Primer group for identifying beef and mutton sources based on LAMP-CRISPR-Cas system as well as detection system and method

Abstract

The invention provides a composition for identifying beef and mutton sources based on an LAMP-CRISPR-Cas system. The composition comprises a mutton LAMP primer, a mutton crRNA probe, a beef LAMP primer and a beef crRNA probe. The invention further provides a detection kit containing the composition and an identification method. According to the application, a Cytb gene with relatively high specificity among different species is taken as a target, a crRNA and LAMP amplification primer pair with relatively high specificity and sensitivity is screened out, and a rapid on-site nucleic acid detection technology aiming at sheep and beef derived components is established. Wherein the detection sensitivity for the sheep meat-derived component can reach 1pg / mu L, and the detection sensitivity for the beef-derived component can reach 10pg / mu L.

Description

Technical Field

[0001] The present invention belongs to the technical field of food inspection, and specifically relates to a primer set, a detection system, and a method for identifying the meat origins of beef and mutton based on a LAMP-CRISPR-Cas system. Background Art

[0002] Other animal-derived ingredients that may be present in imported fishmeal and meat-and-bone meal significantly increase the risk of foreign livestock infectious diseases spreading to my country, particularly those from cattle and sheep. Therefore, strengthening the detection of beef and mutton-derived ingredients in imported fishmeal and meat-and-bone meal is crucial for strengthening quarantine of imported animal-derived products, preventing the risk of animal diseases, and ensuring the safety of animal husbandry production. In import quarantine, the detection of animal-derived products requires nucleic acid detection technology with high specificity, sensitivity, and accuracy, as well as ease of operation and low cost.

[0003] However, traditional nucleic acid detection technologies for animal-derived product ingredients are mostly based on PCR technology and nucleic acid sequencing technology. These technologies are relatively complex to operate, costly and time-consuming, and are difficult to meet the needs of on-site nucleic acid testing.

[0004] Therefore, there is an urgent need to provide a detection technology that is simple to operate, low in cost, and highly sensitive to meet the needs of import quarantine work. Summary of the Invention

[0005] In view of this, the present invention provides a visual detection method and application for distinguishing between beef and sheep meat components using loop-mediated isothermal amplification technology (LAMP) and CRISPR-Cas12a system, so as to address the shortcomings of traditional nucleic acid detection technology in terms of operational complexity, cost and time consumption, and meet the needs of on-site nucleic acid detection.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions: One of the purposes of the present invention is to provide a composition for identifying the meat source of beef and mutton based on the LAMP-CRISPR-Cas system, the composition comprising mutton LAMP primers, mutton crRNA probes, beef LAMP primers, beef crRNA probes; Among them, the lamb LAMP primers are as follows: Sheep-F3: 5'-CCAACCTCCTTTCAGCAA-3'; Sheep-B3: 5'-GGGAATTTTATCTGTGTCCG-3'; Sheep-LF:5'-TCCTCCTCAGATTCATTCGACTA-3'; Sheep-LB: 5'-CTTCCTCCACGAAAACAGGATCCA-3'; Sheep-FIP: 5'-TCGGGTGAGGGTAGCTTTGTTTCCATATATTGGCACAAACC-3'; Sheep-BIP: 5'-CCTCGCCATAGTTCACCTACTTGGAATTCCTGTGGGGTT-3'; The sheep crRNA probe sequence Sheep-crRNA is: 5'-GGGAAAAUAAAGUGAAAGGC-3'; Beef LAMP primers are as follows: Bos Taurus-F3: 5'-CGGCACAAATTTAGTCGAATG-3'; Bos Taurus-B3: 5'-GTAGGGGTGGAATGGGAT-3'; Bos Taurus-LF: 5'-TCGGGTAAGGGTGCTTTTGT-3'; Bos Taurus-LB: 5'-TTATTCCTCCACGAAACAGGC-3'; Bos Taurus-FIP: 5'-TGGAAGGATAAAATGGAAAGCGAAGGAGGCGGATTCTCAGTAG-3'; Bos Taurus-BIP: 5'-CATAGCAATTGCCATAGTCCACCTATTTGTCTACGTCTGAGGAGAT-3'; The beef crRNA probe sequence, Bos Taurus-crRNA, is: 5'-GGAAUCUCCUCAGACGUAGA-3'.

