Multi-modal nucleic acid detection kit and method based on connection-started LAMP (loop-mediated isothermal amplification) auxiliary molecular beacon system

Abstract

The invention discloses a multi-modal nucleic acid detection method (multi-modal LAMP, M-LAMP) of an LAMP (loop-mediated isothermal amplification) auxiliary molecular beacon system based on connection start. In M-LAMP, aiming at different targets to be detected, only target binding sites can be changed, and primer binding sites and signal probe binding sites are fixed, so that single, double and triple detection can be simultaneously realized by using one set of LAMP primer and signal probe, and the tedious and time-consuming design and optimization process of the primer and signal probe is avoided. The two major problems, namely the primer design and optimization complexity and the false positive risk, existing in the current carbapenemase detection based on LAMP are effectively solved, and the reliability and timeliness of a detection result are remarkably improved.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly to a multimodal nucleic acid detection reagent and method based on a connection-initiated LAMP-assisted molecular beacon system. Background Art

[0002] Carbapenem antibiotics are non-typical β-lactam antibiotics with the broadest antibacterial spectrum and the strongest antibacterial activity, and are regarded as the last line of defense against multi-drug resistant bacterial infections. However, in recent years, the abuse of such antibiotics has led to the emergence of bacteria with carbapenem resistance. Among them, carbapenemase-producing Enterobacteriaceae (CPE), due to its fast transmission speed, strong drug resistance, high lethality rate, etc., has become one of the categories that pose the greatest threat to the life and health of patients, mainly including strains producing Klebsiella pneumoniae carbapenemase (KPC), imipenemase (IMP), New Delhi metallo-β-lactamase (NDM), Verona integron-encoded metallo-β-lactamase (VIM), and oxacillinase-48 (OXA-48). These strains hydrolyze carbapenem antibiotics by producing carbapenemases. Therefore, timely and effective detection of carbapenemases can not only control the rapid spread of CPE, reduce the risk of cross-infection, but also optimize the use of antibiotics, thereby reducing medical costs.

[0003] Carbapenemase detection methods mainly include phenotypic detection, immunochromatography, and molecular detection methods. Phenotypic detection methods such as the Carba NP test, modified Hodge test, and matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF MS), etc., usually have problems such as low sensitivity and long time consumption, and it is difficult to meet the requirements of rapid detection. Immunochromatography based on antigen-antibody reaction, such as lateral flow test (LFT), although simple to operate, requires culturing bacterial colonies or positive blood culture samples, which takes a long time; in addition, when the sample inoculation amount is too large, non-specific reactions may occur in LFT, resulting in false positive results. Molecular detection methods mainly include polymerase chain reaction (PCR), loop-mediated isothermal amplification (LAMP), genome sequencing, etc. These methods have significantly improved the detection efficiency and have high accuracy and sensitivity. However, they also have some limitations. For example, genome sequencing is complex and costly to operate, and PCR requires sophisticated thermal cycling instruments and skilled operators, which limit their application in on-site detection and remote areas. In contrast, LAMP is carried out at a constant temperature without expensive equipment such as thermal cyclers, and has the advantages of being fast and sensitive, and is particularly suitable for carbapenemase detection in resource-limited areas.

[0004] At present, carbapenemase detection based on LAMP technology still faces the following challenges: on the one hand, there are many variations in the carbapenemase gene family. For different drug-resistant gene variants, corresponding primers need to be designed and optimized, and each set of detection usually requires the design and optimization of 4-6 primers, which not only increases the complexity of detection, but also increases the detection time and cost; on the other hand, in the process of carbapenemase detection, turbidity determination, SYBR Green or calcein staining are usually used to characterize LAMP products, but these methods are prone to produce false positive signals. In order to improve the specificity of detection, some researchers have tried to introduce technologies such as Cas / 13a and LFT. However, these methods require the LAMP product to be opened, which may lead to product contamination, thereby increasing the risk of false positive results.

[0005] In summary, the spread of carbapenem-resistant bacteria (such as strains producing KPC, NDM, OXA-48 and other genes) poses a serious threat to global public health. Existing technologies have the following defects: (1) Complex design: Traditional LAMP requires the design of 4-6 primers for each target group, which is time-consuming and laborious; (2) Risk of false positives: Open-cap detection (such as SYBR Green staining) is prone to contamination; (3) Equipment dependence: PCR requires a precision thermal cycler, which limits field applications.

[0006] Therefore, how to ensure the convenience and specificity of detection while avoiding product contamination has become a key issue that needs to be urgently addressed in the current application of LAMP technology in carbapenemase detection. Summary of the invention

[0007] The purpose of the present invention is to provide a multimodal nucleic acid detection method (M-LAMP) based on a ligation-activated LAMP-assisted molecular beacon system. In M-LAMP, for different targets to be detected, only the target binding site will change, while the primer binding site and the signal probe binding site are fixed, so that a set of LAMP primers and signal probes can be used to simultaneously achieve single, double and triple detection, avoiding the cumbersome and time-consuming design and optimization process of primers and signal probes.

