A method for detecting tuberculosis sgRNA, kit, and application based on RPA-CRISPR Cas12b technology.

By using RPA-CRISPR Cas12b technology, specific sgRNAs targeting Mycobacterium tuberculosis and Mycobacterium bovis were designed. Combined with Cas12b protease and single-stranded nucleic acid reporter molecules, the problems of long time consumption, high cost and insufficient specificity of existing tuberculosis detection methods were solved, and rapid and sensitive tuberculosis diagnosis was achieved.

CN120384141BActive Publication Date: 2026-05-08LANZHOU VETERINARY RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES(LANZHOU BRANCH CENTER OF CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENTER)
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510588492.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-07
Publication Date
2026-05-08
Estimated Expiration
2045-05-07

AI Technical Summary

Technical Problem

Existing tuberculosis diagnostic and testing methods are time-consuming, costly, and lack highly specific detection targets. Traditional culture and PCR methods are complex to operate, and immunological diagnosis suffers from false positives and false negatives. CRISPR detection technology lacks specificity in the detection of tuberculosis pathogens.

Method used

Using RPA-CRISPR Cas12b technology, sgRNAs specifically targeting Mycobacterium tuberculosis and Mycobacterium bovis were designed, combined with Cas12b protease and single-stranded nucleic acid reporter molecules, to achieve rapid and sensitive detection through RPA amplification and CRISPR-Cas12b reaction.

Benefits of technology

It enables rapid and accurate detection of Mycobacterium tuberculosis and Mycobacterium bovis, reduces detection costs, is suitable for use in areas with poor experimental conditions, improves detection sensitivity and specificity, and is applicable to the monitoring of pasture animals and close contacts.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120384141B_ABST
    Figure CN120384141B_ABST
Patent Text Reader

Abstract

The application provides an sgRNA, a kit, a detection method and application for detecting tuberculosis based on RPA-CRISPR Cas12b technology, and belongs to the technical field of molecular detection. The application provides an sgRNA for detecting mycobacterium, which comprises sgRNA-6110 with a nucleotide sequence as shown in SEQ ID NO: 1 and / or sgRNA-1081 with a nucleotide sequence as shown in SEQ ID NO: 2. The sgRNA can specifically recognize and combine with the high-conservation target sequence IS6110 and IS1081 of Mycobacterium tuberculosis and / or Mycobacterium bovis, and can be used for instant detection of Mycobacterium tuberculosis and / or Mycobacterium bovis which are pathogenic bacteria of human and livestock tuberculosis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular detection technology, specifically relating to a kit, detection method, and application of sgRNA for detecting tuberculosis based on RPA-CRISPR Cas12b technology. Background Technology

[0002] Tuberculosis (TB) is a chronic infectious disease caused by infection with the Mycobacterium tuberculosis complex. The Mycobacterium tuberculosis complex mainly includes *Mycobacterium tuberculosis*, *Mycobacterium bovis*, *Mycobacterium canettii*, *Mycobacterium africanum*, *Mycobacterium microti*, *Mycobacterium pinnipedii*, and *Mycobacterium caprae*. It has been found that the Mycobacterium tuberculosis complex can infect not only humans but also more than 50 species of mammals and 25 species of birds. Human TB is mainly caused by *Mycobacterium tuberculosis*, with some cases caused by *Mycobacterium bovis*. Bovine tuberculosis is mainly caused by *Mycobacterium bovis*, with some cases caused by *Mycobacterium tuberculosis*. Bovine tuberculosis not only affects the food safety of dairy products such as milk and beef but also poses a public health safety hazard, spreading to close contact groups such as herders and slaughterhouse workers, causing infection in the general population. Establishing rapid, sensitive, and low-cost detection methods for tuberculosis pathogens and improving the detection rate of tuberculosis infection is crucial for the prevention and control of tuberculosis.

[0003] Currently, traditional methods for diagnosing and detecting tuberculosis mainly include bacterial culture, immunological diagnosis, and molecular biology methods. However, traditional culture methods are time-consuming, immunological diagnostic methods have a certain number of false positive and false negative results, and nucleic acid amplification identification methods based on polymerase chain reaction (PCR) have high requirements for instruments, testing environment, and operators, thus limiting them to medical laboratories, and also resulting in high testing costs and long processing times. Although new detection methods have been developed, such as CRISPR-based detection technology, there is a lack of highly specific detection targets for detecting the tuberculosis pathogen. Summary of the Invention

[0004] In view of this, the present invention provides an sgRNA for detecting tuberculosis pathogens based on RPA-CRISPR Cas12b technology. The sgRNA can specifically target highly conserved sequences of Mycobacterium tuberculosis and / or Mycobacterium bovis, effectively improving the detection rate of tuberculosis pathogens in humans and animals.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] The present invention provides an sgRNA for detecting mycobacteria, wherein the sgRNA comprises sgRNA-6110 as shown in SEQ ID NO:1 and / or sgRNA-1081 as shown in SEQ ID NO:2.

[0007] The present invention provides a reagent for detecting mycobacteria, comprising the following components: sgRNA, Cas12b protease, and single-stranded nucleic acid reporter molecule.

[0008] Preferably, the single-stranded nucleic acid reporter molecule comprises a single-stranded nucleotide labeled with a fluorescent group at the 5' end and a fluorescent quencher group at the 3' end.

[0009] This invention provides the use of the sgRNA or the reagent in the preparation of a kit for detecting tuberculosis.

[0010] This invention provides a kit for detecting tuberculosis, comprising an RPA primer pair and the sgRNA or the reagent;

[0011] The RPA primer pairs include the RPA-6110 primer pair and / or the RPA-1081 primer pair;

[0012] The RPA-6110 primer pair includes primer pairs with nucleotide sequences as shown in SEQ ID NO: 3 and SEQ ID NO: 4;

[0013] The RPA-1081 primer pair includes primer pairs with nucleotide sequences as shown in SEQ ID NO: 5 and SEQ ID NO: 6.

[0014] This invention provides a method for detecting mycobacteria for non-diagnostic purposes, comprising the following steps:

[0015] 1) Using the genomic DNA of the sample to be tested as a template, perform RPA amplification using the RPA primer pair described in the kit to obtain RPA amplification products;

[0016] 2) Mix the RPA amplification product, the sgRNA, and the Cas12b protease and single-stranded nucleic acid reporter molecule in the reagent, and incubate to obtain the reaction product;

[0017] 3) Measure the fluorescence intensity of the reaction product, and determine whether the sample contains mycobacteria based on the presence or absence of fluorescence intensity: when a fluorescence intensity signal is detected, it indicates that the sample contains Mycobacterium tuberculosis and / or Mycobacterium bovis, otherwise it does not.