[0007] The second object of the present invention is to provide a kit for identifying the source of beef and mutton, wherein the kit contains the above-mentioned composition, Cas12a protein, and a fluorescent marker.

[0008] Furthermore, the kit also contains a reaction buffer and auxiliary reagents.

[0009] Furthermore, the reaction buffer comprises a buffer, an ionic solution, and a surfactant; The auxiliary reagents include dNTPs and DNA polymerase.

[0010] A third object of the present invention is to provide a method for identifying the meat source of beef and mutton using the above-mentioned kit, comprising the following steps: S1. Extract genomic DNA of the sample to be tested; S2, using the extracted DNA as a template, amplify using LAMP primers to obtain amplified products; S3, mixing the amplified product with the crRNA probe and Cas12a protein for reaction; S4. After the reaction is completed, fluorescence detection or taking pictures can be used to determine whether the sample contains beef or mutton.

[0011] In some specific embodiments, preferably, the LAMP amplification reaction conditions are as follows: temperature 65°C, time 30-60 min.

[0012] A fourth object of the present invention is to provide a method for verifying the accuracy of the detection results of the above method, comprising the following steps: performing PCR amplification on genomic DNA of a sample to be tested, sequencing the amplified product, and determining whether the sample contains beef or mutton to verify the accuracy of the result; Among them, the lamb PCR primers are as follows: Sheep-cytb-F:5'-GTAACCCACATTTGCCGAGAC-3'; Sheep-cytb-R: 5'-TCCGAGTAAGTCAGGCGTGAATAGT-3'; Beef PCR primers are as follows: Bos Taurus-cytb-F: 5'-ATTTCGGTTCCCTCCTGG-3'; Bos Taurus-cytb-R: 5'-GGGTGTAGTTATCTGGGTCTCC-3'.

[0013] The fifth object of the present invention is to provide the use of the above-mentioned composition, or the above-mentioned kit, or the above-mentioned identification method, or the above-mentioned detection method in distinguishing genuine beef and mutton.

[0014] Compared with the prior art, the present invention has the following beneficial effects: This study, based on the combination of LAMP and CRISPR-Cas12a systems, uses the species-specific Cytb gene as a target. This method screens for highly specific and sensitive crRNA and LAMP amplification primer pairs, establishing a rapid, on-site nucleic acid detection technology for sheep and beef-derived ingredients. The detection sensitivity for sheep-derived ingredients can reach 1 pg / μL, and for beef-derived ingredients, it can reach 10 pg / μL.

[0015] The method provided by the present invention solves the shortcomings of traditional nucleic acid detection technology in terms of operational complexity, cost and time consumption. Its high sensitivity and high specificity can well meet the needs of on-site nucleic acid detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 These are the results of amplifying a 535 bp fragment (216 bp-750 bp) of the ovine and bovine Cytb genes using PCR in Example 1 of the present invention; wherein, A is the amplification result of the ovine Cytb target sequence, the primer used in lane S1 is Sheep-Cytb-1, and the primer used in lane S2 is Sheep-Cytb-2; B is the amplification result of the bovine Cytb target sequence, and the primer used in lane B1 is Bostaurus-Cytb-1.

[0017] Figure 2 Results of screening for highly active crRNAs that can specifically distinguish between ovine and bovine Cytb genes; dsDNA refers to the ovine and bovine Cytb target sequences amplified by PCR, ssDNA refers to the single-stranded DNA target of crRNA, and each crRNA group was designed to use DEPC water as a blank control group for the test samples; "Under blue light" refers to images taken with a mobile phone in a blue light gel excision instrument; A represents the screening for highly active crRNAs, from which Sheep-crRNA-1 and Bos taurus-crRNA-3 were selected; B represents the specificity evaluation of Sheep-crRNA-1 and Bos taurus-crRNA-3.

