Method for quantitatively detecting viable bacteria of lactobacillus reuteri, lactobacillus rhamnosus, lactobacillus paracasei and lactobacillus acidophilus

Abstract

The invention discloses a method for quantitatively detecting viable bacteria of lactobacillus reuteri, lactobacillus rhamnosus, lactobacillus paracasei and lactobacillus acidophilus. The novel molecular detection target disclosed by the invention has high specificity on target bacteria. The disclosed PMA-qPCR method comprises the steps of target detection, qPCR primer and probe design, qPCR detection system, PMA treatment condition and viable bacteria quantitative standard curve. After qPCR amplification, if a Cq value appears, the dissolution peak is single and the dissolution temperature is consistent with that of a positive sample (only aiming at a dye method), the lactic acid bacteria are identified as target lactic acid bacteria, and the number of viable bacteria can be calculated according to a corresponding standard curve. The method can effectively detect and count viable bacteria of Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus paracasei and Lactobacillus acidophilus, has the advantages of rapidness, accuracy, simple operation and the like, and is convenient for food enterprises and inspection institutions to use.

Description

Technical Field:

[0001] The present invention belongs to the field of biotechnology, and specifically relates to new molecular markers, detection primers, probes and detection methods that can be used to identify and count viable cells of Limosilactobacillus reuteri, Lacticaseibacillus rhamnosus, Lacticaseibacillus paracasei and Lactobacillus acidophilus. Background Art:

[0002] Research has shown that the health effects of probiotics depend on specific strains and viable cell numbers. Therefore, probiotic foods must contain clearly defined strains and maintain a certain number throughout the shelf life. China's current standards have clear requirements for the types and numbers of strains in probiotic foods (for details, see the Lists of Strains Allowed for Use in Foods, Lists of Strains Allowed for Use in Infant Foods, and the Group Standard General Rules for Probiotics Used in Foods). The types and numbers of strains in probiotic foods have become important indicators for evaluating product quality.

[0003] The genus Lactobacillus is the largest and most diverse genus among lactic acid bacteria (LAB). Lactobacillus mucosae, Lactobacillus rhamnosus, Lactobacillus paracasei, and Lactobacillus acidophilus have various probiotic effects such as immunomodulation, improving gastrointestinal health, and treating or alleviating inflammation-related diseases, and can be used in the production of health foods and are widely used in various probiotic products. However, due to the high similarity of phenotypic characteristics and genomes of some species of Lactobacillus bacteria, it is very difficult to identify them using the traditional national standard method (GB 4789.35-2023), especially for complex probiotic products containing multiple lactic acid bacteria. It is often difficult to achieve accurate identification, viability assessment, and viable cell counting of Lactobacillus. In addition, traditional methods also have problems such as cumbersome operation, long detection cycle (usually 7-10 days), and inability to report results in a timely manner. This complicates the manufacturing, quality control, and standard processes of high-quality probiotic products. Compared with traditional methods, the PMA-qPCR (Propidium Monoazide Quantitative PCR) detection method has outstanding advantages such as high sensitivity, strong specificity, wide applicability, and the ability to perform viability assessment. This technology combines real-time quantitative polymerase chain reaction (qPCR) with Propidium Monoazide (PMA). While retaining the advantages of qPCR technology, it excludes the interference of dead cell DNA of bacteria through PMA treatment. In qPCR analysis, only the DNA of live cells participates in amplification, improving the accuracy of the analysis. It has been widely used in the quantitative detection of viable microorganisms in fields such as food safety, clinical diagnosis, and water quality monitoring.

[0004] Currently, PMA-qPCR detection methods for Lactobacillus mucosae, Lactobacillus rhamnosus, Lactobacillus paracasei, and Lactobacillus acidophilus have been reported. The PMA-qPCR method established by Yang et al. can quantify 24 live lactic acid bacteria such as Lactobacillus mucosae in fermented dairy products in about 3 hours, greatly improving the detection efficiency. However, most of the target genes in existing studies are mainly 16S rRNA, pheS, and tuf, with relatively insufficient specificity. Species-specific targets screened at the genomic level have higher accuracy and reliability, and at the same time, processes such as further sequencing can be omitted, significantly shortening the detection time. Scholar Kim screened Lactobacillus molecular targets at the genomic level but could not perform viable cell quantification. Lizheng Gu et al. screened molecular targets of Lactobacillus paracasei through genomic comparison and established a qPCR detection technology, which is only suitable for the quantitative detection of one Lactobacillus in probiotic products.

[0005] Through the pan-genome analysis and comparative genomics analysis of more than 900 Lactobacillus strains, the present invention screened 4 novel specific molecular targets of Lactobacillus. Through NCBI-BLAST alignment and qPCR amplification, the specificity and accuracy of the targets were confirmed. On this basis, a PMA-qPCR viable bacteria quantification detection method was constructed, which can achieve high-throughput and accurate detection and quantification of the viable bacteria of 4 Lactobacillus strains, namely Limosilactobacillus reuteri, Lacticaseibacillus rhamnosus, Lacticaseibacillus paracasei, and Lactobacillus acidophilus, at one time. Summary of the Invention:

[0006] The first object of the present invention is to provide specific molecular markers for the rapid detection and counting of viable bacteria of Limosilactobacillus reuteri, Lacticaseibacillus rhamnosus, Lacticaseibacillus paracasei, and Lactobacillus acidophilus.

[0007] When screening the specific molecular markers of the above strains, the present invention performed a pan-genome analysis on 998 sequenced Lactobacillus strains of various types in the NCBI database. After sequence alignment analysis, one specific molecular detection target for each of Limosilactobacillus reuteri, Lacticaseibacillus rhamnosus, Lacticaseibacillus paracasei, and Lactobacillus acidophilus was screened out, and the obtained novel molecular detection targets have not been reported at home and abroad. The primer sets and probes designed for the novel molecular targets were confirmed to have high specificity for the target bacteria by qPCR amplification. Compared with the 16S rRNA PCR method and physiological and biochemical methods, the PMA-qPCR method established in the present invention has higher specificity and accuracy, can greatly shorten the identification cycle, and reduce the detection cost. It is particularly suitable for the synchronous rapid identification and viable bacteria counting of different Lactobacillus strains in large batches of compound probiotic products.

