good development and application prospects.

[0006] The present invention solves the technical problem by adopting the following technical solutions.

[0007] The present invention provides a Cordyceps cicada hybrid strain with high spore powder yield. The Cordyceps cicada hybrid strain with high spore powder yield is preserved in the Guangdong Microbial Culture Collection Center, with the preservation number GDMCC NO. 65980, and its ITS sequence is as shown in SEQ ID NO.1.

[0008] The present invention provides a method for preparing a Cordyceps cicada hybrid strain with high spore powder yield, comprising the following steps: S1. Obtain Cordyceps cicada strains from Wuyi Mountain and Cordyceps cicada strains from Shoushan in Taiwan Province; S2. Respectively inoculate the Cordyceps cicada strains from Wuyi Mountain and the Cordyceps cicada strains from Shoushan in Taiwan Province on a culture medium and culture until they are covered with spores. After rinsing and diluting, obtain a Cordyceps cicada spore suspension from Wuyi Mountain and a Cordyceps cicada spore suspension from Shoushan in Taiwan Province; S3. Add the Cordyceps cicada spore suspension from Wuyi Mountain and the Cordyceps cicada spore suspension from Shoushan in Taiwan Province into a liquid culture medium and shake the bacteria to obtain a Cordyceps cicada and Cordyceps militaris hybrid mycelium solution; S4. Inoculate the Cordyceps cicada and Cordyceps militaris hybrid mycelium solution on a culture material, conduct dark culture and alternate light and dark culture, and then through screening, separation, replanting and re-screening, obtain the Cordyceps cicada hybrid strain with high spore powder yield.

[0009] The beneficial effects of the Cordyceps cicada hybrid strain with high spore powder yield and its preparation method in the embodiments of the present invention are as follows: The present invention hybridizes Cordyceps cicada spore powder collected and isolated from Shoushan in Taiwan Province and Wuyi Mountain in Fujian, and selects a Cordyceps cicada hybrid strain with high spore powder yield, thus greatly shortening the breeding cycle of Cordyceps cicada. This hybrid strain inherits the excellent traits of Cordyceps cicada from Wuyi Mountain in Fujian and Cordyceps cicada from Shoushan in Taiwan Province as parents. It can not only produce a large amount of spores, but also has characteristics such as earlier emergence of the grass, good uniformity, earlier spore production, and large yield. Specific Embodiments

[0010] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. For those conditions not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. For reagents or instruments whose manufacturers are not specified, they are all conventional products that can be obtained through commercial purchase.

[0011] The Cordyceps cicada hybrid strain with high spore powder yield and its preparation method in the embodiments of the present invention will be specifically described below.

[0012] The present invention provides a cicada flower hybrid strain with high spore powder production, and the cicada flower hybrid strain with high spore powder production is deposited in the Guangdong Provincial Microbiological Culture Collection Center, with a deposit number of GDMCC NO. 65980, a strain deposit name of Cordyceps cicadae (Miq.) Massee, a deposit date of March 6, 2025, and an address of the deposit unit: 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou. Its ITS sequence is shown in SEQ ID NO. 1. The cicada flower hybrid strain with high spore powder production of the present invention (Cicada Flower Tianbao No. 1) inherits the excellent traits of two parents, the cicada flower in Wuyi Mountain, Fujian and the cicada flower in Shoushan, Taiwan Province, and can produce a large number of spores. In addition, it also has the characteristics of early emergence of grass, good uniformity, and early spore production.

[0013] The present invention also provides a method for preparing a cicada condylar hybrid strain with high spore powder yield, comprising the following steps: S1. Obtain the Wuyishan cicada fungus strains and the Shoushan cicada fungus strains from Taiwan Province.

[0014] Furthermore, in a preferred embodiment of the present invention, the steps of obtaining the Wuyi Mountain cicada fungus strains and the Taiwan Province Shoushan cicada fungus strains are: isolating the strains from the Wuyi Mountain wild cicada fungus and the Taiwan Province Shoushan wild cicada fungus, respectively, and after multiple generations of screening, obtaining the Wuyi Mountain cicada fungus strains and the Taiwan Province Shoushan cicada fungus strains.