[0018] Figure 3 The results of screening LAMP amplification primer pairs that can detect the Cytb gene in sheep and cattle are shown in Figure 1. Among them, A is the LAMP amplification of the Sheep-crRNA-1 detection site, the amplification template is sheep genomic DNA, the primers in lanes S1 and S2 are Sheep-1, and S1 is the LAMP amplification blank control group; the primers in lanes S3 and S4 are Sheep-2, and S3 is the LAMP amplification blank control group; B is the CRISPR Cas12a enzyme digestion test of the LAMP amplification product in Figure A, and 0 is the enzyme digestion blank control group; C is the LAMP amplification of the Bos taurus-crRNA-3 detection site, and the amplification template is cattle genomic DNA: the primers in lanes B1 and B2 are Bos taurus-1, B1 is the LAMP amplification blank control group, the primers in lanes B3 and B4 are Bos taurus-2, and B3 is the LAMP amplification blank control group; the primers in lanes B5 and B6 are Bos taurus-3, B5 is the LAMP amplification blank control group; D is the CRISPRCas12a enzyme digestion test of the LAMP amplification product in Figure C, and 0 is the enzyme digestion blank control group.

[0019] Figure 4 Figure 3 is a graph showing the sensitivity of using LAMP-CRISPR-Cas12a technology to detect Cytb genes in cattle and sheep; A is the sensitivity evaluation of LAMP amplification of Sheep-2 primer pair, the amplification template is sheep genomic DNA, S0 is the blank control group for LAMP amplification, and the concentrations of amplification templates in S1-S6 are 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, and 0.1 pg / μL, respectively; B is the sensitivity evaluation of using LAMP-CRISPR-Cas12a technology to detect Cytb genes in sheep: 0 is the enzyme-digested blank control group, and the samples to be tested in S1-S6 are the LAMP gradient amplification products in Figure A; C is the Bos Sensitivity evaluation of LAMP amplification using the taurus-3 primer pair, using bovine genomic DNA as the amplification template: B0 is the LAMP amplification blank control group, and the amplification template concentrations in B1-B6 are 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, and 0.1 pg / μL, respectively. D is the sensitivity evaluation of the bovine Cytb gene using LAMP-CRISPR-Cas12a technology: 0 is the enzyme digestion blank control group, and the samples to be tested in B1-B6 are the LAMP gradient amplification products shown in Figure C. Figure 5 Figure 3: Specificity evaluation of the Cytb gene in cattle and sheep using the LAMP-CRISPR-Cas12a technology. Figure A shows the specificity evaluation of the Sheep-2 and Bos taurus-3 primer pairs for LAMP amplification: lanes S1-S3 use Sheep-2 primers, lanes B1-B3 use Bos taurus-3 primers, S1 and B1 are LAMP amplification blank controls, S2 and B2 amplification templates are sheep genomic DNA, and S3 and B3 amplification templates are bovine genomic DNA. Figure B shows the specificity evaluation of the Cytb gene in cattle and sheep using the LAMP-CRISPR-Cas12a technology: 1 and 2 are enzyme-digested blank controls, and samples S1-S3 and B1-B3 are the LAMP positive mismatch amplification products in A.

[0020] Figure 6This is the result diagram of the detection of beef and mutton-derived components in fish meal and bone meal using LAMP-CRISPR-Cas12a technology; among them, 1, S0-S3 in A are the detection of mutton-derived components in fish meal and bone meal using LAMP-CRISPR-Cas12a technology, 1 is the enzyme digestion blank control group, S0 is the LAMP amplification blank control group, and the samples to be tested in S1-S3 are the genomic DNA of fish meal, beef bone meal, and chicken meal, respectively; 2, B0-B3 are the detection of beef-derived components in fish meal and bone meal using LAMP-CRISPR-Cas12a technology, 2 is the enzyme digestion blank control group, B0 is the LAMP amplification blank control group, and the samples to be tested in B1-B3 are the genomic DNA of fish meal, beef bone meal, and chicken meal, respectively; B is the verification of nucleic acid detection results using PCR, lanes 1-3 use Sheep-Cytb-1 as the amplification primer, and the amplification templates are the genomic DNA of fish meal, beef bone meal, and chicken meal, respectively, and lanes 4-6 use Bos Taurus-Cytb-1 was used as the amplification primer, and the amplification templates were genomic DNA of fish meal, beef bone meal, and chicken meal, respectively.