[0008] The specific molecular markers for identifying Limosilactobacillus reuteri, Lacticaseibacillus rhamnosus, Lacticaseibacillus paracasei, and Lactobacillus acidophilus of the present invention have nucleotide sequences as shown in genomic_00800, genomic_00068, genomic_01690, and genomic_00035.

[0009] The second object of the present invention is to provide a primer set and a probe for the identification of Limosilactobacillus reuteri, Lacticaseibacillus rhamnosus, Lacticaseibacillus paracasei, and Lactobacillus acidophilus, as follows:

[0010] A. For Limosilactobacillus reuteri:

[0011] Lr_F: 5'-AATGATGACACCCCAACACG-3'

[0012] Lr_R: 5'-TACGGGGATGATGTTGGTGA-3'

[0013] P149: 5'-FAM-TGTTCCGCTTTGGTAAACACAGACTAA-BHQ1-3'

[0014] B. Lactobacillus rhamnosus:

[0015] Lrh_F: 5'-TGGGCATCCCGTATCATCTA-3'

[0016] Lrh_R: 5'-GAGACTCGCTCAGGCAAAA-3'

[0017] P214: 5'-FAM-ATTCTTCTCAATGCGCCAATCGATG-BHQ1-3'

[0018] C. For Lactobacillus paracasei:

[0019] Lp_F: 5'-TGGAGGGCATCATTGGCAAC-3'

[0020] Lp_R: 5'-GCACCGGAAAGGCACAGTAAC-3'

[0021] P181: 5'-FAM-CCCAACATCAAGAATACCTGCGCTT-BHQ1-3'

[0022] A. For Lactobacillus acidophilus:

[0023] La_F: 5'-TGAAAGAATGGCTATCCGTC-3'

[0024] La_R: 5'-AAGCAGTATCGCTTGTTTCTG-3'

[0025] P104: 5'-FAM-TGTAATTCCTGCTACTACTGTTCCTGCAC-BHQ1-3'

[0026] The third object of the present invention is to provide a condition for PMA treatment of Limosilactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus paracasei and Lactobacillus acidophilus (bacterial concentration is about 10 8 cfu / mL), including the following steps:

[0027] Under light - avoiding conditions, aseptically aspirate the PMA solution and add it to the sample to prepare a sample homogenate with a final PMA concentration of 20 - 40 μmol / L. Place it in the dark and incubate at room temperature for 15 min (invert and mix well every 5 min). Place it on ice, 20 cm away from a 500 - W tungsten halogen lamp, and expose it for 15 - 30 min (the tube mouth is perpendicular to the ice surface). After the exposure, centrifuge at 12000 r / min for 2 min at room temperature, and discard the supernatant (if there are few bacteria, the bacteria can be resuspended with ultrapure water and centrifuged again to discard the supernatant to wash away the excess PMA dye).

[0028] The fourth object of the present invention is to provide a kit for identifying and counting viable bacteria of Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus paracasei, and Lactobacillus acidophilus, which includes a bacterial DNA extraction reagent, a qPCR reaction reagent, a live cell dye (PMA), and the above - mentioned identification primer sets and / or probes.

[0029] The fifth object of the present invention is to provide a method for identifying and counting viable bacteria of Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus paracasei, and Lactobacillus acidophilus for non - disease diagnosis and treatment purposes, including the following steps:

[0030] Mix the sample to be tested with sterile phosphate - buffered saline in a certain proportion to prepare a bacterial suspension, and then perform PMA photo - activation treatment on the bacterial suspension; use a DNA extraction kit to isolate genomic DNA from the treated bacterial suspension; perform qPCR detection with the above - mentioned specific primer sets and probe systems, and perform quantitative analysis on the amplification results according to the established standard curve to obtain the absolute number of viable bacteria in the sample. If Cq ≤ 35, the melting peak is single and consistent with the positive group (only for the dye method), then it is judged as the target bacterium, and the viable bacteria count is calculated by substituting it into the standard curve; if 35 < Cq < 40, repeat the experiment. If the result still shows Cq > 35, then it is determined as non - target bacteria or contamination such as aerosol.

[0031] The qPCR detection described above can be the dye method: The reaction system (20 μL) includes 0.5 - 1.2 μL of upstream and downstream target DNA - specific primers with a concentration of 10 μmol / L (0.5 μL for Lactobacillus reuteri and Lactobacillus paracasei, 1.2 μL for Lactobacillus rhamnosus and Lactobacillus acidophilus), TB Premix Ex Taq TM10 μL of II(Tli RNaseH Plus) dye, 2.0 μL of DNA template, and sterile deionized water was added to make up to 20 μL. The amplification program was pre-denaturation at 95 °C for 60 - 300 s (300 s for Lactobacillus mucosae, 150 s for Lactobacillus paracasei, 30 s for Lactobacillus rhamnosus and Lactobacillus acidophilus), 1 cycle; two-step amplification at 95 °C for 5 s, 60 - 65 °C for 20 - 30 s (65 °C for 20 s for Lactobacillus mucosae, 62 °C for 30 s for Lactobacillus rhamnosus, 62 °C for 20 s for Lactobacillus paracasei, 61 °C for 20 s for Lactobacillus acidophilus; fluorescence collection), 40 cycles; melting program, 95 °C for 60 s, 40 °C for 60 s, 65 °C for 1 s, 97 °C for 1 s, 1 cycle.

[0032] The qPCR detection described above can be the probe method: The reaction system (20 μL) is 0.4 - 0.8 μL of upstream and downstream target DNA specific primers with a concentration of 10 μmol / L (0.8 μL for Lactobacillus mucosae, Lactobacillus rhamnosus, and Lactobacillus paracasei, 0.4 μL for Lactobacillus acidophilus), 0.2 - 0.4 μL of probe with a concentration of 10 μmol / L (0.4 μL for Lactobacillus mucosae, Lactobacillus rhamnosus, and Lactobacillus paracasei, 0.2 μL for Lactobacillus acidophilus), Premix Ex Tag TM (Probe qPCR) dye 10 μL, DNA template 2.0 μL, and sterile deionized water was added to make up to 20 μL. The amplification program was pre-denaturation at 50 °C for 120 s, 1 cycle; denaturation at 95 °C for 300 s, 1 cycle; two-step amplification at 94 °C for 5 s, 60 - 65 °C for 20 s (65 °C for 20 s for Lactobacillus mucosae, Lactobacillus rhamnosus, and Lactobacillus acidophilus, 63 °C for 20 s for Lactobacillus paracasei; fluorescence collection), 40 cycles.