[0015] S2. The Wuyishan Cicadella species and the Taiwan Shoushan Cicadella species are inoculated on a culture medium and cultured until they are covered with spores. After washing and dilution, a Wuyishan Cicadella spore suspension and a Taiwan Shoushan Cicadella spore suspension are obtained.

[0016] Furthermore, in a preferred embodiment of the present invention, the Wuyishan cicada fungus species and the Taiwan Shoushan cicada fungus species are inoculated on a PDA solid culture medium, cultured in the dark at 22°C for 8-10 days until mycelium grows, and then cultured in alternating light and dark at 24°C, the cycle of the alternating light and dark culture is 12 hours, the light intensity is 350-500Lx, and the culture time is 10-12 days. The PDA solid culture medium includes potatoes, glucose, agar strips and water, and the mass volume ratio of potatoes, glucose, agar strips and water is 10:1:1:50 (g / g / g / mL).

[0017] S3, adding the Wuyishan Cicadae Condyloides spore suspension and the Taiwan Shoushan Cicadae Condyloides spore suspension to a liquid culture medium for shaking to obtain Cicadae Condyloides Cordyceps hybrid mycelium liquid. The formula of the liquid culture medium is: peptone 10g / L, sucrose 20g / L, magnesium sulfate heptahydrate 3g / L, potassium hydrogen sulfate 6g / L, and water is added to make up to 1L. The pH of the liquid culture medium is 6.2-6.5.

[0018] Further, in a preferred embodiment of the present invention, the conditions for shaking the bacteria are as follows: the rotation speed is 120-140 r / min, the culture temperature is 22 °C, and the shaking time is 5 d.

[0019] S4. Inoculate the hybrid mycelium solution of Cordyceps cicadae on the culture medium, and after dark culture and alternating light and dark culture, through screening, separation, replanting and re-screening, obtain the Cordyceps cicadae hybrid strain with high-yield spore powder. Specifically, the culture medium, calculated by weight percentage (based on dry matter), includes 97% wheat and 3% peptone, and its water content accounts for 60% of the total amount.

[0020] Further, in a preferred embodiment of the present invention, the temperature for dark culture is 22-24 °C, and the dark culture time is 7-9 d.

[0021] Further, in a preferred embodiment of the present invention, the temperature for alternating light and dark culture is 25-26 °C, the cycle is 12 h, the light intensity is 600-800 Lx, and the alternating light and dark culture time is 28-30 d.

[0022] Further, in a preferred embodiment of the present invention, the steps of screening, separation, replanting and re-screening are as follows: after the hybrid mycelium solution of Cordyceps cicadae undergoes the dark culture and the alternating light and dark culture, screen the fruiting bodies with a growth period not greater than 35 d (the number of days of dark culture + the number of days of alternating light and dark culture), the fruiting bodies are 5-6 cm, the length of the spores on the fruiting bodies is not less than 4 cm, and the spores on them are thick and numerous for tissue separation to obtain candidate strains, and then replant the candidate strains. Re-screen according to the fruiting bodies with a growth period not greater than 35 d, the fruiting bodies are 5-6 cm, the length of the spores on the fruiting bodies is not less than 4 cm, and the spores on them are thick and numerous to obtain the Cordyceps cicadae hybrid strain with high-yield spore powder.

[0023] The present invention uses the Cordyceps cicadae spore powder collected and isolated from Mount Shoushan in Taiwan Province and Wuyi Mountain in Fujian Province for hybridization, selects and breeds a Cordyceps cicadae hybrid strain with high-yield spore powder, and names it Cordyceps cicadae Tianbao No. 1 (Cordyceps cicadae (Miq.) Massee). Cordyceps cicadae Tianbao No. 1 is bred by crossing Cordyceps cicadae from Wuyi Mountain in Fujian Province and Cordyceps cicadae from Mount Shoushan in Taiwan Province as parents, and it inherits the excellent traits of both parents. Cordyceps cicadae Tianbao No. 1 has strong ability to produce grass (fruiting bodies), good uniformity, and caulocladia grow in clusters, protruding from the front end of the host. When fresh, it is 5-6 cm high, the stalk is branched or unbranched, and the diameter is 0.1-0.2 cm. When fresh, it is grayish white. The conidia are oblong-ovoid, slightly pointed at both ends, often containing 2 oil globules, transparent and colorless. This Cordyceps cicadae hybrid strain has a large spore production, and can be applied to the preparation of Cordyceps cicadae spore powder products, with good development and application prospects.