[0021] Figure 7 Schematic diagram of the process for detecting the Cytb gene in cattle and sheep using LAMP-CRISPR-Cas12a technology. DETAILED DESCRIPTION

[0022] The present invention will be further described in detail below in conjunction with specific examples so that those skilled in the art can more clearly understand the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and all reagents and consumables are commercially available products.

[0023] Example 1 This embodiment provides a method for screening highly active crRNAs that can specifically distinguish between ovine and bovine Cytb genes, comprising the following steps: 1.1 Extraction of genomic DNA from test samples Use the TIANGEN Blood / Cell / Tissue Genomic DNA Extraction Kit (spin column format) to extract genomic DNA from the test samples. The specific steps are as follows: Place approximately 0.05 g of the test sample into a clean 1.5 mL centrifuge tube, add 20 μL of Proteinase K solution, mix thoroughly, and incubate at 56°C until the sample is fully dissolved (vortexing several times during digestion). Store the remaining beef and mutton samples at -80°C, while fish meal, beef bone meal, and chicken meal should be stored at room temperature. Then, extract genomic DNA from the test samples according to the TIANGEN DNA Extraction Kit's instructions.

[0024] 1.2 Identification and PCR amplification of ovine and bovine Cytb target sequences In this example, the cytochrome b (Cytb) gene was selected as the gene used in nucleic acid detection for species differentiation, as follows: Five species (sheep, cattle, rabbit, pig, and horse) were selected for their respective Cytb gene sequences, using the National Center for Biotechnology Information (NCBI) database. Multiple sequence alignments of the Cytb gene sequences of the five species were performed using MEGA 5.0 software to identify cattle and sheep sequence fragments that differed significantly from those of other species. Furthermore, Cytb genes of goats and sheep, as well as cattle and dairy cows, which are widely raised in animal husbandry, were compared within the same species and across different breeds. The highly conserved target sequence fragments of the cattle and sheep Cytb genes (216 bp to 750 bp, a total of 535 bp) were identified, which served as the sequence range for nucleic acid detection of bovine and sheep-derived components.

[0025] Primer Premier 5.0 software was used to design PCR amplification primers for the selected target sequences. The primers were synthesized by Tianyi Huiyuan Biotechnology Co., Ltd. The PCR primers used in this study are shown in Table 1: Table 1 Details of designed PCR sequences

[0026] The PCR reaction system and procedure are shown in Table 2: Table 2 PCR reaction system and procedure details

[0027] After the amplification was completed according to the above primer sequence and reaction procedure, the amplification results were preliminarily verified by agarose gel electrophoresis. Figure 1 As shown by Figure 1 It can be seen that the results show that the two pairs of sheep PCR primers and one pair of cattle PCR primers designed can amplify the target sequence well; among them, the Sheep-Cytb-1 primer and the Bos taurus-Cytb-1 primer with better amplification effect were selected as PCR primers for amplifying the cattle and sheep target sequences, respectively.

[0028] 1.3 Screening for highly active crRNAs that can specifically distinguish between ovine and bovine Cytb genes In view of the significant differences in Cytb sequences between sheep and cattle, we searched for nucleic acid detection sites based on the PAM sequence (5'-TTTN-3') of Cas12a. We designed four crRNAs (Table 3) and downstream primers for PCR amplification of crRNA in vitro transcription templates (Table 4) for cattle and sheep, respectively, and commissioned Tianyi Huayu Company to synthesize them.

[0029] Table 3 Details of designed crRNAs sequences

[0030] Table 4 Details of downstream primer sequences for PCR amplification of crRNA in vitro transcription templates

[0031] Eight crRNA transcription templates were generated by PCR amplification using the pUC57-T7-crRNA plasmid (SEQ ID NO. 1), which contains the crRNA expression sequence, as the template. The T7 plasmid promoter sequence (5'-TAATACGACTCACTATAGGG-3') was used as the upstream primer. The system, in a total volume of 50 μL, contained 1 μL of pUC57-T7-crRNA plasmid, 2.5 μL of the T7 promoter sequence, 2.5 μL of the crRNA-R primer, and 44 μL of 1.1× T3 Super PCR Mix.