[0033] The present invention discloses a specific PMA-qPCR detection method for Lactobacillus mucosae, Lactobacillus rhamnosus, Lactobacillus paracasei, and Lactobacillus acidophilus, which can quickly and accurately detect the live target bacteria in the compound probiotic product and clarify their quantity. The new molecular detection target disclosed by the present invention has high specificity for the target bacteria. The disclosed PMA-qPCR method includes detection target, qPCR primer, probe design, qPCR detection system, PMA treatment conditions, and viable bacteria quantification standard curve. After qPCR amplification, if there is a single Cq value and melting peak and the melting temperature is consistent with that of the positive sample (only for the dye method), it is identified as the target lactic acid bacteria, and the viable bacteria quantity can be calculated according to the corresponding standard curve. The present invention can effectively detect and count the viable bacteria of Lactobacillus mucosae, Lactobacillus rhamnosus, Lactobacillus paracasei, and Lactobacillus acidophilus, and has the advantages of being fast, accurate, and simple to operate, which is convenient for food enterprises and inspection institutions to use. Description of the Drawings:

[0034] Figure 1 It is the melting curve for the specific verification of dye-based qPCR. A, B, C, and D represent the primer amplification results of Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus paracasei, and Lactobacillus acidophilus, respectively;

[0035] Figure 2 It is the standard curve for the viable cell quantification of 4 types of lactic acid bacteria (dye-based method). A, B, C, and D represent the standard curves of Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus paracasei, and Lactobacillus acidophilus, respectively;

[0036] Figure 3 It is the standard curve for the viable cell quantification of 4 types of lactobacilli (probe-based method). A, B, C, and D represent the standard curves of Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus paracasei, and Lactobacillus acidophilus, respectively:

[0037] Figure 4 It is the plate counting result of Sample 1 in Example 5;

[0038] Figure 5 It is the plate counting result of Sample 2 in Example 5

[0039] Figure 6 It is the plate counting result of Sample 3 in Example 5

[0040] Figure 7 It is the MALDI-TOF MS result of Example 5;

[0041] Figure 8 It is the qPCR result (dye-based method) of Sample 1 in Example 5;

[0042] Figure 9 It is the qPCR result (dye-based method) of Sample 2 in Example 5;

[0043] Figure 10 It is the qPCR result (dye-based method) of Sample 3 (L. paracasei) in Example 5;

[0044] Figure 11 It is the qPCR result (dye-based method) of Sample 3 (L. reuteri) in Example 5;

[0045] Figure 12 It is the qPCR result (probe-based method) of Sample 1 in Example 5;

[0046] Figure 13 It is the qPCR result (probe-based method) of Sample 2 in Example 5;

[0047] Figure 14 It is the qPCR result (probe-based method) of Sample 3 (L. paracasei) in Example 5;

[0048] Figure 15 This is the qPCR result (probe method) of Sample 3 (L. reuteri) in Example 5. Specific implementation manner:

[0049] The following is a further description of the present invention, rather than a limitation thereof.

[0050] (1) Sequence screening:

[0051] The complete genome sequences of the Lactobacillus group and related species downloaded from the NCBI database. All genomic sequences for analysis were annotated using Prokka v1.11. After completing the Prokka annotation, copy the GFF annotation files of all strains and perform a pan-genome analysis. The generated gene_presence_absence.csv file after the analysis is the pan-genome matrix file. Subsequently, convert the presence / absence status of all genes in this matrix file into a 1 / 0 form, and finally obtain the nucleotide sequences that only exist in the target bacteria. Then, through database BLAST alignment, it was confirmed that the screened molecular targets belong to the nucleotide sequences unique to the target bacteria, and other non-target bacteria do not contain this gene fragment. By analyzing the screened specific target fragments and comparing them with the literature, no molecular markers identical to this study were found. Therefore, through the alignment and screening of the complete genome sequences of the Lactobacillus group and related species in the NCBI database, specific molecular detection targets for Lactobacillus reuteri mucosae, Lactobacillus casei rhamnosus, Lactobacillus paracasei, and Lactobacillus acidophilus were obtained, and their nucleotide sequences are shown as genomic_00800, genomic_00068, genomic_01690, and genomic_00035.

[0052] (2) Primer and probe design:

[0053] One set of qPCR detection primer groups and probes for identifying Lactobacillus reuteri mucosae, Lactobacillus casei rhamnosus, Lactobacillus paracasei, and Lactobacillus acidophilus are provided, and the detection primer groups and probes are highly specific for the target bacteria.

[0054] Table 1 Primer group and probe sequences

[0055]

[0056] (3) Identification method:

[0057] Provide a method for specifically counting viable Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus paracasei and Lactobacillus acidophilus by PMA-qPCR. Using a new molecular target as the target gene, perform qPCR amplification on the DNA of the sample to be tested treated with PMA using the above detection primer set and probe, determine whether the target bacteria exist, and calculate the number of target bacteria according to the Cq value.

[0058] Specific steps:

[0059] 1. Sample pretreatment: Mix the sample to be tested with sterile phosphate buffer in a certain proportion to prepare a test system with a bacterial suspension concentration of about 10 8 cfu / mL. Take 500 μL of the bacterial solution and place it in a 1.5 mL sterile centrifuge tube for standby.

[0060] 2. PMA treatment: Under light-proof conditions, aseptically pipette the PMA solution into the centrifuge tube in the first step and mix well to make a solution with a final PMA concentration of 20 - 40 μmol / L. Place the solution in the dark and incubate at room temperature for 15 min (invert and mix once every 5 min). Then place it on ice, 20 cm away from a 500 W tungsten halogen lamp, and expose it for 15 - 30 min (the tube mouth is perpendicular to the ice surface). After the exposure, centrifuge at 12000 r / min for 2 min at room temperature, and discard the supernatant (if there are fewer bacteria, after this step, it can be resuspended with ultrapure water and centrifuged again to discard the supernatant to wash away the excess PMA reagent).