[0018] Preferably, the reaction procedure for RPA amplification in step 1) is 42°C for 30 min.

[0019] Preferably, the reaction system for RPA amplification in step 1) is: 14.7 μL of Abuffer, 1 μL each of 10 μM RPA upstream and downstream primers, 5 μL of template, 1.25 μL of B buffer, and enzyme-free water to a final volume of 25 μL.

[0020] Preferably, the incubation reaction procedure in step 2) is a reaction at 42°C for 60 min.

[0021] Preferably, the mycobacteria include Mycobacterium tuberculosis and / or Mycobacterium bovis.

[0022] Compared with the prior art, the present invention has the following advantages:

[0023] This invention provides an sgRNA for detecting mycobacteria, wherein the sgRNA comprises sgRNA-6110 with a nucleotide sequence as shown in SEQ ID NO:1 and / or sgRNA-1081 with a nucleotide sequence as shown in SEQ ID NO:2. This invention selects the highly conserved target sequences IS6110 and / or IS1081 specific to Mycobacterium tuberculosis and Mycobacterium bovis, respectively. Three specific sgRNAs are designed for IS6110 and IS1081. Through CRISPR Cas12b fluorescence detection experiments, the fluorescence intensity of the reaction system is observed to screen for sgRNAs (sgRNA-6110 and / or sgRNA-1081) with early peak time, high fluorescence intensity, and high sensitivity. These sgRNAs can specifically recognize and bind to the highly conserved specific DNA target sequences of Mycobacterium tuberculosis and Mycobacterium bovis, thereby achieving immediate detection of Mycobacterium tuberculosis and / or Mycobacterium bovis.

[0024] This invention provides a reagent for detecting mycobacteria, comprising the following components: sgRNA, Cas12b protease, and a single-stranded nucleic acid reporter molecule. In this reagent, the sgRNA specifically recognizes and binds to highly conserved specific DNA target sequences of Mycobacterium tuberculosis and Mycobacterium bovis. Once bound, it activates the cleavage activity of the Cas12b protease, cleaving the single-stranded nucleic acid reporter molecule in the system and generating a visually observable fluorescent signal, thereby enabling immediate detection of Mycobacterium tuberculosis and Mycobacterium bovis.

[0025] This invention provides a kit for detecting tuberculosis, comprising RPA primer pairs and the sgRNA or the reagent; the RPA primer pairs include the RPA-6110 primer pair and / or the RPA-1081 primer pair; the RPA-6110 primer pair includes primer pairs with nucleotide sequences as shown in SEQ ID NO: 3 and SEQ ID NO: 4; the RPA-1081 primer pair includes primer pairs with nucleotide sequences as shown in SEQ ID NO: 5 and SEQ ID NO: 6. This invention designs and synthesizes three pairs of RPA primers based on sgRNA, and screens the RPA-6110 primer pair and RPA-1081 primer pair with the optimal amplification efficiency of specific fragments through RPA amplification product nucleic acid electrophoresis and CRISPR-Cas12b fluorescence detection experiments. The kit of this invention combines RPA amplification reaction with CRISPR-Cas12b reaction, and through optimized sgRNA and RPA primer pairs, achieves rapid and specific recognition of target pathogens, while expanding the pathogen spectrum and improving the sensitivity of the diagnostic system. The kit described in this invention is specifically designed for ranch animals and their close contacts in areas with a high incidence of tuberculosis. It has a high detection rate of tuberculosis in humans and cattle and can be used for tuberculosis monitoring in ranch animals, reducing the spread of tuberculosis in animal populations and lowering the threat of animal tuberculosis to humans.

[0026] This invention provides a method for detecting mycobacteria for non-diagnostic purposes, comprising the following steps: 1) using the genomic DNA of the sample to be tested as a template, performing isothermal amplification with the RPA primer pair to obtain RPA amplification products; 2) mixing the RPA amplification products, the sgRNA, the Cas12b protease, and a single-stranded nucleic acid reporter molecule, and incubating to obtain reaction products; 3) measuring the fluorescence intensity of the reaction products, and determining whether the sample to be tested contains mycobacteria based on the presence or absence of fluorescence intensity: when a fluorescence intensity signal is detected, it indicates that the sample to be tested contains Mycobacterium tuberculosis and / or Mycobacterium bovis, otherwise it does not. This method utilizes the CRISPR Cas12b system to specifically recognize and cleave target DNA, combined with RPA recombinase polymerase isothermal amplification technology, to improve detection sensitivity and achieve rapid, accurate, and portable diagnosis of tuberculosis. The method described in this invention has a fast detection speed, and the entire detection process can be completed within 2 to 3 hours; it has high detection sensitivity, capable of detecting Mycobacterium tuberculosis or Mycobacterium bovis DNA as low as 2 copies / μL; it is easy to operate, requiring no complex instruments or professional technicians, and is suitable for use in areas with poor experimental conditions; it is cost-effective and can serve as an important tool for daily monitoring of ranches, enabling large-scale screening. Attached Figure Description

[0027] Figure 1 A schematic diagram illustrating the detection principle of a kit for detecting tuberculosis;

[0028] Figure 2 Validation diagrams of IS6110 and IS1081 in the genomes of the standard Mycobacterium tuberculosis strain H37Rv and the attenuated Mycobacterium bovis vaccine strain BCG. 1: 2000bp DNA marker; 2: IS6110 PCR product (template: H37Rv genome); 3: IS1081 PCR product (template: H37Rv genome); 4: IS6110 PCR product (template: BCG genome); 5: IS1081 PCR product (template: BCG genome).

[0029] Figure 3 The image shows the optimal sgRNA screening results for IS6110: 1 and 2: sgRNA1-6110, 3 and 4: sgRNA2-6110, 5 and 6: sgRNA3-6110, 7: NC;

[0030] Figure 4 The image shows the optimal sgRNA screening results for IS1081: 1 and 2: sgRNA4-1081, 3 and 4: sgRNA5-1081, 5 and 6: sgRNA6-1081, 7: NC;

[0031] Figure 5 The figure shows the results of optimizing the concentration ratio of Cas12b to sgRNA;

[0032] Figure 6 The images show the electrophoresis results of the IS6110 and IS1081 RPA primer pair screenings, where A is the IS6110 RPA primer pair screening electrophoresis result and B is the IS1081 RPA primer pair screening electrophoresis result.