[0032] SEQ ID.NO.1 is as follows: 5'-CGAGGGGACGGTGATTGGAGATCGGTACTTCGCGAATGCGTCGAGATGGATCCCTAATACGACTCACTATAGGGAATTTCTACTGTTGTAGATAATCGCATTGCCTCCGTAGTGAATTTTTTAAAGGGCCCGTCGACTG CAGAGGCCTGCATGCAAGCTTATCGGATGCCGGGACCGACGAGTGCAGAGGCGTGCAAGCGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAA-3'.

[0033] The activity of crRNA was tested using CRISPR-Cas12a digestion, using dsDNA (PCR-amplified ovine and bovine Cytb target sequences) and ssDNA as test templates. The digestion system consisted of 20 μL of the following: 1 μL of Cas12a enzyme, 2 μL of rCutSmartBuffer, 600 ng of crRNA, 0.1 μL of ROX ssDNA-reporter, 1 μL of the test sample, and DEPC water to 20 μL. The digestion reaction was incubated at 37°C for 10-15 minutes and terminated at 98°C for 2 minutes. The fluorescence signal was monitored under blue light, and crRNAs with high activity were selected for nucleic acid detection.

[0034] The experimental results are as follows Figure 2As shown in A, the results show that when the corresponding dsDNA is used as the template to be tested, the 8 designed crRNAs can all cause the enzyme digestion system to emit fluorescence. In the crRNA detecting sheep-derived components, the fluorescence of Sheep-crRNA-2 is weaker, while the fluorescence of Sheep-crRNA-1 and Sheep-crRNA-4 is stronger; the 4 crRNAs used to detect bovine-derived components can all cause the system to produce strong fluorescence. When the corresponding ssDNA is used as the sample to be tested, the 8 designed crRNAs can also cause the enzyme digestion system to emit fluorescence. In the crRNA detecting sheep-derived components, the fluorescence of Sheep-crRNA-4 is weaker, while the fluorescence of Sheep-crRNA-1 and Sheep-crRNA-2 is stronger; in the crRNA detecting bovine-derived components, the fluorescence intensity of Sheep-crRNA-3 is stronger, so Sheep-crRNA-1 and Bos taurus-crRNA-3 are selected for nucleic acid detection.

[0035] The PCR amplification products of the sheep and cattle Cytb target sequences were used as test samples for positive and mismatch enzyme digestion reactions to test the specificity of crRNA. The experimental results are as follows Figure 2 As shown in B, the results show that Sheep-crRNA-1 and Bos taurus-crRNA-3 are specific for recognizing the target sequences of the Cytb gene of sheep and cattle.

[0036] Example 2 This embodiment provides a method for screening LAMP amplification primer pairs capable of detecting the Cytb gene in sheep and cattle, and the specific steps are as follows: LAMP primer pairs were designed using the online LAMP primer design tool PrimerExplorer V4 to amplify the selected crRNA-specific binding site sequences. Due to the high sensitivity of LAMP amplification, a negative control group was designed, using DEPC water as the template for amplification. UDG, UDG Buffer, and dUTP were introduced into the amplification system to reduce aerosol contamination that may occur during the amplification process. Agarose gel electrophoresis was used to verify the amplification results of each LAMP primer pair, and LAMP primers with the best amplification performance were selected for nucleic acid detection. The LAMP primer pairs used in this study are shown in Table 5, and the LAMP reaction system and procedure are shown in Table 6.

[0037] Table 5 Details of designed LAMP primer pairs

[0038] Table 6 LAMP reaction system and procedure details

[0039] Each LAMP primer pair was used to amplify the genomic DNA of the corresponding species as the amplification template, and the amplified products were detected by agarose gel electrophoresis. At the same time, the LAMP amplified products were digested by CRISPR Cas12a using the corresponding crRNA. The experimental results are shown in Figure 2. Figure 3 As shown: The Sheep-2 and Bos taurus-3 primer pair can amplify the target sequence and the amplified product can cause the enzyme digestion system to produce fluorescence, so it was selected as the LAMP amplification primer for the sheep and cattle Cytb gene.