[0061] 3. Sample DNA extraction: Extract the genomic DNA of the strain to be detected by the kit method.

[0062] 4. Real-time fluorescence quantitative PCR amplification:

[0063] Dye method: The reaction system (20 μL) is as follows: 0.5 - 1.2 μL of upstream and downstream target DNA-specific primers with a concentration of 10 μmol / L, 10 μL of TB Premix Ex Taq TM II (Tli RNaseH Plus) dye, 2.0 μL of DNA template, and make up to 20 μL with sterile deionized water. The amplification program is pre-denaturation at 95 °C for 60 - 300 s, 1 cycle; two-step amplification at 95 °C for 5 s, 60 - 65 °C for 20 - 30 s (collect fluorescence), 40 cycles; melting program, 95 °C for 60 s, 40 °C for 60 s, 65 °C for 1 s, 97 °C for 1 s, 1 cycle.

[0064] Probe method: The reaction system (20 μL) is as follows: 0.4 - 0.8 μL of upstream and downstream target DNA-specific primers with a concentration of 10 μmol / L, 0.2 - 0.4 μL of probe with a concentration of 10 μmol / L, Premix Ex Tag TM(Probe qPCR) 10 μL of dye, 2.0 μL of DNA template, and sterile deionized water was added to make up to 20 μL. The amplification program was pre-denaturation at 50 °C for 120 s, 1 cycle; denaturation at 95 °C for 60 - 300 s, 1 cycle; two-step amplification at 94 °C for 5 s, 60 - 65 °C for 20 - 30 s, 40 cycles.

[0065] Perform qPCR reaction with the primer sets and probes identified in Table 1. Observe whether the Cq value is less than 35 and whether the melting peak is single and the same as that of the positive group (only applicable to the dye method). If so, it is judged as the target bacterium, and the viable cell count is calculated by substituting into the standard curve; otherwise, it indicates non-target bacteria or aerosol contamination.

[0066] 5. Standard curve construction:

[0067] Inoculate the target lactic acid bacteria standard strain or isolate into MRS liquid medium, and culture it in an aerobic / anaerobic environment at 37 ± 1 °C for 10 - 24 h to the logarithmic growth phase according to the strain characteristics. The obtained bacterial liquid was subjected to plate counting (cfu / mL) referring to the content on the detection of lactic acid bacteria in the national standard GB4789.35 - 2023. At the same time, perform 10-fold serial dilutions (at least five times) on the bacterial liquid, take 500 μL of each dilution of the bacterial liquid for PMA treatment, and extract genomic DNA by the kit method. Using the established qPCR reaction system and amplification program, measure the Cq values corresponding to the DNA of each dilution, and draw a standard curve based on the linear relationship between the logarithm of the total viable cell count of the sample (log 10 cfu / mL) and the amplified Cq value. (With the logarithm of the total viable cell count as the abscissa and the corresponding Cq value as the ordinate)

[0068] Example 1: Specificity verification of probes and primer sets for Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus paracasei, and Lactobacillus acidophilus

[0069] 1. Cultivation of specificity verification strains and DNA extraction

[0070] Using aseptic operation, aspirate 100 μL of the bacterial liquid and inoculate it into 5 mL of MRS medium, and culture it in an aerobic / anaerobic environment at 37 ± 1 °C for 24 h according to the strain characteristics. Take 1 mL of the obtained bacterial suspension into a 1.5 mL centrifuge tube, centrifuge at 12000 r / min for 1 min, discard the supernatant, and collect the bacterial cells. Extract its DNA using a kit for standby.

[0071] 2. qPCR verification

[0072] Dye method: The reaction system (20 μL) includes 0.5 - 1.2 μL of upstream and downstream target DNA-specific primers with a concentration of 10 μmol / L (0.5 μL for Lactobacillus reuteri and Lactobacillus paracasei, 1.2 μL for Lactobacillus rhamnosus and Lactobacillus acidophilus), TB Premix Ex Taq TM For the Probe method: In a reaction system (20 μL), 0.4 - 0.8 μL of upstream and downstream target DNA specific primers with a concentration of 10 μmol / L (0.8 μL for Lactobacillus mucosae, Lactobacillus rhamnosus, and Lactobacillus paracasei, 0.4 μL for Lactobacillus acidophilus), 0.2 - 0.4 μL of a probe with a concentration of 10 μmol / L (0.4 μL for Lactobacillus mucosae, Lactobacillus rhamnosus, and Lactobacillus paracasei, 0.2 μL for Lactobacillus acidophilus), Premix Ex Taq

[0073] Probe method: The reaction system (20 μL) consists of 0.4 - 0.8 μL of upstream and downstream target DNA specific primers at a concentration of 10 μmol / L (0.8 μL for Lactobacillus mucosae, Lactobacillus rhamnosus, and Lactobacillus paracasei, 0.4 μL for Lactobacillus acidophilus), 0.2 - 0.4 μL of a probe at a concentration of 10 μmol / L (0.4 μL for Lactobacillus mucosae, Lactobacillus rhamnosus, and Lactobacillus paracasei, 0.2 μL for Lactobacillus acidophilus), Premix Ex Tag TM (Probe qPCR) dye 10 μL, DNA template 2.0 μL, make up to 20 μL with sterile deionized water. The amplification program is pre - denaturation at 50 °C for 120 s, 1 cycle; denaturation at 95 °C for 300 s, 1 cycle; two - step amplification at 94 °C for 5 s, 60 - 65 °C for 20 s (65 °C for 20 s for Lactobacillus mucosae, Lactobacillus rhamnosus, and Lactobacillus acidophilus, 63 °C for 20 s for Lactobacillus paracasei; fluorescence collection), 40 cycles.

[0074] 3. Result analysis

[0075] Table 2 shows the qPCR specific verification strains and results. If the Cq value is less than 35, it is judged as the target bacterium (+); otherwise, it is judged as non - target bacterium or aerosol contamination (-). The specificity of the probe and primer sets is good, and only the target bacterium shows a positive result.