[0024] The Cordyceps cicada hybrid strain with high spore powder yield of the present invention can be applied to the preparation of Cordyceps cicada spore powder products. Among them, the Cordyceps cicada spore powder products include food, medicine, health products, feed and cosmetics.

[0025] The features and properties of the present invention will be further described in detail below in conjunction with the embodiments.

[0026] Example 1 A Cordyceps cicada hybrid strain with high spore powder yield provided in this example is prepared according to the following steps: (1) Isolate strains from Cordyceps cicada collected from Wuyi Mountain in Fujian and wild Cordyceps cicada collected from Shoushan in Taiwan Province. Inoculate the isolated Cordyceps cicada strains on PDA solid medium respectively, and incubate them in the dark at 22°C for 6-7 days until mycelia grow out, then carry out alternating light and dark culture at 24°C with a cycle of 12h, a light intensity of 350-500 Lx, and a culture time of 2d. Wait until the white mycelia turn into light gray, and then refrigerate the two Cordyceps cicada strains at 2-5°C for standby. These isolated strains are called Wuyi Mountain Cordyceps cicada strain and Shoushan Cordyceps cicada strain in Taiwan Province respectively.

[0027] (2) Inoculate the above 2 Cordyceps cicada strains on PDA solid medium respectively, and incubate them in the dark at 22°C for 10 days until mycelia grow out, then carry out alternating light and dark culture at 24°C with a cycle of 12h, a light intensity of 350-500 Lx, and a culture time of 12d. After the spores are fully grown, rinse the two kinds of spores with sterile water respectively to make two Cordyceps cicada spore suspensions, and dilute them to a concentration of 10 4 cells / mL respectively to obtain Wuyi Mountain Cordyceps cicada spore suspension and Shoushan Cordyceps cicada spore suspension in Taiwan Province. Among them, the formula of PDA medium is: 200g of potato, 20g of glucose, 20g of agar strips, and 1000mL of water.

[0028] (3) Add the Wuyi Mountain Cordyceps cicada spore suspension and Shoushan Cordyceps cicada spore suspension obtained in the previous step to the liquid medium for shaking culture to carry out liquid multi-spore hybridization to obtain Cordyceps cicada hybrid mycelium liquid. Among them, the formula of the liquid medium is: 10g / L of peptone, 20g / L of sucrose, 3g / L of magnesium sulfate heptahydrate, 6g / L of potassium dihydrogen sulfate, add water to make up to 1L, and the pH of this liquid medium is 6.2-6.5. The shaking culture conditions are: the rotation speed is 120-140 r / min, the culture temperature is 22°C, and the shaking culture ends after 5 days to obtain Cordyceps cicada hybrid mycelium liquid as the liquid strain.

[0029] (4) In the laminar flow hood, inoculate the hybrid mycelium solution of Cordyceps cicadae on the culture medium in the cultivation bottle, seal it with a breathable cap, and place it in a dark culture room at 24 °C for 7 days. Among them, the culture medium used in the cultivation bottle, calculated by weight percentage (dry matter), includes: 97% wheat and 3% peptone, and the water content of the culture medium accounts for 60% of the total. After the mycelium fills the cultivation bottle, conduct alternate light and dark cultivation at 25 °C, with a cycle of 12 h, a light intensity of 600 - 800 Lx, and cultivate for 28 days. At this time, the fruiting bodies and spore powder are mature. Select fruiting bodies with a growth period less than or equal to 35 days (the number of days of dark cultivation + the number of days of alternate light and dark cultivation), the fruiting bodies are 5 - 6 cm, the length of the spores on the fruiting bodies is not less than 4 cm, and the spores on them are thick and numerous for tissue isolation to obtain candidate strains. Then, replant the obtained candidate strains, and screen according to the growth period less than or equal to 35 days, the fruiting bodies are 5 - 6 cm, the length of the spores on the fruiting bodies is not less than 4 cm, and the spores on them are thick and numerous. Re-screen the obtained fruiting bodies once to obtain the Cordyceps cicadae hybrid strain with high spore powder yield (i.e., Cordyceps cicadae Tianbao No. 1).