[0008] In order to achieve the above object, the present invention adopts the following technical solution: In a first aspect of the present invention, a multimodal nucleic acid detection kit based on a ligation-initiated LAMP-assisted molecular beacon system is provided, characterized in that it comprises the following components: Identification probe group: composed of a pair of stem-loop structure probes, wherein the stem-loop structure probes are LHP and RHP, The LHP is a stem-loop structure with a sequence composition of: 5'-the first stem + the first loop + the second stem + nucleotide TTT + the first recognition site-3', and the nucleotide sequences of the first stem, the first loop, and the second stem are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3 respectively; wherein, the nucleotide sequences of the first stem and the second stem are complementary and paired; the first recognition site recognizes the target sequence through nucleotide complementary pairing; The RHP is a stem-loop structure with a sequence composition of: 5'-recognition site + nucleotide TTT + the third stem + the second loop + the fourth stem-3', and the nucleotide sequences of the second recognition site, the third stem, the second loop, and the fourth stem are shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 respectively; wherein, the nucleotide sequences of the third stem and the fourth stem are complementary and paired; the second recognition site recognizes the target sequence through nucleotide complementary pairing; Primer set: Comprising a forward primer, a reverse primer, and a loop primer, with nucleotide sequences shown in SEQ ID NO.7 - SEQ ID NO.9 respectively; Signal probe: A molecular beacon with a nucleotide sequence shown in SEQ ID NO.10, where the fluorophore and quencher are modified at both ends of the stem, specifically binding to the LAMP amplification product and outputting a real-time fluorescence signal.

[0009] In the above technical solution, the structural compositions of LHP and RHP are as Figure 7 shown in Table 1.

[0010] Table 1 - Structural Compositions of LHP and RHP The sequences of the recognition sites of the LHP and the RHP are determined according to the target. It is applicable to any target.

[0011] As a specific implementation manner, For the KPC target, the sequence of the recognition site of the LHP is GGCGTTATCAC (SEQ ID NO.11), and the sequence of the recognition site of the RHP is TGTATTGCACG (SEQ ID NO.12); For the NDM target, the sequence of the recognition site of the LHP is GACAACGCATT (SEQ ID NO.13), and the sequence of the recognition site of the RHP is GGCATAAGTCG (SEQ ID NO.14); For the OXA-48 target, the sequence of the recognition site of the LHP is TTTGCTCCGTG (SEQ ID NO.15), and the sequence of the recognition site of the RHP is GCCGAAATTCG (SEQ ID NO.16); For the VIM target, the sequence of the recognition site of the LHP is CTTAGTGCATC (SEQ ID NO.17), and the sequence of the recognition site of the RHP is TAACGCCGAAG (SEQ ID NO.18); For the IMP target, the sequence of the recognition site of the LHP is CACGCTCCACA (SEQ ID NO.19), and the sequence of the recognition site of the RHP is AACCAAGTGAC (SEQ ID NO.20).

[0012] When other targets are used, the recognition site can be determined according to the base complementary pairing principle, and this is also within the protection scope of the present invention. protection scope.

[0013] Furthermore, the kit further includes an IP probe with a linear structure; In the dual detection, two targets, target 1 and target 2, are detected simultaneously. The IP probe is IP1, and its sequence composition is: 5'-complementary region of target 1 + complementary region of target 2-3'. The sequence of the complementary region of target 1 is complementary to 11 nucleotides starting from the 5'-end of target 1, and the sequence of the complementary region of target 2 is complementary to 11 nucleotides starting from the 3'-end of target 2; In the triple detection, three targets, target 1, target 2, and target 3, are detected simultaneously. The IP probe includes IP1 and IP2. The sequence composition of IP1 is: 5'-complementary region of target 1 + first complementary region of target 2-3'. The sequence of the complementary region of target 1 is complementary to 11 nucleotides starting from the 5'-end of target 1, and the sequence of the first complementary region of target 2 is complementary to 11 nucleotides starting from the 3'-end of target 2; The sequence composition of IP2 is: 5'-second complementary region of target 2 + complementary region of target 3-3'. The sequence of the second complementary region of target 2 is complementary to 11 nucleotides starting from the 5'-end of target 2, and the sequence of the complementary region of target 3 is complementary to 11 nucleotides starting from the 3'-end of target 3.

[0014] Among them, the single, dual, or triple detection modes are achieved by adjusting the sequences of the recognition probe group, and the amplification primer group and the signal probe are common in all modes. signal probe are common in all modes.