[0033] Figure 7 The image shows the fluorescence results of the IS6110 RPA primer pair screening: 1 and 2: F1-R1, 3 and 4: F2-R2, 5 and 6: F3-R3, 7: NC;

[0034] Figure 8 The image shows the fluorescence results of the IS1081 RPA primer pair screening: 1 and 2: F1-R1, 3 and 4: F2-R2, 5 and 6: F3-R3, 7: NC;

[0035] Figure 9 The figures show the results of sensitivity tests for the RPA CRISPR Cas12b diagnostic system. Figure A shows the results of sensitivity tests for the IS6110 RPA CRISPR Cas12b diagnostic system, and Figure B shows the results of sensitivity tests for the IS1081 RPA CRISPR Cas12b diagnostic system. Figures 1-7 represent different DNA sample concentrations, with a ratio of 1:10. 5 copies / μL, 2:10 4copies / μL, 3:10 3 copies / μL, 4:10 2 5: 10 copies / μL, 6: 5 copies / μL, 7: 2 copies / μL, 8: enzyme-free water;

[0036] Figure 10 The figures show the results of specificity experiments for the RPACRISPR Cas12b diagnostic system. Figure A shows the results of specificity experiments for the IS6110 RPACRISPR Cas12b diagnostic system, and Figure B shows the results of specificity experiments for the IS1081 RPACRISPR Cas12b diagnostic system. Figures 1-5 represent genomic DNA from different strains: 1: Mycobacterium bovis strain BCG genomic DNA, 2: Staphylococcus aureus strain genomic DNA, 3: Candida albicans strain genomic DNA, 4: Escherichia coli strain genomic DNA, and 5: enzyme-free water.

[0037] Figure 11 The graphs show the sensitivity test results of the RPACRISPR Cas12b diagnostic system for detecting simulated bovine milk samples. Figure A shows the sensitivity test results of the IS6110 RPACRISPR Cas12b diagnostic system, and Figure B shows the sensitivity test results of the IS1081 RPACRISPR Cas12b diagnostic system. 1–8 represent the following DNA sample concentrations: 1:10. 7 CFU / mL, 2:10 6 CFU / mL, 3:10 5 CFU / mL, 4:10 4 CFU / mL, 5:10 3 CFU / mL, 6:10 2 CFU / mL, 7: 10 CFU / mL, 8: enzyme-free water;

[0038] Figure 12 The image shows the results of RPA RISPR Cas12b detection in sputum samples from tuberculosis patients. 1-14 are the fluorescent reaction templates for RPA amplification after DNA extraction from sputum samples from tuberculosis patients, and 15 is the fluorescent reaction template for enzyme-free water.

[0039] Figure 13 The image shows the RPA CRISPR Cas12b detection results of milk samples from a dairy farm. The fluorescent reaction templates 1-36 are the products of RPA amplification after DNA extraction from the milk samples, and the fluorescent reaction template 37 is enzyme-free water. Detailed Implementation

[0040] The present invention provides an sgRNA for detecting mycobacteria, wherein the sgRNA comprises sgRNA-6110 as shown in SEQ ID NO:1 and / or sgRNA-1081 as shown in SEQ ID NO:2.

[0041] In this invention, both *Mycobacterium tuberculosis* and *Mycobacterium bovis* belong to the *Mycobacterium tuberculosis complex* (MTBC), and both can infect humans or animals such as cattle, causing tuberculosis. IS6110 is an insertion sequence widely present in the genome of the *Mycobacterium tuberculosis complex*, commonly used for the detection and molecular typing of *Mycobacterium tuberculosis*. The copy number of IS6110 varies among different mycobacterial strains, with a higher copy number in *Mycobacterium tuberculosis*, typically between 7 and 21, and it is also present in *Mycobacterium bovis*. The IS1081 fragment typically has 5 to 7 copies in *Mycobacterium bovis*, and it is also present in *Mycobacterium tuberculosis*.

[0042] In this invention, the sgRNA-6110 is designed based on the conserved gene IS6110 of Mycobacterium tuberculosis, and can specifically target IS6110 of both Mycobacterium tuberculosis and Mycobacterium bovis. The sgRNA-1081 is designed based on the conserved gene IS1081 of Mycobacterium bovis, and can specifically target IS1081 of both Mycobacterium tuberculosis and Mycobacterium bovis. Selecting the conserved genes IS6110 and IS1081 of Mycobacterium tuberculosis and Mycobacterium bovis as target genes ensures high homology among different strains, effectively improving the detection rate of tuberculosis pathogens, increasing the sensitivity of the diagnostic system, and reducing the false negative rate in pasture animals and close contacts in high-incidence areas of tuberculosis. Furthermore, the sgRNA of this invention has high specificity, recognizing only Mycobacterium tuberculosis and / or Mycobacterium bovis, and cannot recognize other common pathogens, such as Staphylococcus aureus, Candida albicans, and Escherichia coli. In this embodiment of the invention, three specific sgRNAs were designed for the target sequences IS1081 and IS6110, respectively. The optimal sgRNA was screened using the CRISPR Cas12b diagnostic system. The results showed that sgRNA-6110 with the sequence SEQ ID NO:1 and / or sgRNA-1081 with the nucleotide sequence SEQ ID NO:2 had an early peak time, high fluorescence intensity, and high sensitivity when used for detection.

[0043] The present invention provides a reagent for detecting mycobacteria, comprising the following components: sgRNA, Cas12b protease, and single-stranded nucleic acid reporter molecule.

[0044] In this invention, the design of the sgRNA is crucial for the detection efficiency of the diagnostic system. In CRISPR detection, the sgRNA guides the Cas12b protease to precisely target the target DNA sequence. Through its specific 20-nucleotide sequence complementary pairing with the target gene, it activates the trans-cleavage activity of the Cas12b protease, cleaving the free single-stranded nucleic acid reporter molecule (ssDNA) in the reaction system. This separates the fluorescent and quenching groups modified on the ssDNA, thereby generating a visible fluorescent detection signal. The Cas12b protease amplifies the signal, enabling the detection of low-abundance target DNA. The single-stranded nucleic acid reporter molecule preferably comprises a single-stranded nucleotide labeled with a fluorescent group at the 5' end and a fluorescent quenching group at the 3' end. The fluorescent group is preferably at least one of the following: FAM, TET, VIC, and HEX; the fluorescent quenching group is preferably TAMRA and / or BHQ.

[0045] This invention provides the use of the sgRNA or the reagent in the preparation of a kit for detecting tuberculosis.