[0076] Figure 1 It should be noted that in the translation of the content in , there seems to be some confusion in the original text structure. The correct translation should be based on the overall context and the intended meaning. The above translation tries to make sense of the content as accurately as possible. If there are any specific requirements or corrections, please feel free to let me know.This is the melting curve for specific verification of dye-based qPCR. A, B, C, and D represent the primer amplification results of Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus paracasei, and Lactobacillus acidophilus, respectively. The melting curves of each target bacterium showed a single characteristic peak, and the melting temperatures (Tm values) were: Lactobacillus reuteri (81.0 ± 1.0 °C), Lactobacillus rhamnosus (83.0 ± 1.0 °C), Lactobacillus paracasei (86.0 ± 1.0 °C), and Lactobacillus acidophilus (80.5 ± 1.0 °C), which were significantly distinguishable from non-target strains.

[0077] Table 2 Strains and Results for Specific Verification

[0078]

[0079]

[0080] Example 2: Construction of Standard Curves for Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus paracasei, and Lactobacillus acidophilus

[0081] 1. Activation and Cultivation of Target Bacteria

[0082] Using aseptic technique, aspirate 100 μL of the target bacterial solution and inoculate it into 5 mL of MRS liquid medium. Cultivate it under aerobic / anaerobic conditions at 37 ± 1 °C for 24 h according to the strain characteristics to complete activation (this step can be repeated once to ensure the activity of the strain). After activation, inoculate the strain into a new MRS liquid medium using aseptic technique and cultivate it under aerobic / anaerobic conditions at 37 ± 1 °C for 10 - 24 h until the logarithmic growth phase.

[0083] 2. Plate Counting, DNA Extraction, and qPCR Amplification

[0084] Refer to the part on lactic acid bacteria detection in the national standard GB 4789.35-2023 for plate counting and calculate the total viable count (cfu / mL). At the same time, perform 10-fold serial dilutions of the bacterial solution, and take 500 μL of the bacterial solution at each dilution and place it in a 1.5 mL centrifuge tube for standby. Under light-proof conditions, use aseptic technique to aspirate the PMA solution and mix it with the bacterial solution in the above centrifuge tube to make a solution with a final PMA concentration of 20 - 40 μmol / L. Place the solution in the dark and incubate it at room temperature for 15 min (invert and mix it once every 5 min). Then place it on ice and expose it to a 500 W tungsten halogen lamp at a distance of 20 cm for 15 - 30 min (the tube mouth is perpendicular to the ice surface). After the exposure, centrifuge it at 12,000 r / min for 1 min at room temperature, discard the supernatant, and collect the bacterial cells. Use a kit to extract its DNA for standby. Using the established qPCR reaction system and amplification program, measure the Cq value corresponding to the DNA at each dilution.

[0085] Dye method: The reaction system (20 μL) consists of 0.5 - 1.2 μL of upstream and downstream target DNA specific primers with a concentration of 10 μmol / L (0.5 μL for Lactobacillus reuteri and Lactobacillus paracasei, 1.2 μL for Lactobacillus rhamnosus and Lactobacillus acidophilus), TB Premix Ex Taq TM II (Tli RNaseH Plus) dye 10 μL, DNA template 2.0 μL, and sterile deionized water is added to make up to 20 μL. The amplification program is pre-denaturation at 95 °C for 60 - 300 s (300 s for Lactobacillus reuteri, 150 s for Lactobacillus paracasei, 30 s for Lactobacillus rhamnosus and Lactobacillus acidophilus), 1 cycle; two-step amplification at 95 °C for 5 s, 60 - 65 °C for 20 - 30 s (65 °C for 20 s for Lactobacillus reuteri, 62 °C for 30 s for Lactobacillus rhamnosus, 62 °C for 20 s for Lactobacillus paracasei, 61 °C for 20 s for Lactobacillus acidophilus; fluorescence collection), 40 cycles; melting program, 95 °C for 60 s, 40 °C for 60 s, 65 °C for 1 s, 97 °C for 1 s, 1 cycle.

[0086] Probe method: The reaction system (20 μL) consists of 0.4 - 0.8 μL of upstream and downstream target DNA specific primers with a concentration of 10 μmol / L (0.8 μL for Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus paracasei, 0.4 μL for Lactobacillus acidophilus), 0.2 - 0.4 μL of probe with a concentration of 10 μmol / L (0.4 μL for Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus paracasei, 0.2 μL for Lactobacillus acidophilus), Premix Ex Tag TM (Probe qPCR) dye 10 μL, DNA template 2.0 μL, and sterile deionized water is added to make up to 20 μL. The amplification program is pre-denaturation at 50 °C for 120 s, 1 cycle; denaturation at 95 °C for 300 s, 1 cycle; two-step amplification at 94 °C for 5 s, 60 - 65 °C for 20 s (65 °C for 20 s for Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus acidophilus, 63 °C for 20 s for Lactobacillus paracasei; fluorescence collection), 40 cycles.

[0087] 3. Result analysis

[0088] Using the logarithm of the total viable count (log 10 cfu / mL) as the abscissa and the corresponding Cq value as the ordinate to plot the standard curve. The results are as Figures 2 - 3 , where A, B, C, and D represent the standard curves of Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus paracasei, and Lactobacillus acidophilus respectively. The obtained curves have a good linear relationship (R 2 > 0.99), and a wide linear dynamic range (10 3 ~108 cfu / mL).

[0089] Example 3: Detection of Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus paracasei and Lactobacillus acidophilus (dye method)

[0090] 1. Sample pretreatment

[0091] In a sterile environment, the sample containing the target bacteria is mixed with sterile phosphate buffer according to the addition amount stated in the product to prepare a test system with a bacterial suspension concentration of about 10 8 cfu / mL. Take 500 μL of the bacterial solution and place it in a 1.5 mL centrifuge tube for standby.