[0015] Single detection: For a single drug-resistant gene (such as KPC, NDM, OXA-48, etc.); Dual detection: Simultaneously detect two combinations of drug-resistant genes (such as KPC+IMP, NDM+OXA-48, etc.); Triple detection: Synchronously detect three drug-resistant genes (such as KPC+NDM+OXA-48).

[0016] (1) When using the single detection mode, no IP probe is required. Only use LHP probe and RHP probe; (2) When using the dual detection mode, for example, when the two targets are KPC+IMP respectively, the recognition probe group of the kit includes: LHP-KPC: A stem-loop probe targeting the KPC gene; RHP-IMP: A stem-loop probe targeting the IMP gene; IP1 probe: A linear probe, with the 5' end complementary to the KPC sequence (11 nucleotides starting from the 5' end), and the 3' end complementary to the IMP sequence (11 nucleotides starting from the 3' end). The sequence of the IP1 probe is 22 nucleotides (nt) in total.

[0017] (3) When using the triple detection mode, for example, when the three targets are KPC, OXA-48, and NDM respectively, the recognition probe group of the kit includes: LHP-KPC: A stem-loop probe targeting the KPC gene; RHP-OXA-48: A stem-loop probe targeting the OXA-48 gene; IP1 probe: The 5' end is complementary to the KPC sequence (11 nucleotides starting from the 5' end), and the 3' end is complementary to the NDM sequence (11 nucleotides starting from the 3' end); the sequence of the IP1 probe is 22 nucleotides (nt) in total; IP2 probe: The 5' end is complementary to the NDM sequence (11 nucleotides starting from the 5' end), and the 3' end is complementary to the OXA-48 sequence (11 nucleotides starting from the 3' end).

[0018] Further, the probe with a stem-loop structure includes at least one of the following 5 groups, as shown in Table 2.

[0019] Table 2 The present invention solves the above problems through the following solutions: Modular probe design: Only change the target binding region of the recognition probe, and the universal primer group and MB are used to achieve multi-mode detection, reducing the primer design amount.

[0020] Closed-tube real-time detection: MB binds to the stem-loop region of the LAMP product, avoiding the opening of the tube and reducing the risk of contamination.

[0021] Efficient amplification and detection: Isothermal reaction (completed in 50 minutes) combined with fluorescence signal output, with a sensitivity reaching the aM level One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages: The method of the present invention provides an efficient means for detecting carbapenemase with high sensitivity, good multiplex detection ability and simple operation process, which has important research and application value for resource-limited areas and on-site detection environments that require rapid response. Compared with the prior art, it has the following advantages: 1. The present invention provides a multimodal nucleic acid detection method (M-LAMP) based on a ligation-initiated LAMP-assisted molecular beacon system, which can be used for rapid detection of carbapenemase genes. This method supports single, double and triple detection modes and can simultaneously detect 2-3 carbapenemase genes.

[0022] 2. The single detection mode shows high sensitivity and can detect drug-resistant genes at the aM (attomolar) level; while the double and triple detection modes, although the sensitivity is slightly reduced, can simultaneously provide expression information of multiple drug-resistant genes, which has important clinical application value.

[0023] 3. The modular design of M-LAMP is extremely simple. Under different detection modes, only the recognition region of the recognition probe needs to be adjusted according to the target drug-resistant gene, and the amplification primers and signal probes can be used in all modes. This greatly reduces the time-consuming process of primer and signal probe design and optimization and can effectively meet the detection requirements for the frequent mutation of carbapenemase genes.

[0024] 4. In addition, the introduction of MB can specifically bind to the amplification product to achieve closed-tube detection, reduce the possibility of non-specific signal generation, and the flexibility of the dual-terminal modification of the fluorophore provides the possibility for higher-order multiplex detection.

[0025] 5. In practical applications, M-LAMP has been successfully used for the detection of clinical strains, can accurately distinguish bacteria carrying different drug-resistant genes, and shows good practicability. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0027] Figure 1It is a detection mechanism diagram of M-LAMP. The stem-loop structures of LHP and RHP contain: (a) Stem: The stem of LHP consists of 21 nucleotide pairs, and the stem of RHP consists of 20 nucleotide pairs (the stem of LHP is GTCCATCGAGGATGTCGAGTT; the stem of RHP is GGGCTTGCCGGGTTTGATCA), with a GC content ≥ 50% and a Tm value ≥ 60 °C; (b) Loop: The length of the loop of LHP is 52 nucleotides GCCGCAGTACTGGTAGAGGCGGCGATGGTTGAACCAGTCGACCCAGCGCGC, and the loop of RHP is 42 nucleotides GCTCGGTCTTGTATAGGCCGTTGATCGTCTCGGCTAGTGCAT), which contains the specific complementary sequence of the target nucleic acid.