[0040] Example 3 This example uses the crRNAs screened in Example 1 and the primers screened in Example 2 to establish the LAMP-CRISPR-Cas12a detection technology and verify its sensitivity. The specific operations are as follows: Sheep and cattle genomic DNA was added to the corresponding LAMP amplification system at concentrations of 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, and 0.1 pg / μL, respectively. The sensitivity of the selected LAMP primers was evaluated by agarose gel electrophoresis. Subsequently, the LAMP gradient amplification products were used as test samples for CRISPR-Cas12a digestion, and the sensitivity of the nucleic acid detection system was evaluated based on the fluorescence of the system under blue light.

[0041] The experimental results are as follows Figure 4 As shown in the figure, agarose gel electrophoresis results show that the LAMP amplification sensitivity of the Sheep-2 primer pair can reach 0.1pg / μL, and the amplification sensitivity of the Bos taurus-3 primer pair can reach 1pg / μL. CRISPR-Cas12a digestion of the LAMP gradient amplification products using the corresponding crRNA showed that the sensitivity of detecting the sheep Cytb gene using the LAMP-CRISPR-Cas12a technology can reach 1pg / μL, and the sensitivity of detecting the cattle Cytb gene can reach 10pg / μL.

[0042] Example 4 This example uses the crRNAs screened in Example 1 and the primers screened in Example 2 to establish the LAMP-CRISPR-Cas12a detection technology and verify its specificity. The specific operations are as follows: Each set of LAMP primers used sheep and cattle genomic DNA as templates for positive-match and mismatch amplification, respectively. Agarose gel electrophoresis was used to determine the specificity of the LAMP primers. Subsequently, the LAMP positive-match and mismatch amplification products were added to the CRISPR-Cas12a enzyme digestion system as test samples, and the specificity of the nucleic acid detection system was evaluated based on the system's fluorescence under blue light.

[0043] The experimental results are as follows Figure 5 As shown in the figure, agarose gel electrophoresis results showed that the Sheep-2 primer pair could specifically amplify sheep genomic DNA but not bovine genomic DNA, while the Bos taurus-3 primer pair had no amplification specificity. The crRNA corresponding to the LAMP primer pair was used to perform CRISPR-Cas12a digestion on the LAMP positive and mismatch amplification products ( Figure 5 B) Experimental results show that the LAMP-CRISPR-Cas12a technology has good specificity for detecting the Cytb gene in sheep and cattle.

[0044] Example 5 Furthermore, to verify the effectiveness of the LAMP-CRISPR-Cas12a detection technology designed in this application for detecting sheep and beef-derived components in fish meal and bone meal, the following experiments were conducted: Peruvian imported fish meal, Australian beef bone meal and chicken meal were used as test samples. The designed nucleic acid detection system was used to detect their main components, and PCR amplification and DNA sequencing were used to verify the nucleic acid detection results.

[0045] The experimental results are as follows Figure 6 Results showed that the nucleic acid detection system for detecting ovine-derived ingredients exhibited strong fluorescence when the LAMP amplification product of beef bone meal was used as the test sample, indicating that the purchased beef bone meal may be adulterated with ovine-derived ingredients. Genomic DNA extracted from Peruvian fish meal, Australian beef bone meal, and chicken meal were used for nucleic acid testing. Fluorescence from the enzyme digestion system indicated that the beef bone meal may contain ovine-derived ingredients.

[0046] Genomic DNA from the three samples was amplified using PCR primers designed to target specific sequences in the sheep and cattle Cytb genes. The Sheep-Cytb-1 primer was found to be capable of amplifying the genomic DNA from beef bone meal, producing a product approximately 500 bp long. DNA sequencing of the amplified product at Tianyi Huiyuan Biotechnology Co., Ltd. revealed 100% overlap with the sheep Cytb target sequence, indicating that the beef bone meal was indeed adulterated with sheep-derived ingredients. This further validates the feasibility and accuracy of the LAMP-CRISPR-Cas12a system for detecting sheep and beef-derived ingredients.