[0092] 2. Plate counting, PMA treatment and extraction of target bacteria DNA

[0093] For the bacterial solution obtained in step 1, plate counting is carried out according to the requirements for the detection of lactic acid bacteria in the national standard GB 4789.35-2023. Under light-proof conditions, PMA solution is aseptically aspirated and mixed with the bacterial solution in the above centrifuge tube to make a solution with a final PMA concentration of 20-40 μmol / L. The solution is placed in the dark and incubated at room temperature for 15 min (inverted and mixed evenly every 5 min). Then it is placed on ice and exposed to a 500 W tungsten halogen lamp at a distance of 20 cm for 15-30 min (the tube mouth is perpendicular to the ice surface). After the exposure is completed, centrifuge at 12000 r / min for 1 min at room temperature, discard the supernatant, and collect the bacterial cells. Use a kit to extract its DNA for standby.

[0094] 3. qPCR detection

[0095] The reaction system (20 μL) is as follows: 0.5-1.2 μL of upstream and downstream target DNA specific primers with a concentration of 10 μmol / L (0.5 μL for Lactobacillus reuteri and Lactobacillus paracasei, 1.2 μL for Lactobacillus rhamnosus and Lactobacillus acidophilus), TB Premix Ex Taq TM II (Tli RNaseH Plus) dye 10 μL, DNA template 2.0 μL, make up to 20 μL with sterile deionized water.

[0096] The amplification program is as follows: pre-denaturation at 95°C for 60 - 300 s (300 s for Lactobacillus mucosae, 150 s for Lactobacillus paracasei, 30 s for Lactobacillus rhamnosus and Lactobacillus acidophilus), 1 cycle; two-step amplification at 95°C for 5 s, 60 - 65°C for 20 - 30 s (65°C for 20 s for Lactobacillus mucosae, 62°C for 30 s for Lactobacillus rhamnosus, 62°C for 20 s for Lactobacillus paracasei, 61°C for 20 s for Lactobacillus acidophilus; fluorescence collection), 40 cycles; melting program at 95°C for 60 s, 40°C for 60 s, 65°C for 1 s, 97°C for 1 s, 1 cycle.

[0097] 4. Result analysis

[0098] Table 3 shows the detection results of the PMA-qPCR method with dye and the plate counting method. T-test analysis indicates that there is no significant difference in the results of the two detection methods (P > 0.05). The detection results of the two are consistent.

[0099] Table 3 Results of the PMA-qPCR method with dye and the plate counting method

[0100]

[0101]

[0102] Example 4: Detection of Lactobacillus mucosae, Lactobacillus rhamnosus, Lactobacillus paracasei and Lactobacillus acidophilus (probe method)

[0103] 1. Sample pretreatment

[0104] In a sterile environment, the sample containing the target bacteria is mixed with sterile phosphate buffer according to the addition amount stated in the product declaration to prepare a test system with a bacterial suspension concentration of about 10 8 cfu / mL. Take 500 μL of the bacterial solution and place it in a 1.5 mL centrifuge tube for standby.

[0105] 2. Plate counting, PMA treatment and extraction of target bacteria DNA

[0106] For the bacterial solution obtained in step 1, plate counting is carried out according to the requirements for the detection of lactic acid bacteria in the national standard GB 4789.35-2023. Under light-shielded conditions, draw the PMA solution and mix it with the bacterial solution in the above centrifuge tube to make a solution with a final PMA concentration of 20 - 40 μmol / L. Place the solution in the dark and incubate it at room temperature for 15 min (invert and mix it once every 5 min). Then place it on ice 20 cm away from a 500 W tungsten halogen lamp for exposure for 15 - 30 min (the tube mouth is perpendicular to the ice surface). After the exposure, centrifuge it at 12000 r / min for 1 min at room temperature, discard the supernatant, and collect the bacterial cells. Use a kit to extract its DNA for standby.

[0107] 3. qPCR Detection

[0108] The reaction system (20 μL) is as follows: 0.4 - 0.8 μL of upstream and downstream target DNA specific primers with a concentration of 10 μmol / L (0.8 μL for Lactobacillus reuteri, Lactobacillus rhamnosus, and Lactobacillus paracasei, 0.4 μL for Lactobacillus acidophilus), 0.2 - 0.4 μL of probe with a concentration of 10 μmol / L (0.4 μL for Lactobacillus reuteri, Lactobacillus rhamnosus, and Lactobacillus paracasei, 0.2 μL for Lactobacillus acidophilus), Premix Ex Tag TM (Probe qPCR) dye 10 μL, DNA template 2.0 μL, make up to 20 μL with sterile deionized water. The amplification program is pre - denaturation, 50 °C / 120 s, 1 cycle; denaturation, 95 °C / 300 s, 1 cycle; two - step amplification, 94 °C / 5 s, 60 - 65 °C / 20 s (65 °C / 20 s for Lactobacillus reuteri, Lactobacillus rhamnosus, and Lactobacillus acidophilus, 63 °C / 20 s for Lactobacillus paracasei; collect fluorescence), 40 cycles.

[0109] 4. Result Analysis

[0110] Table 4 shows the detection results of the PMA - qPCR method and the plate counting method. T - test analysis indicates that there is no significant difference in the results of the two detection methods (P > 0.05). The detection results of the two methods are consistent.

[0111] Table 4 Results of the PMA - qPCR Method and the Plate Counting Method

[0112]

[0113]

[0114] Example 5: Proficiency Testing of the Kit

[0115] To verify the influence of different laboratories and operators on the detection ability of the kit of the present patent invention, Laboratory A and Laboratory B were arranged to use the kit of the present patent to detect the same samples. The specific operations are as follows:

[0116] 1. Sample Pretreatment

[0117] In a sterile environment, the sample containing the target bacteria is mixed with sterile phosphate - buffered saline according to the addition amount stated in the product declaration to prepare a test system with a bacterial suspension concentration of about 10 8 cfu / mL. Take 500 μL of the bacterial solution and place it in a 1.5 mL centrifuge tube for standby.

[0118] 2. Plate Counting, PMA Treatment, and Extraction of Target Bacteria DNA

[0119] For the bacterial solution obtained in Step 1, plate counting is performed according to the requirements for lactic acid bacteria detection in the national standard GB 4789.35-2023 (MALDI-TOF MS-assisted plate counting is used to effectively distinguish and count different lactic acid bacteria in composite probiotic products). Under light-shielded conditions, aseptically aspirate the PMA solution and mix it with the bacterial solution in the above centrifuge tube to prepare a solution with a final PMA concentration of 20-40 μmol / L. The solution is placed in the dark and incubated at room temperature for 15 min (inverted and mixed evenly every 5 min). Then, it is placed on ice and exposed to a 500 W tungsten halogen lamp at a distance of 20 cm for 15-30 min (the tube mouth is perpendicular to the ice surface). After the exposure, centrifuge at 12,000 r / min for 1 min at room temperature, discard the supernatant, and collect the bacterial cells. Use a kit to extract its DNA for standby.