[0028] Figure 2 It is the optimization result of MB. Among them, Figure A: MB detects KPC at 516 fM / 51.6 pM respectively; Figure B: SYBR Green detects KPC at 516 fM / 51.6 pM respectively.

[0029] Figure 3 It is the single detection mode of carbapenemase genes. Among them, A is the composition and sequence design of LHP and RHP in the single detection mode, where different drug-resistant genes share a set of universal primers and MB, B is the real-time fluorescence amplification curve of different concentrations of T-KPC, C is the quantitative analysis result of different concentrations of T-KPC, D is the real-time fluorescence amplification curve of different concentrations of T-NDM, E is the real-time fluorescence amplification curve of different concentrations of T-IMP, F is the real-time fluorescence amplification curve of different concentrations of T-OXA-48, G is the real-time fluorescence amplification curve of different concentrations of T-VIM. Error bars represent the standard deviation of at least three independent experiments, and the target is marked above each panel.

[0030] Figure 4 It is the dual detection mode of carbapenemase genes. Among them, A is a schematic diagram of drug-resistant gene detection based on the dual detection mode, where each group of detections requires a pair of LHP, RHP, and an IP. Except for the groupings of T-NDM and T-OXA-48, T-KPC and T-IMP, T-IMP and T-VIM, the other pairwise pairing groupings can also be detected by M-LAMP. B is the real-time fluorescence amplification curve of different concentrations of T-KPC and T-IMP, C is the quantitative analysis result of different concentrations of T-KPC and T-IMP, that is, the linear relationship between the end fluorescence value and the logarithmic concentration, D is the real-time fluorescence amplification curve of different concentrations of T-NDM and T-OXA-48, E is the real-time fluorescence amplification curve of different concentrations of T-IMP and T-VIM. Error bars represent the standard deviation of at least three independent experiments, and the corresponding target genes are marked in each panel.

[0031] Figure 5 It is a triple detection mode for carbapenemase genes. Among them, A is a schematic diagram of the probe design and reaction system composition of the triple detection mode (taking T-KPC, T-NDM, and T-OXA-48 as examples), B is the end fluorescence intensity of carbapenemase genes at different concentrations, and C is the quantitative analysis result of carbapenemase genes at different concentrations.

[0032] Figure 6 It is a schematic diagram for the detection of clinical strains. Among them, A is the comparison of Ct values of five CPKP strains detected using the KPC recognition probe in the single detection mode, B is the comparison of Ct values of five CPKP strains detected using the NDM recognition probe in the single detection mode, C is the comparison of Ct values of five CPKP strains detected using the OXA-48 recognition probe in the single detection mode, and D is the comparison of end fluorescence values between CPKP strains co-expressing two drug resistance genes (NDM and OXA-48) and non-specific CPKP strains with different combinations in the double detection mode. Error bars represent the standard deviation of at least three independent experiments.

[0033] Figure 7 It is the design schematic diagram of the LHP and RHP of the present invention. Detailed implementation manners

[0034] The present invention will be specifically described below in combination with the detailed implementation manners and embodiments, and the advantages and various effects of the present invention will be presented more clearly therefrom. Those skilled in the art should understand that these detailed implementation manners and embodiments are used to illustrate the present invention rather than limit the present invention.

[0035] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as having the meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as the general understanding of those skilled in the art to which the present invention belongs. In case of contradiction, this specification shall prevail.

[0036] Unless otherwise specifically stated, various raw materials, reagents, instruments, and equipment used in the present invention can be obtained through market purchase or by existing methods.

[0037] To solve the above technical problems, the overall idea of the present invention is as follows: The LAMP system consists of a recognition probe group, a primer group (including a forward primer, a reverse primer, and a loop primer), and a signal probe (MB). Among them, the recognition probe group is the only variable component, while the primer group and the signal probe (MB) are both of fixed designs.

[0038] The recognition probe set consists of a pair of stem-loop structured probes (LHP and RHP) and 0 to 2 linear structured probes (IP), where the number of IP probes depends on the number of drug-resistant genes to be detected simultaneously.

[0039] The detection mechanism of LAMP is as Figure 1 shown. When detecting the five carbapenemase families using the single detection mode, 5 groups of LHP and RHP are required, and the purple parts are used to identify the five drug-resistant genes respectively.

[0040] When using the dual detection mode, each group of detection requires a pair of LHP and RHP and one IP probe. The purple part of LHP and the 5'-end of IP are used to identify drug-resistant gene 1, and the 3'-end of IP and the purple part of RHP are used to identify drug-resistant gene 2.

[0041] When using the triple detection mode, in addition to a pair of LHP and RHP, two IP probes are also required. The purple part of LHP and the 5'-end of IP1 are used to identify drug-resistant gene 1, the 3'-end of IP1 and the 5'-end of IP2 are used to identify drug-resistant gene 2, and the 3'-end of IP2 and the purple part of RHP are used to identify drug-resistant gene 3.