[0030] The fruiting body characteristics of Cordyceps cicadae Tianbao No. 1 are as follows: strong ability to produce fruiting bodies (mycelia), good uniformity, fascicles of sporophores growing in clusters, 5 - 6 cm high when fresh, the stipe branched or unbranched, 0.1 - 0.2 cm in diameter. Grayish-white when fresh. The emergence of fruiting bodies is neat, the length of the spores on the fruiting bodies is not less than 4 cm, and the spores on them are thick and numerous, and the spore powder yield is very high. 100 grams (dry weight) of fruiting bodies contain 15.9% of spore powder. The growth period is short (5 - 7 days earlier than the factory cultivation variety), suitable for factory cultivation, and has good development and application prospects.

[0031] Example 2 In this example, molecular biological identification of the Cordyceps cicadae hybrid strain with high spore powder yield (Cordyceps cicadae Tianbao No. 1) in Example 1 was carried out through DNA extraction, PCR amplification, sequence sequencing, and sequence alignment. This part was entrusted to the Guangdong Provincial Microbial Analysis and Testing Center. The ITS sequencing sequence of Cordyceps cicadae Tianbao No. 1 obtained from the test is shown as follows: CGTTGCTTCGGCGGACTCGCCCCAGCGTCCGGACGGCCCTGCGCCGGCCCGCGACCTGGACCCAGGCGGCCGCCGGAGACCACGCAACCCTGTATCCATCAGTCTCTCTGAATCCGCCGCAAGGCAACACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACGTCCCCTGGGACGTCGGCCTTGGGGACCGGCAGCACCCCGCCGGCCCTGAAATAGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGCAGTACAACCACTCGCACCGGGAACCCGACGCGGCCCGCCGTGAAACCCCCAACCTCTGAACGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAA (SEQ ID NO.1).

[0032] In this example, molecular biological identification was carried out on the Cordyceps cicadae Tianbao No.1 in Example 1. The results showed that the ITS sequence of the Cordyceps cicadae hybrid strain sample had the highest homology of 100% with Cordyceps cicadae (Cordyceps cicadae strain).

[0033] Test Example 1 In this test example, the isolated Cordyceps cicadae strains from Wuyi Mountain, the Cordyceps cicadae strains from Shoushan in Taiwan Province, and the Cordyceps cicadae Tianbao No.1 in Example 1 were respectively cut into strain blocks the size of rice grains and added to a liquid medium for shaking culture, and three kinds of Cordyceps cicadae mycelial solutions were obtained. Among them, the liquid medium formula was: peptone 10 g / L, sucrose 20 g / L, magnesium sulfate heptahydrate 3 g / L, dipotassium hydrogen sulfate 6 g / L, and the volume was made up to 1 L with water, and the pH of the liquid medium was 6.2 - 6.5. The shaking culture conditions were: the rotation speed was 120 - 140 r / min, the culture temperature was 22 °C, and after 5 days, the shaking culture ended, and three kinds of Cordyceps cicadae mycelial solutions were obtained as liquid strains.

[0034] On the ultra-clean bench, inoculate the mycelial solutions of 3 kinds of Cordyceps cicadae hybrids onto the culture materials in the cultivation bottles respectively, seal them with breathable lids, and place them in a dark culture room at 24 °C for 7 - 8 days. Among them, the culture materials used in the cultivation bottles, calculated by weight percentage (based on dry matter), include: 97% wheat and 3% peptone, and the water content of this culture material accounts for 60% of the total. Add 30 grams of culture medium to each bottle (based on dry matter). These 3 strains are each inoculated into 30 bottles, and 6 mL of liquid seeds are inoculated into each bottle. After the mycelia of each variety fill the cultivation bottles, conduct alternating light and dark cultivation at 25 °C with a cycle of 12 h and a light intensity of 600 - 800 Lx for 22 - 33 days. When the spore powder on the fruiting bodies of each variety matures, harvest and dry the mature fruiting bodies in the bottles, sieve out the spore powder, and make comparisons: Table 1 Comparison results of 3 kinds of Cordyceps cicadae hybrids

[0035] Spore powder yield rate (%) = spore powder weight / (fruiting body weight + spore powder weight) × 100% As can be seen from Table 1, the fresh spore powder yield of 100 grams (dry culture medium) of Cordyceps cicadae Tianbao No. 1 increased by 48.0% compared with Cordyceps cicadae from Wuyi Mountain, Fujian; and increased by 64.8% compared with Cordyceps cicadae from Shoushan, Taiwan Province.