[0120] 3. qPCR detection

[0121] (1) Dye-based kit

[0122] The reaction system (20 μL) is as follows: 0.5-1.2 μL of upstream and downstream target DNA-specific primers with a concentration of 10 μmol / L (0.5 μL for Lactobacillus mucosae, Lactobacillus paracasei, 1.2 μL for Lactobacillus rhamnosus, Lactobacillus acidophilus), TB Premix Ex Taq TM II (Tli RNaseH Plus) dye 10 μL, DNA template 2.0 μL, and sterile deionized water is added to make up to 20 μL. The amplification program is pre-denaturation at 95 °C for 60-300 s (300 s for Lactobacillus mucosae, 150 s for Lactobacillus paracasei, 30 s for Lactobacillus rhamnosus, Lactobacillus acidophilus), 1 cycle; two-step amplification at 95 °C for 5 s, 60-65 °C for 20-30 s (65 °C for 20 s for Lactobacillus mucosae, 62 °C for 30 s for Lactobacillus rhamnosus, 62 °C for 20 s for Lactobacillus paracasei, 61 °C for 20 s for Lactobacillus acidophilus; fluorescence is collected), 40 cycles; melting program, 95 °C for 60 s, 40 °C for 60 s, 65 °C for 1 s, 97 °C for 1 s, 1 cycle.

[0123] (2) Probe-based kit

[0124] Probe method: The reaction system (20 μL) is as follows: 0.4-0.8 μL of upstream and downstream target DNA-specific primers with a concentration of 10 μmol / L (0.8 μL for Lactobacillus mucosae, Lactobacillus rhamnosus, Lactobacillus paracasei, 0.4 μL for Lactobacillus acidophilus), 0.2-0.4 μL of probe with a concentration of 10 μmol / L (0.4 μL for Lactobacillus mucosae, Lactobacillus rhamnosus, Lactobacillus paracasei, 0.2 μL for Lactobacillus acidophilus), Premix Ex TagTM (Probe qPCR) 10 μL of dye, 2.0 μL of DNA template, and sterile deionized water was added to make up to 20 μL. The amplification program was pre-denaturation at 50 °C for 120 s, 1 cycle; denaturation at 95 °C for 300 s, 1 cycle; two-step amplification at 94 °C for 5 s, 60 - 65 °C for 20 s (65 °C for 20 s for Limosilactobacillus reuteri, Lactobacillus rhamnosus, and Lactobacillus acidophilus; 63 °C for 20 s for Lacticaseibacillus paracasei; fluorescence was collected), 40 cycles.

[0125] 4. Result Analysis

[0126] Figure 4 This is the plate count result of Sample 1, containing the strains Lactobacillus acidophilus and Bifidobacterium animalis subsp. lactis; Figure 5 This is the plate count result of Sample 2, containing the strains Lacticaseibacillus rhamnosus, Bifidobacterium animalis subsp. lactis, and Bifidobacterium animalis subsp. animalis; Figure 6 This is the plate count result of Sample 3, containing the strains Lacticaseibacillus paracasei, Limosilactobacillus fermentum, and Limosilactobacillus reuteri. Verified by MALDI-TOF MS ( Figure 7 ), the identification results of Lactobacillus strains were completely consistent with the product label. Due to the limitation of aerobic culture conditions, no valid mass spectrometry data were obtained for Bifidobacterium strains. Figures 8 - 15 This is the detection result of the kit by PMA-qPCR. The threshold of the amplification curve of each target strain is clear, and the melting curve shows a single peak. The proficiency testing results shown in Table 5 indicate that the consistency rate of qualitative identification of target bacteria by the two groups of laboratories A and B using this kit and the plate count method reached 100%, and the deviation of the quantitative results was less than 1 logarithmic order, meeting the requirements of methodological equivalence. These results show that the kit of the present invention can accurately complete the synchronous identification and quantitative analysis of multiple active strains in composite probiotic products.

[0127] Table 5 Proficiency Testing Results of the Kit

[0128]

[0129] Target Sequence Table:

[0130] SEQ ID NO.1:

[0131] Target sequence of Limosilactobacillus reuteri (genomic_00800)

[0132] GTGGTTACCATTCTGAATCGAACTAAGCAATTTATGCGCGACAATGATTTAATGTATAAAAAAGAGTACATTCGGCCAATGATGACACCCCAACACGTATATGTGTTCCGCTTTGGTAAACACAGACTAAATAATCGGGTAATTGTTCGTTATTCCCATACTTGGACCGGACGATTAAAAATTAACGAGATTGATGTTCGGTTGCATCACCAACATCATCCCCGTATTTTCTTGACTGAGTCCGACTTAATCGATTACTTAAGTCATCATTTAGAAAAAGAAAAGAAACGCGAACAAGAACGACCACATATTAGTAAAGTTGATAATGAAAATGATTAGSEQ ID NO.2:

[0133] Target sequence of Lacticaseibacillus rhamnosus (genomic_00068)

[0134] ATGACAGAAAAAGAGCGTTTCCGGAAATTTGTTCGCAATGGATTTCGAAAAGATGAAGAATTGGGCATCCCGTATCATCTATATTGCCTAGCCCATGCAATTTTGATAGCAGTCCCGCTTGGATTCATTGTATCCGCGGTGTTTTATGCAATGGATTTGCGGGACTTATATGGTACTGTGTACGCTTTTAACATGGGCGTTATTGTGTTTTTGATGTTTGAACTGGACATCGATTGGCGCATTGAGAAGAATGAATTTTTGCCTGAGCGAGTCTCCAAGTTGCAATGGGTCATTCGTATTTTGGCGAGTGTGCTCGTTTCCGGGATCTTCTTTTATTTTCATGAAACAACAGTTATCCAGCAATTTGTGAAGTAA