[0042] Regardless of single, dual or triple detection, under the action of drug-resistant genes and T4 DNA ligase, the M-LAMP system will finally form a dumbbell-shaped DNA template (DB-DNA). Subsequently, under the action of components such as primer sets, DNA polymerase, dNTPs, etc., an exponential amplification reaction is initiated using the dumbbell-shaped DNA as a template to generate a large number of amplification products containing stem-loop structures. At the same time, signal output is performed on the amplification products through MB, and real-time signal monitoring can be achieved.

[0043] In M-LAMP, for different target analytes to be detected, only the target binding sites will change, while the primer binding sites and signal probe binding sites are fixed. Thus, a set of LAMP primers and signal probes can be used to achieve single, double, and triple detections simultaneously, avoiding the cumbersome and time-consuming primer and signal probe design and optimization processes. In addition, we use molecular beacons (MBs) as signal probes to specifically recognize LAMP products, thereby achieving real-time fluorescence signal output, avoiding open-cap operations, reducing the generation of non-specific signals, and the modification at both ends of the fluorescent groups in MBs is not restricted, making it more potential for multiplex detection. Based on the above design, M-LAMP can complete the efficient detection of five major drug-resistant gene families within 50 minutes, with a detection limit as low as the aM level. This innovative design effectively solves the two major problems existing in current LAMP-based carbapenemase detection, namely the complexity of primer design and optimization and the risk of false positives, significantly improving the reliability and timeliness of detection results. Therefore, M-LAMP is particularly suitable for resource-limited areas and on-site detection environments that require rapid response, providing an efficient, convenient, and economical solution for drug-resistant gene detection.

[0044] The present application will be described in detail below in conjunction with examples, comparative examples, and experimental data.

[0045] Example 1: A Multimodal Nucleic Acid Detection Kit Based on a Ligation-Primed LAMP-Assisted Molecular Beacon System This kit includes the following reagents: (1) Buffer composition: 50 mM Tris-HCl (pH 7.5), 2.67 M NaCl, 10 mM MgCl2, 1 mM ATP, 10 mM DTT.

[0046] (2) Probes LHP / RHP / IP; LHP / RHP / IP are mixed in equimolar amounts (final concentration 42.7 nM), heated at 95°C for 5 minutes, and then cooled to room temperature at 0.1°C / s to form a stem-loop structure.

[0047] (3) Primer set: including a forward primer, a reverse primer, and a loop primer, with nucleotide sequences shown in SEQ ID NO.9 - SEQ ID NO.11 respectively; (4) Signal probe MB, shown in SEQ ID NO.12.

[0048] Example 2: Single Detection (Taking KPC, NDM, OXA-48, VIM, and IMP as Examples) I. The reaction process is as follows: Probe hybridization: Incubate LHP-KPC (42.7 nM) or RHP-KPC (42.7 nM) with the target DNA (synthetic 22-nt KPC mimic fragment) at 25 °C for 10 minutes to form a hybrid.

[0049] Ligation and amplification: Ligation conditions: 25 °C for 30 minutes; LAMP amplification conditions: 63 °C for 60 minutes.

[0050] Signal detection: MB-KPC monitors the fluorescence signal in real time.

[0051] II. The specific steps are as follows: 1. Reaction steps Conventional reaction process: First, prepare 42.7 nmol / L of LHP and RHP (sequences are SEQ ID NO.23 and SEQ ID NO.24 in Table 2) with a buffer (50 mM Tris-HCl, 2.67 M NaCl, 10 mM MgCl2, 1 mM ATP, 10 mM DTT, pH 7.5). Then, anneal equimolar amounts of LHP (42.7 nmol / L) and RHP (42.7 nmol / L) (heat at 95 °C for 5 minutes and then cool to room temperature at a rate of 0.1 °C / s) to prepare the recognition probe solution for the single detection mode.

[0052] Subsequently, take 3 μL of the recognition probe solution obtained in the above step and mix it with 5 μL of the target (CGTGCAATACAGTGATAACGCC) at different concentrations from 516 amol / L to 516 pmol / L, and incubate at room temperature for 10 minutes to form a triple-stranded hybrid.

[0053] Add 8 μL of the triple-stranded hybrid to a ligation system containing 0.5 μL of T4 DNA ligase, 1 μL of 10× T4 DNA ligase reaction buffer, and 0.5 μL of water (the above ligation system can be scaled up equally). Incubate the solution at 25 °C for 30 minutes, and then incubate at 65 °C for 10 minutes to inactivate the T4 DNA ligase.

[0054] III. Experimental results Taking KPC as an example, the detection limit reaches the aM level, and the linear range is 516 aM - 516 pM (R² = 0.99); Closed-tube operation avoids contamination and reduces the false positive rate.