[0036] The embodiments described above are some, but not all, of the embodiments of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely represents selected embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments in the present invention without creative efforts fall within the scope of protection of the present invention.

Claims

1. A hybrid strain of Cordyceps cicadae with high spore powder yield, characterized in that, The Cordyceps cicada hybrid strain with high spore powder yield is preserved in the Guangdong Microbial Culture Collection Center, with the preservation number of GDMCC NO. 65980, and its ITS sequence is shown as SEQ ID NO.

1.

2. A preparation method of a Cordyceps cicadae hybrid strain with high spore powder yield, characterized in that, It includes the following steps: S1. Obtain the Cordyceps cicada strain from Wuyi Mountain and the Cordyceps cicada strain from Shoushan in Taiwan Province; S2. Respectively inoculate the Cordyceps cicada strain from Wuyi Mountain and the Cordyceps cicada strain from Shoushan in Taiwan Province on a culture medium and culture until they are covered with spores. After washing and dilution, obtain the Cordyceps cicada spore suspension from Wuyi Mountain and the Cordyceps cicada spore suspension from Shoushan in Taiwan Province; S3. Add the Cordyceps cicada spore suspension from Wuyi Mountain and the Cordyceps cicada spore suspension from Shoushan in Taiwan Province into a liquid culture medium and shake the bacteria to obtain a Cordyceps cicada hybrid mycelium solution; S4. Inoculate the Cordyceps cicada hybrid mycelium solution on a culture material, conduct dark culture and alternating light and dark culture, and after screening, separation, replanting and re-screening, obtain the Cordyceps cicada hybrid strain with high spore powder yield.

3. The preparation method according to claim 2, wherein In step S1, the steps of obtaining the Cordyceps cicada strain from Wuyi Mountain and the Cordyceps cicada strain from Shoushan in Taiwan Province are: respectively isolate the strains from wild Cordyceps cicadas in Wuyi Mountain and wild Cordyceps cicadas in Shoushan in Taiwan Province, and after multiple generations of screening, obtain the Cordyceps cicada strain from Wuyi Mountain and the Cordyceps cicada strain from Shoushan in Taiwan Province.

4. The preparation method according to claim 2, characterized in that, In step S2, the steps of respectively inoculating the Cordyceps cicada strain from Wuyi Mountain and the Cordyceps cicada strain from Shoushan in Taiwan Province on a culture medium and culturing until they are covered with spores are: Respectively inoculate the Cordyceps cicada strain from Wuyi Mountain and the Cordyceps cicada strain from Shoushan in Taiwan Province on a PDA solid culture medium, conduct dark culture at 22°C for 8 - 10 d until mycelia grow, and then conduct alternating light and dark culture at 24°C. The period of the alternating light and dark culture is 12 h, the light intensity is 350 - 500 Lx, and the culture time is 10 - 12 d.

5. The preparation method according to claim 2, characterized in that, In step S3, the conditions for shaking the bacteria are: the rotation speed is 120 - 140 r / min, the culture temperature is 22°C, and the shaking time is 5 d.

6. The preparation method according to claim 2, wherein In step S4, the temperature for dark culture is 22 - 24°C, and the dark culture time is 7 - 9 d.

7. The preparation method according to claim 2, wherein In step S4, the temperature for alternating light and dark culture is 25 - 26°C, the period is 12 h, the light intensity is 600 - 800 Lx, and the alternating light and dark culture time is 28 - 30 d.

8. The preparation method according to claim 2, characterized in that, In step S4, the steps of screening, separation, replanting and re-screening are: after the Cordyceps cicada hybrid mycelium solution undergoes the dark culture and the alternating light and dark culture, screen the fruiting bodies with a growth period not greater than 35 d, a fruiting body of 5 - 6 cm, the length of the spores on the fruiting body not less than 4 cm, and thick and numerous spores on it for tissue separation to obtain candidate strains, and then replant the candidate strains, and re-screen once according to the fruiting bodies with a growth period not greater than 35 d, a fruiting body of 5 - 6 cm, the length of the spores on the fruiting body not less than 4 cm, and thick and numerous spores on it to obtain the Cordyceps cicada hybrid strain with high spore powder yield.

Images