[0046] This invention provides a kit for detecting tuberculosis, comprising RPA primer pairs and the sgRNA or the reagent; the RPA primer pairs include the RPA-6110 primer pair and / or the RPA-1081 primer pair; the RPA-6110 primer pair includes primer pairs with nucleotide sequences as shown in SEQ ID NO: 3 and SEQ ID NO: 4; the RPA-1081 primer pair includes primer pairs with nucleotide sequences as shown in SEQ ID NO: 5 and SEQ ID NO: 6.

[0047] The detection principle of the reagent kit described in this invention is as follows: Figure 1 The kit described in this invention can simultaneously detect Mycobacterium tuberculosis and Mycobacterium bovis. When Mycobacterium tuberculosis and / or Mycobacterium bovis are present in the sample, the RPA primer pair performs RPA amplification on the target gene to obtain the RPA amplification product. The RPA amplification product is then mixed with the sgRNA, Cas12b protease, and single-stranded nucleic acid reporter molecule and incubated. The sgRNA specifically binds to the target sequence of the RPA amplification product, activating the Cas12b protease, which cleaves the single-stranded nucleic acid reporter molecule labeled with a fluorescent group and a quencher group, thereby releasing the fluorescent group and producing fluorescence. Conversely, when Mycobacterium tuberculosis and / or Mycobacterium bovis are not present in the sample, no fluorescence is produced.

[0048] In this invention, the RPA-6110 primer pair specifically amplifies IS6110, and the resulting amplification product contains a target sequence complementary to sgRNA-6110 in the sgRNA; the RPA-1081 primer pair specifically amplifies IS1081, and the resulting amplification product contains a target sequence complementary to sgRNA-1081 in the sgRNA. In this embodiment of the invention, three pairs of RPA primers were designed for sgRNA-6110 and sgRNA-1081, and the RPA-6110 primer pair and the RPA-1081 primer pair were selected through RPA amplification and RPA-ARPA-RISPR-Cas12b technology, exhibiting early peak time, high fluorescence intensity, and high efficiency in amplifying specific fragments. The tuberculosis subjects preferably include humans or animals. The animals preferably include mammals, more preferably bovine animals. The samples detected by the kit include at least one of the following: blood, saliva, milk, and sputum. The kit described in this invention simultaneously selects the highly conserved specific targets IS6110 and IS1081 of Mycobacterium tuberculosis and Mycobacterium bovis, and uses optimized sgRNA and RPA amplification primers to carry out detection based on RPACRISPR Cas12b technology. This expands the detection spectrum of tuberculosis pathogens while improving detection sensitivity, and achieves rapid and specific detection of target pathogens.

[0049] This invention provides a method for detecting mycobacteria for non-diagnostic purposes, comprising the following steps:

[0050] 1) Using the genomic DNA of the sample to be tested as a template, RPA amplification was performed using the RPA primer pair to obtain the RPA amplification product;

[0051] 2) Mix the RPA amplification product, the sgRNA, the Cas12b protease, and the single-stranded nucleic acid reporter molecule, and incubate to obtain the reaction product;

[0052] 3) Measure the fluorescence intensity of the reaction product, and determine whether the sample contains mycobacteria based on the presence or absence of fluorescence intensity: when a fluorescence intensity signal is detected, it indicates that the sample contains Mycobacterium tuberculosis and / or Mycobacterium bovis, otherwise it does not.

[0053] This invention uses the genomic DNA of the sample to be tested as a template and performs RPA amplification using the RPA primer pairs to obtain RPA amplification products.

[0054] In this invention, the sample to be tested preferably includes at least one of the following: dairy products, blood, saliva, sputum, and meat products. The sample to be tested is preferably inactivated at high temperature before genomic DNA extraction to ensure biosafety. The extraction method of the genomic DNA preferably includes the kit method; this invention does not specifically limit the extraction method of genomic DNA, and conventional genomic DNA extraction methods in the art can be used. In this embodiment of the invention, the genomic DNA is extracted using the TIANGEN DNA extraction kit. The isothermal amplification using the RPA primer pair is preferably performed using the RPA-6110 primer pair and the RPA-1081 primer pair, respectively, to obtain the RPA-6110 amplification product and the RPA-1081 primer pair. The isothermal amplification reaction system is preferably: 14.7 μL of Abuffer, 1 μL each of 10 μM upstream and downstream primers, 5 μL of template, 1.25 μL of B buffer, and enzyme-free water to a final volume of 25 μL. The isothermal amplification reaction program is preferably 42°C for 30 min. This invention does not specifically limit the source of reagents for RPA amplification; any conventional RPA amplification kit in the art can be used. In the embodiments of this invention, an RPA amplification kit was used for isothermal amplification. The RPA amplification kit was purchased from Anpu Future Biotechnology Co., Ltd., and its trade name is DNA Isothermal Rapid Amplification Kit (Basic Type).

[0055] After obtaining the RPA amplification product, the present invention mixes the RPA amplification product, the sgRNA, the Cas12b protease, and a single-stranded nucleic acid reporter molecule, and incubates them to obtain the reaction product. In this invention, the preferred incubation reaction program is 42°C for 60 min. The preferred incubation system consists of 1 μL of isothermal amplification product, 100 nM of sgRNA, 100 nM of Cas12b protease, 0.5 μL of 10 μM fluorescently modified ssDNA probe, 2.5 μL of 10×Reaction Buffer, and enzyme-free water to a final volume of 25 μL. Fluorescence is collected in real time during the incubation reaction (one cycle is 1 min).

[0056] After obtaining the reaction product, the fluorescence intensity of the reaction product is measured. The presence or absence of fluorescence intensity determines whether the sample contains mycobacteria: a detected fluorescence intensity signal indicates the presence of Mycobacterium tuberculosis and / or Mycobacterium bovis in the sample, while the absence of fluorescence indicates its absence. This invention does not specifically limit the method for measuring fluorescence intensity; conventional fluorescence intensity detection methods in the art are acceptable. In this embodiment, a UV nucleic acid gel digester is used for fluorescence intensity detection, and a Real-time PCR instrument is used to collect real-time fluorescence signals.

[0057] In this invention, the detected fluorescence intensity signal is preferably a fluorescence intensity value of the reaction product > 2000. When the fluorescence intensity value is > 2000, fluorescence can be observed with the naked eye. The mycobacteria preferably include Mycobacterium tuberculosis and / or Mycobacterium bovis. The concentration of Mycobacterium tuberculosis and / or Mycobacterium bovis in the sample to be tested is not less than 2 copies / μL.