[0055] IV. Optimization of reaction effects 1. Optimization of MB As Figure 1As shown, the signal probe MB binds to the blue region of the amplification product through nucleotide complementary pairing, thereby opening its own stem-loop structure and releasing a fluorescence signal to achieve specific signal output. During the design of MB, we first removed the primer binding sites and sequences with secondary structures in the LHP and RHP, and then selected the loop sequence of LHP (blue region) as the binding site of MB.

[0056] To balance the interaction between stem-loop structures, we designed an MB with a 6-nt stem (SEQ ID NO.12). Taking the single detection of KPC as an example, we used MB and SYBR Green to detect 516 fM / 51.6 pM of KPC respectively ( Figure 2 ).

[0057] As Figure 2 shown by the results, MB showed a significant background fluorescence delay effect compared with SYBR Green and had a high signal-to-noise ratio. We finally selected MB as the signal probe for M-LAMP.

[0058] 2. Detection performance First, the single detection mode was used to detect the five carbapenemase families (KPC, NDM, OXA-48, VIM, and IMP). As Figure 3 shown in A, five groups of LHP and RHP need to be designed respectively (as shown in Table 2), and each group of drug-resistant gene detection shares a set of amplification primers (SEQ ID NO.9-11) and MB (SEQ ID NO.12).

[0059] Under optimized conditions, the detection sensitivities of the M-LAMP method for the target sequences of T-KPC, T-NDM, T-OXA-48, T-VIM, and T-IMP were evaluated ((R² = 0.99) ( Figure 3 B-3G).

[0060] The M-LAMP method demonstrated high flexibility and wide target applicability. By simply adjusting the recognition regions of LHP and RHP to the complementary sequences of drug-resistant genes, the efficient detection of KPC, IMP, VIM, NDM, and OXA-48 sequences can be achieved, further verifying the versatility of this method.

[0061] Example 3: Dual detection (KPC + IMP combination) 1. Composition of the kit (1) Recognition probe group: LHP-KPC: Stem-loop probe targeting the KPC gene, with the same sequence as in Example 1, see Table 2; RHP-IMP: Stem-loop probe targeting the IMP gene), with the same sequence as in Example 1, see Table 2; IP1 probe: Use the IP1 probe to bridge the LHP and RHP linear probes. The 5'-end is complementary to the KPC sequence, and the 3'-end is complementary to the IMP sequence. The sequences are shown in Table 3 and the appendix Figure 4 A.

[0062] (2) Fixed primer set: The same as in Example 1; (3) Signal probe: The sequence is the same as in Example 1.

[0063] 2. Dual detection mode The drug-resistant genes were detected using a dual detection mode. Corresponding LHPs, RHPs, and IPs were designed for the T-KPC and T-IMP groups, T-NDM and T-OXA-48 groups, and T-VIM and T-IMP groups respectively ( Figure 4 A). The designs of LHPs and RHPs are shown in Table 2, and the IP design is as follows in Table 3.

[0064] Table 3 3. Reaction steps Probe hybridization: Mix LHP-KPC (42.7 nM), RHP-IMP (42.7 nM), and IP1 probe (42.7 nM), and incubate with the target DNA (KPC + IMP) at 25 °C for 10 minutes to form a multi-strand hybrid ( Figure 4 A).

[0065] Ligation and amplification: T4 DNA ligase seals the gaps between the LHP, IP, and RHP probes to generate a dumbbell-shaped template; the LAMP amplification conditions are the same as in Example 1.

[0066] Signal detection: The MB fluorescence signal distinguishes the individual or co-existing signals of KPC and IMP.

[0067] 4. Experimental results Under the optimal conditions, we evaluated the detection effects of the M-LAMP method on the T-KPC and T-IMP groups, T-NDM and T-OXA-48 groups, and T-VIM and T-IMP groups. The results showed that within the range of 516 fM to 516 pM, a good linear relationship (R² = 0.99) was observed ( Figure 4 B-4E).

[0068] Dual detection linear range 516 fM - 516 pM (R² = 0.99), anti-interference verification: In the presence of a high concentration (516 pM) of a single target, the other target can still be accurately detected ( Figure 4 C).

[0069] Example 3: Triple detection mode (co-detection of KPC + NDM + OXA-48 genes) 1. Experimental purpose: To verify the scalability and sensitivity of concatenating LHP / RHP through IP1 and IP2 probes under triple detection mode.

[0070] 2. Kit composition (simultaneously detecting T-KPC, T-NDM, and T-OXA-48) (1) Recognition probe set: LHP-KPC: A stem-loop probe targeting the KPC gene, with the same sequence as in Example 1 shown in Table 2; RHP-OXA-48: A stem-loop probe targeting the OXA-48 gene, with the same sequence as in Example 1 shown in Table 2; IP1 probe: The 5'-end is complementary to the KPC sequence, and the 3'-end is complementary to the NDM sequence, with the sequence shown in Table 4; IP2 probe: The 5'-end is complementary to the NDM sequence, and the 3'-end is complementary to the OXA-48 sequence, with the sequence shown in Table 4.