[0135] SEQ ID NO.3:

[0136] Target sequence of Lacticaseibacillus paracasei (genomic_01690)

[0137] ATGATGAAGAAAGGACAGCTTAGTTTCTTCTTGATGGCCTTGTTTTTCTTTATGAATATGCCACCGCATATAGGCCTTGCGGAAACCAATGCAAGTATTGAGGTGGAGGGCATCATTGGCAACCAGCCAGTTGATGTGACTGACAAAAACGATGGCGGCAAAAGTCCGATTGTTCAGCGCAAGGAATCTAATGACAAAATAAGGCAGGAGATGCCCGAACTGGGGGCAGATGCCGCGCAAGCGCAGGTATTCTTGATGTTGGGGTTACTGTGCCTTTCCGGTGCAATTTTTGTGTACTGGACAAGGAAATATCAAGGAGAAGATGGCAATCAGGGAACTGCCAGCAATGCCACCAAAAAAGTCGAACCTTAG

[0138] SEQ ID NO.4:

[0139] Target sequence of Lactobacillus acidophilus (genomic_00035)

[0140] TTGAATACTTTATTTTTAGCAAATGCTAACAATGGTGCTGCTGGTAACAACTGGATGATGATTATTTTATTCATTATTTTGATTGGTTTTACATACTTTGGTATGATTCGTCCACAAAAAAAGCAGCAACAACAAAGACTACAAATGATGGACAAGTTGAAGAAGGGCGACGAAGTTGTTTTAGTAGATGGTTTGCATGCAAAGATTGATAAGATCAACAGTGATAAGACTGTAGTTGTTGATGCAGATGGTATTTACCTAACTTTTGAAAGAATGGCTATCCGTCGTGTAATTCCTGCTACTACTGTTCCTGCACCAGAAACTACTGAAAAGACTGATGAAAAGGCAACAGAAACAAGCGATACTGCTTCAGCTGATGATACTAAAAAAGAAGACAAGTAA。

Claims

1. A specific molecular marker for identifying Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus paracasei, and Lactobacillus acidophilus, characterized in that, They are genomic_00800, genomic_00068, genomic_01690, and genomic_00035 respectively. The nucleotide sequences of genomic_00800, genomic_00068, genomic_01690, and genomic_00035 are shown as SEQ ID NO.1, 2, 3, and 4 respectively.

2. Identification primer sets and probes for Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus paracasei, and Lactobacillus acidophilus, characterized in that, As follows: A. For Lactobacillus mucosae: Lr_F: 5'-AATGATGACACCCCAACACG-3' Lr_R: 5'-TACGGGGATGATGTTGGTGA-3' P149: 5'-FAM-TGTTCCGCTTTGGTAAACACAGACTAA-BHQ1-3' B. For Lactobacillus rhamnosus: Lrh_F: 5'-TGGGCATCCCGTATCATCTA-3' Lrh_R: 5'-GAGACTCGCTCAGGCAAAA-3' P214: 5'-FAM-ATTCTTCTCAATGCGCCAATCGATG-BHQ1-3' C. For Lactobacillus paracasei: Lp_F: 5'-TGGAGGGCATCATTGGCAAC-3' Lp_R: 5'-GCACCGGAAAGGCACAGTAAC-3' P181: 5'-FAM-CCCAACATCAAGAATACCTGCGCTT-BHQ1-3' D. For Lactobacillus acidophilus: La_F: 5'-TGAAAGAATGGCTATCCGTC-3' La_R: 5'-AAGCAGTATCGCTTGTTTCTG-3' P104: 5'-FAM-TGTAATTCCTGCTACTACTGTTCCTGCAC-BHQ1-3'.

3. A kit for identifying and counting viable cells of Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus paracasei, and Lactobacillus acidophilus, characterized in that, It includes a bacterial DNA extraction reagent, a qPCR reaction reagent, a live cell dye, and the identification primer set and probe described in claim 2.

4. A method for identifying and counting viable bacteria of Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus paracasei and Lactobacillus acidophilus for purposes other than disease diagnosis and treatment, characterized in that, It includes the following steps: Mix the sample to be tested with sterile phosphate buffer in a certain proportion to prepare a bacterial suspension, and then perform PMA photoactivation treatment on the bacterial suspension; use a DNA extraction kit to isolate genomic DNA from the treated bacterial suspension; Perform qPCR detection with the specific primer set and probe system described in claim 2, perform quantitative analysis on the amplification results according to the established standard curve to obtain the absolute number of live bacteria in the sample. If Cq ≤ 35, the melting peak is single and consistent with the positive group (only for the dye method), it is determined as the target bacterium, and the number of live bacteria is calculated by substituting it into the standard curve; if 35 < Cq < 40, repeat the experiment. If the result still shows Cq > 35, it is determined as non-target bacteria or contamination such as aerosol.

5. The method according to claim 4, characterized in that The qPCR detection described above is the dye method: the reaction system of 20 μL includes 0.5 - 1.2 μL of upstream and downstream target DNA specific primers with a concentration of 10 μmol / L, TB Premix ExTaq TM II (Tli RNaseH Plus) dye 10 μL, DNA template 2.0 μL, supplemented with sterile deionized water to 20 μL. The amplification program is pre-denaturation at 95 °C for 60 - 300 s, 1 cycle; two-step amplification at 95 °C for 5 s, 60 - 65 °C for 20 - 30 s, 40 cycles; melting program, 95 °C for 60 s, 40 °C for 60 s, 65 °C for 1 s, 97 °C for 1 s, 1 cycle.

6. The method according to claim 4, characterized in that The qPCR detection described above is the probe method: the reaction system is 20 μL, including 0.4 - 0.8 μL of upstream and downstream target DNA specific primers with a concentration of 10 μmol / L, 0.2 - 0.4 μL of probe with a concentration of 10 μmol / L, Premix Ex Tag TM (Probe qPCR) dye 10 μL, DNA template 2.0 μL, and sterile deionized water is added to make up to 20 μL. The amplification program is pre-denaturation at 50 °C for 120 s, 1 cycle; denaturation at 95 °C for 300 s, 1 cycle; two-step amplification at 94 °C for 5 s and 60 - 65 °C for 20 s, 40 cycles.

Images