[0058] The method described in this invention can simultaneously detect Mycobacterium tuberculosis and Mycobacterium bovis. By simultaneously selecting the highly conserved specific targets IS6110 and IS1081 for both Mycobacterium tuberculosis and Mycobacterium bovis, the pathogen spectrum is broadened and diagnostic sensitivity is improved. Optimized sgRNA and RPA amplification primer design and screening enable rapid and specific identification of the target pathogen. Simultaneously, the reaction system was optimized to allow target sequence amplification and detection to be performed at the same temperature of 42°C. The highest detection efficiency was achieved when the concentration ratio of sgRNA and Cas12b protease in the RPA-CRISPR Cas12b reaction system was 1:1, and the detection efficiency increased with increasing concentration, thus improving detection sensitivity. The sensitivity of the method was verified by detecting diluted plasmid samples containing the target and diluted bacterial culture samples containing bovine milk. The results showed that the limit of detection for plasmid samples was 2 copies / μL, and the limit of detection for bacterial culture samples was 10 CFU / μL. The specificity of the method was validated by detecting common pathogens (Staphylococcus aureus, Candida albicans, and Escherichia coli), and the results showed that the method can distinguish between target and non-target strains. This demonstrates that the method has high detection sensitivity and strong diagnostic system specificity. Furthermore, the method of this invention can detect sputum samples from tuberculosis patients and simulated milk samples, exhibiting high sensitivity and specificity. It has strong practical value for field diagnosis in areas with high tuberculosis incidence in the future, providing a new and efficient tool for tuberculosis diagnosis and is expected to play an important role in the field of public health.

[0059] The method described in this invention has the following advantages:

[0060] 1) Speed: This diagnostic system is based on CRISPR technology and can quickly detect Mycobacterium tuberculosis and Mycobacterium bovis, which greatly shortens the detection time compared with traditional detection methods;

[0061] 2) High sensitivity: The RPACRISPR Cas12b diagnostic system has a sensitivity of 2 copies / μL, which means that even extremely low amounts of pathogens can be detected, improving diagnostic accuracy;

[0062] 3) Easy to operate: The diagnostic system has a constant temperature reaction, which simplifies the requirements for using the testing instrument and makes the testing process simpler and faster, and can be used on site;

[0063] 4) High specificity: The selected target sequences of Mycobacterium tuberculosis and Mycobacterium bovis are highly conserved and have good specificity. They will only produce strong green fluorescence when the reaction template is the DNA of the target pathogen.

[0064] 5) Easy integration: The CRISPR system is easy to integrate into portable platforms, making it suitable for field use and point-of-care testing (POCT), increasing the convenience and accessibility of testing;

[0065] 6) Potential multiplex detection capability: CRISPR technology can theoretically be extended to multiplex detection, which makes it possible to develop diagnostic tools that can simultaneously detect multiple pathogens or drug resistance genes in the future.

[0066] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, provides a method and application for detecting tuberculosis sgRNA based on RPA-CRISPR Cas12b technology, including a kit and detection method. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0067] Example 1

[0068] Determination of target gene sequences

[0069] The specific conserved sequences IS6110 and IS1081 of Mycobacterium tuberculosis and Mycobacterium bovis were selected as two detection targets. PCR primers for the IS6110 and IS1081 targets were designed. The copy number of the target sequences and the species present are shown in Table 1. The primer sequences for PCR amplification are shown in Table 2.

[0070] Table 1 Targets and present bacterial species

[0071] Insertion sequence length Existing strains IS6110 1361 Mycobacterium tuberculosis and Mycobacterium bovis IS1081 1324 Mycobacterium bovis and Mycobacterium tuberculosis

[0072] Table 2 Primer sequences for IS6110 and IS1081

[0073]

[0074]

[0075] PCR amplification was performed using whole-genome DNA from Mycobacterium tuberculosis strain H37Rv and Mycobacterium bovis strain BCG as templates to verify the presence of target genes IS6110 and IS1081 in both Mycobacterium tuberculosis and Mycobacterium bovis. The Mycobacterium tuberculosis strain H37Rv was the standard strain purchased from the American Center for Type Culture Collection (ATCC) (accession number: ATCC93009). The Mycobacterium bovis strain BCG was an attenuated Mycobacterium bovis vaccine strain BCG (Bacillus Calmette-Guérin), i.e., BCG vaccine, purchased from Chengdu Institute of Biological Products Co., Ltd.

[0076] PCR amplification system: template DNA <0.5 μg; 1 μL of 10 μM forward primer; 1 μL of 10 μM reverse primer; 12.5 μL of 2×TransTaq HiFi PCR SuperMix; ddH2O to a final volume of 25 μL. Amplification reagents were purchased from TransGenBiotech.

[0077] PCR program settings: cap temperature 105℃, reaction volume: 25μL; pre-denaturation 94℃, 5min; denaturation 94℃, 30s; annealing 65℃, 30s; extension 72℃, 30s; repeat this process 30 times; final extension 72℃, 10min; reaction completed, yielding IS6110 PCR products and IS1081 PCR products with H37Rv genome template, and IS6110 PCR products and IS1081 PCR products with BCG genome template, respectively.

[0078] PCR product electrophoresis detection results are as follows Figure 2 As shown (nucleic acid electrophoresis sample loading volume 5 μL). From Figure 2 It can be seen that the target band can be amplified using the genomic DNA of Mycobacterium tuberculosis or Mycobacterium bovis reference strains as templates.

[0079] Example 2

[0080] sgRNA design and screening experiments

[0081] Based on the specific conserved target sequences IS6110 and IS1081 of Mycobacterium tuberculosis and Mycobacterium bovis, three specific sgRNAs were designed for each of IS6110 and IS1081. The optimal sgRNAs were selected by CRISPR-Cas12b detection. The sequence information of the sgRNAs is shown in Table 3. The sgRNAs were synthesized by Gemma Genetics Co., Ltd.

[0082] Table 3. sgRNA sequences of IS6110 and IS1081

[0083]

[0084]

[0085] The reaction system for screening sgRNA consisted of 2.5 μL of 10×Reaction Buffer, 0.5 μL of 2 μM fluorescently modified ssDNA probe (FAM-BHQ), a final concentration of 50 nM for sgRNA and 50 nM for Cas12b, and 1 μL of IS6110 PCR product of the H37Rv genome or IS1081 PCR product of the BCG genome from Example 1 as templates. Enzyme-free water was added to a final volume of 25 μL. The fluorescently modified ssDNA probe, 2.5 μL of 10×Reaction Buffer, and Cas12b protease were all purchased from Megbio.

[0086] Reaction procedure: React at 42℃ for 60 min, and collect fluorescence intensity signals in real time.

[0087] A control (NC) was set up, with enzyme-free water as the reaction template.