[0047] This study combines LAMP with the CRISPR-Cas12a system, targeting the species-specific Cytb gene. This method screened for highly specific and sensitive crRNA and LAMP amplification primer pairs, establishing a rapid, on-site nucleic acid detection technology for sheep and beef-derived ingredients. The detection sensitivity for sheep-derived ingredients reached 1 pg / μL, and for beef-derived ingredients reached 10 pg / μL.

[0048] The above is only a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A composition for identifying the origin of beef and mutton based on the LAMP-CRISPR-Cas system, characterized in that: The composition includes mutton LAMP primers, mutton crRNA probes, beef LAMP primers, and beef crRNA probes; Among them, the lamb LAMP primers are as follows: Sheep-F3: 5'-CCAACCTCCTTTCAGCAA-3'; Sheep-B3: 5'-GGGAATTTTATCTGTGTCCG-3'; Sheep-LF: 5'-TCCTCCTCAGATTCATTCGACTA-3'; Sheep-LB: 5'-CTTCCTCCACGAAAACAGGATCCA-3'; Sheep-FIP: 5'-TCGGGTGAGGGTAGCTTTGTTTCCATATATTGGCACAAACC-3'; Sheep-BIP: 5'-CCTCGCCATAGTTCACCTACTTGGAATTCCTGTGGGGTT-3'; The sheep crRNA probe sequence Sheep-crRNA is: 5'-GGGAAAAUAAAGUGAAAGGC-3'; Beef LAMP primers are as follows: Bos Taurus-F3: 5'-CGGCACAAATTTAGTCGAATG-3'; Bos Taurus-B3: 5'-GTAGGGGTGGAATGGGAT-3'; Bos Taurus-LF: 5'-TCGGGTAAGGGTGCTTTTGT-3'; Bos Taurus-LB: 5'-TTATTCCTCCACGAAACAGGC-3'; Bos Taurus-FIP: 5'-TGGAAGGATAAAATGGAAAGCGAAGGAGGCGGATTCTCAGTAG-3'; Bos Taurus-BIP: 5'-CATAGCAATTGCCATAGTCCACCTATTTGTCTACGTCTGAGGAGAT-3'; The beef crRNA probe sequence, Bos Taurus-crRNA, is: 5'-GGAAUCUCCUCAGACGUAGA-3'.

2. A kit for identifying the origin of beef and mutton, characterized in that: The kit contains the composition according to claim 1, Cas12a protein, and a fluorescent marker.

3. The kit according to claim 2, wherein The kit also contains a reaction buffer and auxiliary reagents.

4. The kit according to claim 3, wherein The reaction buffer comprises a buffer, an ionic solution, and a surfactant; The auxiliary reagents include dNTPs and DNA polymerase.

5. A method for identifying the origin of beef and mutton using the kit according to any one of claims 2 to 4, characterized in that: The following steps are involved: S1. Extract genomic DNA of the sample to be tested; S2, using the extracted DNA as a template, amplify using LAMP primers to obtain amplified products; S3, mixing the amplified product with the crRNA probe and Cas12a protein for reaction; S4. After the reaction is completed, fluorescence detection or taking pictures can be used to determine whether the sample contains beef or mutton.

6. The method according to claim 5, characterized in that The LAMP amplification reaction conditions were as follows: temperature 65°C, time 30–60 min.

7. A method for verifying the accuracy of the detection result of the method according to claim 5, characterized in that: The following steps are involved: Take the genomic DNA of the sample to be tested for PCR amplification, and sequence the amplified product to determine whether the sample contains beef or mutton to verify the accuracy of the result; Among them, the lamb PCR primers are as follows: Sheep-cytb-F:5'-GTAACCCACATTTGCCGAGAC-3'; Sheep-cytb-R: 5'-TCCGAGTAAGTCAGGCGTGAATAGT-3'; Beef PCR primers are as follows: Bos Taurus-cytb-F: 5'-ATTTCGGTTCCCTCCTGG-3'; Bos Taurus-cytb-R: 5'-GGGTGTAGTTATCTGGGTCTCC-3'.

8. Use of the composition according to claim 1, or the kit according to any one of claims 2 to 4, or the method according to claim 6, or the method according to claim 7 in identifying genuine beef or mutton.

Images