[0071] Use IP1 and IP2 probes to concatenate LHP / RHP; Table 4 Among them, the 3'-end (11 nt) of LHP and the 5'-end (11 nt) of IP1 are complementary to T-KPC, the 3'-end (11 nt) of IP1 and the 5'-end (11 nt) of IP2 are complementary to T-NDM, and the 3'-end (11 nt) of IP2 and the 5'-end (11 nt) of RHP are complementary to T-OXA-48.

[0072] (2) Fixing primer set: The same as in Example 1; (3) Signal probe: The same as in Example 1.

[0073] 3. Reaction steps Probe hybridization: Mix LHP-KPC (42.7 nM nM), RHP-OXA-48 (42.7 nM nM), IP1 (42.7 nM nM), and IP2 (42.7 nM nM), and incubate with the target DNA (KPC + NDM + OXA-48) at 25°C for 10 minutes to form a multi-strand hybrid ( Figure 5 A).

[0074] Ligation and amplification: T4 DNA ligase seals the gaps between LHP, IP1, IP2, and RHP to generate a nested dumbbell-shaped template; The LAMP amplification conditions are the same as in Example 1.

[0075] Signal detection: Real-time monitor the fluorescence signal through MB.

[0076] 4. Experimental results Modular scalability verification: Only by adjusting the IP probe sequence can it be adapted to new targets (such as VIM gene).

[0077] Results show: Sensitivity test: The target concentration gradient is 516 fM - 516 pM, and the linear range of triple detection is 516 fM - 516 pM (R² = 0.96).

[0078] In the concentration range of 516 fM to 516 pM, we observed a good linear relationship (R² = 0.96) ( Figure 5 B-5C).

[0079] 5. Summary: As can be seen from the above Examples 2, 3 and 4: For the dual detection mode and the triple detection mode, only the composition of the recognition probe solution is adjusted, and its concentration and volume are the same as those of the single detection system. In the dual detection mode, the recognition probe solution consists of LHP, RHP and IP; in the triple detection mode, the recognition probe solution contains LHP, RHP, IP1 and IP2. As the detection mode changes from single, dual to triple detection mode, the number of added targets also increases accordingly.

[0080] Table 5 As can be seen from the above, the kit of the present application has the following advantages: Probe modularity: Only by adjusting the recognition probe group (LHP / RHP / IP) can the detection mode be switched, and the amplification primer group and signal probe are universal; the IP probe is designed as a "molecular bridge" to connect different LHP / RHP, avoiding repeated design of the primer group.

[0081] Advantages of closed-tube operation: The lid does not need to be opened throughout the process, and the MB probe directly binds to the stem-loop region. Compared with SYBR Green, when the MB signal is output, the fluorescence intensity of the background signal is reduced, and the peak starting time is also longer.

[0082] Example 4. Detection of clinical strains 1. Clinical strain detection process: Inoculate CRE clinical strains into an appropriate culture medium and incubate overnight at 37°C for 15 hours. Subsequently, extract plasmid DNA using a kit and measure the plasmid concentration and purity (A260 / A280 ratio) using a NanoDrop spectrophotometer. On this basis, use M-LAMP to detect the carbapenemase genes carried by bacteria. Specifically, heat the extracted plasmid DNA at 95°C for 10 minutes to completely denature the double-stranded structure, and then immediately cool it on ice to 4°C. Next, incubate the heat-denatured plasmid with the pre-annealed recognition probe solution at 25°C for 10 minutes to allow the probe to specifically bind to the target sequence and form a stable multi-stranded hybrid. Finally, perform ligation and amplification reactions.

[0083] 2. Clinical strain detection First, we detected CPKP strains that express only a single resistance gene (taking IMP, KPC, and OXA-48 as examples). In the single detection mode, the IMP recognition probe, KPC recognition probe, and OXA-48 recognition probe showed the best detection effects on Klebsiella pneumoniae producing IMP (IMP), Klebsiella pneumoniae producing KPC (KPC), and Klebsiella pneumoniae producing OXA-48 (OXA-48) respectively, while the response signals to non-specific CPKP strains were extremely low ( Figure 6 A-6C). In addition, no obvious cross-reaction was observed between each CPKP and non-specific probes, further confirming the specific discrimination ability of M-LAMP for CPKP in the single detection mode. We further conducted experiments on CPKP strains co-expressing two resistance genes (taking Klebsiella pneumoniae co-producing NDM and OXA-48 as an example) in the double detection mode ( Figure 6 D). The results showed that M-LAMP could effectively distinguish CPKP strains with different combinations of resistance genes.