[0088] The fluorescence signal intensity results are shown in Figure 3 and Figure 4 .according to Figure 3 and Figure 4 It can be seen that sgRNA2-6110 and sgRNA4-1081 have earlier peak times and higher fluorescence intensity.

[0089] In addition, sgRNAs were screened using 1 μL of the IS6110 PCR product of the BCG genome or the IS1081 PCR product of the H37Rv genome from Example 1 as templates. The results also showed that sgRNA2-6110 and sgRNA4-1081 had earlier peak times and higher fluorescence intensity.

[0090] Therefore, the optimal sgRNA for IS6110 is sgRNA2-6110, and the optimal sgRNA for IS1081 is sgRNA4-1081. Subsequent experiments were conducted using sgRNA2-6110 and sgRNA4-1081.

[0091] Example 3

[0092] Optimization experiment of the reaction system of CRISPR Cas12b diagnostic system

[0093] To improve the detection efficiency of the diagnostic system, the optimal reaction concentration ratio of sgRNA and Cas12b protease in the CRISPR-Cas12b detection reaction was determined through experiments.

[0094] In the reaction system for the optimized concentration ratio experiment, the reaction template was the IS6110 PCR product of the H37Rv genome in Example 1, and the sgRNA was sgRNA2-6110; the concentrations and well order of Cas12b and sgRNA2-6110 are shown in Table 4.

[0095] Table 4. Experimental Pore Concentration and Order

[0096] reagents Hole 1 Hole 2 Hole 3 Hole 4 Hole 5 Hole 6 Hole 7 Cas12b(nM) 100 100 100 200 200 200 100 sgRNA2-6110(nM) 100 150 200 100 150 200 100

[0097] The reaction system for the optimized concentration ratio experiment consisted of: 2.5 μL of 10×Reaction Buffer, 0.5 μL of a 10 μM fluorescently modified ssDNA probe, sgRNA at a final concentration of 100 nM, 150 nM, or 200 nM, Cas12b at a final concentration of 100 nM or 200 nM, 1 μL of template, and enzyme-free water to a final volume of 25 μL. The reaction program was 42℃ for 60 min, with real-time fluorescence signal collection. The fluorescently modified ssDNA probe (FAM-BHQ), 2.5 μL of 10×Reaction Buffer, and Cas12b protease were all purchased from Megvii Biotechnology. A control (NC) was also set up, with enzyme-free water as the template.

[0098] The fluorescence detection results are shown below. Figure 5 .according to Figure 5 The results showed that wells 1 and 6 had high fluorescence intensity, with well 6 exhibiting a higher fluorescence intensity than well 1. Similarly, optimizing the concentration ratio using the IS6110 PCR product of the BCG genome from Example 1 as a template yielded the same results.

[0099] Therefore, a 1:1 concentration ratio of Cas12b to sgRNA in the reaction system results in higher detection efficiency, and the detection efficiency increases with increasing concentration. In future applications using real samples, it is advisable to appropriately increase the concentrations of both sgRNA and Cas12b while maintaining a final 1:1 ratio in the reaction to improve the detection efficiency of the diagnostic system.

[0100] Example 4

[0101] Design and screening experiments of primers for recombinase polymerase isothermal amplification (RPA)

[0102] The target fragment for RPA amplification must contain a target sequence complementary to the sgRNA. For the optimal sgRNAs (IS6110-sgRNA2 and IS1081-sgRNA4) screened in Example 2, three pairs of RPA primers were designed for each. The primer pair sequences are shown in Table 5. The optimal RPA primer pairs were selected by following the instructions of the Amp Future RPA Amplification Kit.

[0103] Table 5. IS6110 and IS1081 RPA primer pair sequences

[0104] RPA primer name RPA primer sequence IS6110-F1: CACATCAGCCGCGTCCACGCCGCCAACTACG (SEQ ID NO: 15) IS6110-R1: CTTTCAGGTCGAGTACGCCTTCTTGTTGGCG (SEQ ID NO: 16) IS6110-F2: CGCAAAGTGTGGCTAACCCTGAACCGTGAGG (SEQ ID NO: 3) IS6110-R2: CCGTATGGTGGATAACGTCTTTCAGGTCGAG (SEQ ID NO: 4) IS6110-F3: CGCTTCGGACCACCAGCACCTAACCGGCTGT (SEQ ID NO: 17) IS6110-R3: CGCTCGCTGAACCGGATCGATGTGTACTGAG (SEQ ID NO: 18) IS1081-F1: CGCGAACGCAGCGATGAGCGGTCCAATCAGC (SEQ ID NO: 19) IS1081-R1: CGGGCGGGTCCGAAACGCCTCTACGGCTTCG (SEQ ID NO: 20) IS1081-F2: CCGCAAGCGAGCTGAACGCGCACTGACCAGC (SEQ ID NO: 5) IS1081-R2: CGAGGAAGGTATACGGGCCGGCATCGAGCGG (SEQ ID NO: 6) IS1081-F3: CTGCTGGGAGTATCCACTCGCCGGATGGAGC (SEQ ID NO: 21) IS1081-R3: CGGCGAGGAAGGTATACGGGCCGGCATCGAG (SEQ ID NO: 22)

[0105] The template for RPA amplification was the whole BCG genome. The RPA amplification reaction system consisted of: 14.7 μL of Abuffer, 1 μL each of 10 μM upstream and downstream primers, 5 μL of template, 1.25 μL of B buffer, and enzyme-free water to a final volume of 25 μL. The reaction was incubated at 42℃ for 30 min. After the isothermal amplification reaction, 8 μL of 6× Loading Buffer was added to the reaction product using a heat denaturation method, and the mixture was incubated at 56℃ for 5 min. A 5 μL sample of the mixture was then analyzed by agarose gel electrophoresis.

[0106] RPA amplification yielded the RPA amplification product, which was used as the target for subsequent CRISPR fluorescence detection. The CRISPR fluorescence detection reaction system was prepared as follows: 1 μL of the isothermal amplified product was added to the reaction system along with 100 nM sgRNA-6110 and 100 nM sgRNA-1081. Then, 100 nM Cas12b protease, 0.5 μL of fluorescein-modified 10 μM ssDNA probe, and 2.5 μL of 10× Reaction Buffer were added to the reaction system. Enzyme-free water was added to bring the total volume to 25 μL. Enzyme-free water was used as the NC reaction template. The reaction system was then added to an RNase-free PCR tube and thoroughly mixed. The reaction was incubated at 42℃ for 60 min, and the fluorescence intensity was observed. After the reaction, the fluorescence was observed and photographed under UV light.

[0107] Based on the results of agarose gel electrophoresis ( Figure 6 ) and CRISPR Cas12b fluorescence detection results ( Figure 7 and Figure 8 The RPA primer pairs IS6110-F2 and IS6110-R2, which amplify the target sequence IS6110, were selected as the optimal RPA primer pairs for IS6110 because they exhibited the earliest peak time and the strongest fluorescence intensity. Similarly, the RPA primer pairs IS1081-F2 and IS1081-R2, which amplify the target sequence IS1081, were also selected as the optimal RPA primer pairs for IS1081. These optimal primer pairs were used for subsequent experiments.

[0108] Example 5

[0109] Sensitivity test of RPACRISPR Cas12b diagnostic system

[0110] Using the optimal sgRNA for IS6110 and IS1081 selected in Example 2 and the optimal RPA primer pair selected in Example 4, RPA amplification and CRISPR Cas12b fluorescence detection were performed at an sgRNA:Cas12b concentration ratio of 1:1. The reaction was carried out at a constant temperature of 42°C.

[0111] Number of DNA template copies per microliter = (6.02 × 10⁻⁶) 23 )×(concentration ng / μL×10 -9 Formula I: (DNA length × 660)

[0112] The copy number of plasmids containing IS6110 and IS1081 fragments was calculated according to Formula I, and then serially diluted 10-fold.

[0113] RPA amplification reactions were performed using serially diluted plasmids as DNA templates. The reaction mixture consisted of: 14.7 μL Abuffer, 1 μL of 10 μM upstream primer, 1 μL of 10 μM downstream primer, 5 μL DNA template, 1.25 μL B buffer, and enzyme-free water to a final volume of 25 μL. The reaction program was 42 °C for 30 min.

[0114] RPA amplification yielded the RPA amplification product. Using the RPA amplification product as a template for the CRISPR reaction, a CRISPR fluorescence detection reaction system was prepared: 1 μL of the RPA amplification product was added to the reaction system, along with Cas12b protease (final concentration 100 nM), sgRNA (final concentration 100 nM), 1 μL of the RPA amplification product as template, 0.5 μL (2 μM) of fluorescently modified ssDNA probe, and 2.5 μL of 10× Reaction Buffer. Enzyme-free water was added to bring the total volume to 25 μL. The reaction system was then transferred to an RNase-free PCR tube and thoroughly mixed. The reaction was incubated at 42℃ for 60 min, and the fluorescence intensity was observed to determine the limit of detection (LOD) of the RPA-CRISPR Cas12b diagnostic system.

[0115] Based on the CRISPR Cas12b fluorescence detection results ( Figure 9 It can be observed that the detection sensitivity of the diagnostic system can be as low as 2 copies / μL.

[0116] Example 6

[0117] RPACRISPR Cas12b diagnostic system specificity

[0118] System specificity assessment using single bacterial DNA as a template. The steps are as follows: First, common laboratory pathogens such as Staphylococcus aureus, Candida albicans, and Escherichia coli were selected, and genome extraction was performed according to the instructions of the Tiangen Bacterial Genomic DNA Extraction Kit. The extracted genomes were stored at -20℃ for subsequent use.

[0119] Using the extracted genomic DNA of different pathogenic bacterial strains and BCG strains at a final concentration of 50 nM as templates, RPA amplification reactions were performed respectively, with the reaction system and reaction procedure being the same as in Example 5.

[0120] After RPA amplification, the RPA amplification product was obtained. The RPA amplification product was used as a template for the CRISPR reaction to perform the CRISPR-Cas12b fluorescence detection reaction. The system and procedure of the CRISPR fluorescence detection reaction were the same as in Example 5.

[0121] Based on the CRISPR Cas12b fluorescence detection results ( Figure 10 As can be seen, only test samples containing BCG produce fluorescence in their reaction products, while test samples containing Staphylococcus aureus, Candida albicans, and Escherichia coli do not produce fluorescence. Therefore, the RPACRISPR Cas12b diagnostic system has the ability to distinguish between target and non-target strains.

[0122] Example 7

[0123] Application Experiment of RPACRISPR Cas12b Tuberculosis Diagnostic System

[0124] 1. Detection limit of the RPACRISPR Cas12b tuberculosis diagnostic system for simulated milk samples

[0125] To evaluate the sensitivity and practical value of the detection system in real samples, we simulated milk samples by purchasing sterilized milk from a local supermarket and mixing it with counted BCG (Bacille Calmette-Guérin) bacterial culture, followed by 10-fold serial dilutions to simulate milk samples that might be collected from a farm. These samples were then pretreated, subjected to nucleic acid extraction, RPA amplification, and CRISPR fluorescence detection.

[0126] The simulated milk sample DNA extracted by the TIANGEN DP304 kit was used as the template for the RPA amplification reaction. The Amp Future DNA Isothermal Rapid Amplification Kit (Basic Type) was used, and the reaction system and reaction procedure were the same as in Example 5.

[0127] After RPA amplification, the RPA amplification product was obtained. The RPA amplification product was used as a template for the CRISPR reaction to perform the CRISPR-Cas12b fluorescence detection reaction. The system and procedure of the CRISPR fluorescence detection reaction were the same as in Example 5.

[0128] Based on the CRISPR Cas12b fluorescence detection results ( Figure 11 As can be seen, the RPACRISPR Cas12b tuberculosis diagnostic system exhibits extremely high sensitivity when testing milk samples, capable of detecting concentrations as low as 10 CFU / mL. This system holds promise for application in field trials in areas with high tuberculosis prevalence, enabling the testing of ranch animals and their close contacts for broader disease surveillance.

[0129] 2. RPACRISPR Cas12b tuberculosis diagnostic system for the detection of sputum samples from clinical tuberculosis patients.

[0130] Sputum samples were collected from 14 patients clinically diagnosed with tuberculosis at a hospital and subjected to RPA CRISPR Cas12b fluorescence detection. The results of the 14 tuberculosis patients using different methods are as follows: tuberculosis smear examination was positive in 3 cases, IFN-γ release test was positive in 6 cases, rapid rifampicin resistance X-pert test for tuberculosis was positive in 11 cases, and tuberculosis antibody IgG test was positive in 1 case. Detailed information is shown in Table 6.