[0084] Finally, it should also be noted that the term "comprises", "comprising", or any other variation thereof is intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a series of elements includes not only those elements but also other elements not expressly listed, or elements that are inherent to such process, method, article, or apparatus.

[0085] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications once they learn the basic creative concept. Therefore, the appended claims are intended to be construed to include the preferred embodiments as well as all changes and modifications falling within the scope of the present invention.

[0086] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims

1. A nucleic acid detection kit based on a connection-initiated LAMP-assisted molecular beacon system, characterized in that It includes the following components: Recognition probe set: It consists of a pair of stem-loop structure probes, LHP and RHP; The sequence composition of the LHP is: 5'-the first stem + the first loop + the second stem + nucleotide TTT + the first recognition site-3'. The nucleotide sequences of the first stem, the first loop, and the second stem are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3 respectively; wherein, the nucleotide sequences of the first stem and the second stem are complementary to each other; the first recognition site recognizes the target sequence through nucleotide complementary pairing; The sequence composition of the RHP is: 5'-recognition site + nucleotide TTT + the third stem + the second loop + the fourth stem-3'. The nucleotide sequences of the second recognition site, the third stem, the second loop, and the fourth stem are shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6 respectively; wherein, the nucleotide sequences of the third stem and the fourth stem are complementary to each other; the second recognition site recognizes the target sequence through nucleotide complementary pairing; Primer set: It includes a forward primer, a reverse primer, and a loop primer, and the nucleotide sequences are shown in SEQ ID NO.7 - SEQ ID NO.9 respectively; Signal probe: A molecular beacon with a nucleotide sequence shown in SEQ ID NO.10, and the fluorophore and quencher are modified at both ends, specifically binding to the LAMP amplification product and outputting a real-time fluorescence signal.

2. The nucleic acid detection kit of the LAMP-assisted molecular beacon system based on connection initiation according to claim 1, wherein It also includes an IP probe with a linear structure, wherein, In the dual detection, two targets, target 1 and target 2, are detected simultaneously. The IP probe is IP1, and its sequence composition is: 5'-target 1 complementary region + target 2 complementary region-3'. The sequence of the target 1 complementary region is complementary to 11 nucleotides starting from the 5' end of target 1, and the sequence of the target 2 complementary region is complementary to 11 nucleotides starting from the 3' end of target 2; In the triple detection, three targets, target 1, target 2, and target 3, are detected simultaneously. The IP probe includes IP1 and IP2, The sequence composition of IP1 is: 5'-target 1 complementary region + target 2 first complementary region-3'. The sequence of the target 1 complementary region is complementary to 11 nucleotides starting from the 5' end of target 1, and the sequence of the target 2 first complementary region is complementary to 11 nucleotides starting from the 3' end of target 2; The sequence composition of IP2 is: 5'-target 2 second complementary region + target 3 complementary region-3'. The sequence of the target 2 second complementary region is complementary to 11 nucleotides starting from the 5' end of target 2, and the sequence of the target 3 complementary region is complementary to 11 nucleotides starting from the 3' end of target 3.

3. The nucleic acid detection kit based on the connection-initiated LAMP-assisted molecular beacon system according to claim 1, characterized in that, The stem-loop structure probe includes at least one of the following 5 groups: For the KPC target, the sequence of the recognition site of the LHP is shown in SEQ ID NO.11, and the sequence of the recognition site of the RHP is shown in SEQ ID NO.12; For the NDM target, the sequence of the recognition site of the LHP is shown in SEQ ID NO.13, and the sequence of the recognition site of the RHP is shown in SEQ ID NO.14; For the OXA-48 target, the sequence of the recognition site of the LHP is shown in SEQ ID NO.15, and the sequence of the recognition site of the RHP is shown in SEQ ID NO.16; For the VIM target, the sequence of the recognition site of the LHP is shown in SEQ ID NO.17, and the sequence of the recognition site of the RHP is shown in SEQ ID NO.18 For the IMP target, the sequence of the recognition site of the LHP is shown in SEQ ID NO.19, and the sequence of the recognition site of the RHP is shown in SEQ ID NO.

20.

4. The method according to claim 1, characterized in that, The detection limit of the kit is as low as the attomolar aM level, and the linear range spans three orders of magnitude with R²≥0.

99.

5. A method for using a nucleic acid detection kit of the LAMP-assisted molecular beacon system based on connection initiation according to any one of claims 1-4, characterized in that, The method includes: Incubating the target nucleic acid with LHP / RHP, or LHP / RHP / IP at room temperature to form a multi-stranded hybrid; Using T4 DNA ligase to catalyze the formation of a dumbbell-shaped DNA template from the multi-stranded hybrid, adding the primer set and the signal probe, and performing LAMP amplification under isothermal conditions, and real-time monitoring of the fluorescence signal by MB.

Images