[0131] RPACRISPR Cas12b tuberculosis diagnostic system for detecting sputum samples from clinical tuberculosis patients:

[0132] Sputum sample pretreatment: Boiling water for 30 minutes ensures biosafety and induces bacterial lysis. Nucleic acid extraction was performed using the Qiagen DNAMini Kit: 900 μL of boiled sputum was transferred to a 1.5 ml centrifuge tube. 180 μL of Buffer ATL and 20 μL of Proteinase K were added, vortexed, and incubated at 56°C until complete lysis (1–3 h). Vortexing was performed during incubation. Nucleic acid extraction was then performed according to the kit instructions.

[0133] The DNA extracted from clinical sputum samples using the kit was used as the template for the RPA amplification reaction. The Amp Future DNA Isothermal Rapid Amplification Kit (Basic Type) was used, and the reaction system and procedure were the same as in Example 5.

[0134] After RPA amplification, the RPA amplification product was obtained. The RPA amplification product was used as a template for the CRISPR reaction to perform the CRISPR-Cas12b fluorescence detection reaction. The system and procedure of the CRISPR fluorescence detection reaction were the same as in Example 5.

[0135] Based on the CRISPR Cas12b fluorescence detection results ( Figure 12 As shown in Table 6, the RPACRISPR tuberculosis detection system detected positive results in all 14 sputum samples from tuberculosis patients.

[0136] Table 6 shows the results of sputum sample testing from 614 tuberculosis patients.

[0137]

[0138] Note: + indicates a positive result.

[0139] 3. RPA CRISPR Cas12b tuberculosis diagnostic system for testing milk samples from dairy farm herds.

[0140] Milk samples were collected from 36 dairy cows in a herd that tested positive for PPD intradermal allergy. One sample was collected from each cow, for a total of 36 samples. RPA CRISPR Cas12b fluorescence detection was performed, and a commercially available fluorescent PCR detection kit was also used. Blood samples were aseptically collected from all 36 cows, added to heparinized anticoagulant vacuum tubes, and transported to the laboratory for tuberculosis retesting using a commercially available IFN-γ release assay kit. Information on bovine tuberculosis testing is shown in Table 7.

[0141] Milk sample processing: Nucleic acid extraction was performed using the TIANGEN DP304 DNAKit kit in a biosafety cabinet: 200 μL of milk sample was placed in a 1.5 ml centrifuge tube. 200 μL of buffer GA, 20 μL of proteinase K, and 200 μL of buffer GB were added. The mixture was vortexed and incubated at 70°C until complete lysis (10 min). During incubation, the mixture was inverted to mix thoroughly. Nucleic acid extraction was then performed according to the kit instructions.

[0142] The DNA extracted from clinical sputum samples using the kit was used as the template for the RPA amplification reaction. The Amp Future DNA Isothermal Rapid Amplification Kit (Basic Type) was used, and the reaction system and procedure were the same as in Example 5.

[0143] After RPA amplification, the RPA amplification product was obtained. The RPA amplification product was used as a template for the CRISPR reaction to perform the CRISPR-Cas12b fluorescence detection reaction. The system and procedure of the CRISPR fluorescence detection reaction were the same as in Example 5.

[0144] Based on the CRISPR Cas12b fluorescence detection results ( Figure 13The results show that the RPA CRISPR tuberculosis detection system detected 28 positive samples out of 36 milk samples, with a positive rate of 77.8%, which is higher than that of commercially available fluorescent PCR kits. The commercially available fluorescent PCR method detected 20 positive samples, with a positive rate of 55.6%.

[0145] Table 7. Diagnostic results of tuberculosis in dairy cows and results of milk sample testing.

[0146]

[0147] Note: + indicates a positive test result.

[0148] Based on the above experimental results, it can be seen that the method of the present invention provides a technical basis for the detection of tuberculosis pathogens and disease monitoring in suspected tuberculosis patients or pasture animals, and has great potential and value in clinical application, which is of great significance for the early diagnosis and prevention of tuberculosis.

[0149] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. Other embodiments can be obtained based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A kit for detecting tuberculosis, characterized in that, Including RPA primer pairs and sgRNA; The RPA primer pair and sgRNA include at least one of the following: 1) RPA-6110 primer pair and sgRNA-6110; The RPA-6110 primer pair includes primer pairs with nucleotide sequences as shown in SEQ ID NO: 3 and SEQ ID NO: 4; the nucleotide sequence of the sgRNA-6110 is shown in SEQ ID NO: 1; 2) RPA-1081 primer pair and sgRNA-1081; The RPA-1081 primer pair includes primer pairs with nucleotide sequences as shown in SEQ ID NO: 5 and SEQ ID NO: 6; the nucleotide sequence of the sgRNA-1081 is shown in SEQ ID NO:

2.

2. The reagent kit according to claim 1, characterized in that, It also includes the Cas12b protease and single-stranded nucleic acid reporter molecules.

3. The reagent kit according to claim 2, characterized in that, The single-stranded nucleic acid reporter molecule comprises a single-stranded nucleotide with a fluorescent group labeled at the 5' end and a fluorescent quencher group labeled at the 3' end.

4. A method for detecting Mycobacterium tuberculosis and / or Mycobacterium bovis for non-diagnostic purposes, characterized in that, Includes the following steps: 1) Using the genomic DNA of the sample to be tested as a template, RPA amplification is performed using the RPA primer pair described in the kit of claim 3 to obtain RPA amplification products; 2) Mix the RPA amplification product, the sgRNA and the Cas12b protease and single-stranded nucleic acid reporter molecule in the kit of claim 3, and incubate to obtain the reaction product; 3) Measure the fluorescence intensity of the reaction product, and determine whether the sample contains mycobacteria based on the presence or absence of fluorescence intensity: When the sample to be tested is detected using the RPA-6110 primer pair and sgRNA-6110, the detection of a fluorescence intensity signal indicates that the sample to be tested contains Mycobacterium tuberculosis, and vice versa. When the sample to be tested is detected using the RPA-1081 primer pair and sgRNA-1081, the detection of a fluorescence intensity signal indicates that the sample contains Mycobacterium bovis, and vice versa.

5. The method according to claim 4, characterized in that, The reaction procedure for RPA amplification in step 1) is to react at 42°C for 30 min.

6. The method according to claim 4, characterized in that, The reaction system for RPA amplification described in step 1) is as follows: 14.7 μL of Abuffer, 1 μL each of 10 μM RPA upstream and downstream primers, 5 μL of template, 1.25 μL of B buffer, and enzyme-free water to a final volume of 25 μL.

7. The method according to claim 4, characterized in that, The incubation reaction procedure described in step 2) is to react at 42°C for 60 minutes.

Citation Information

Patent Citations

  • CRISPR / Cas-based intracellular mycobacterium tuberculosis in-situ nucleic acid detection method and application

    CN119799929A