A stress-relieving composition containing camellia flower extract and its application

Abstract

The present application relates to the technical field of skin care products, and particularly relates to a soothing stress composition containing camellia extract and application thereof.The composition comprises the following components: camellia extract, porphyridium extract, pseudoillicium leaf extract and ophiopogon japonicus extract, which synergistically regulate and completely intervene in the neuroinflammatory pathway, block the transmission of nerve stimulation signals, reduce the release of neuropeptides and inflammatory factors, and repair damaged nerve barriers, so as to achieve the effect of comprehensively relieving skin sensitive reactions.The composition not only has faster and more durable effects, but also has good safety and applicability, and is particularly suitable for skin protection and conditioning of high-sensitivity skin and in extreme environments.

Description

Technical Field

[0001] This invention relates to the technical field of skincare products, specifically to a soothing stress composition containing camellia extract and its application. Background Technology

[0002] In recent years, more and more people have been troubled by sensitive skin, a skin condition characterized by intolerance to changes in the external environment and the use of certain skincare products. There are three main mechanisms underlying sensitive skin: impaired skin barrier function, epidermal inflammation, and abnormalities in the skin's sensory nervous system. These mechanisms often interact, creating a vicious cycle that perpetuates sensitive skin. Sensitive skin is accompanied by subjective sensations such as tightness, stinging, short-term burning, and persistent itching, or objective symptoms such as telangiectasia, redness, erythema, peeling, and dryness.

[0003] Currently, the beauty and skincare industry has developed various products and methods to address skin sensitivity, inflammation, and neurogenic discomfort, primarily including anti-inflammatory repair creams, soothing sprays, and antihistamine ointments. While these products can alleviate some symptoms to a certain extent, their effects on improving nerve conduction speed are often limited, failing to provide rapid and lasting relief. Due to the highly complex signal transduction mechanisms and bioelectrical regulation of skin sensory neurons, traditional products often work by inhibiting inflammatory responses, calming nerve endings, or improving vascular responses. These methods are typically slow and cannot meet the need for rapid relief of acute irritations. Especially in cases of intense stress or severely sensitive skin, existing methods have long reaction times and cannot provide instantaneous relief, resulting in a poor user experience. Furthermore, products with single mechanisms of action are susceptible to individual differences, leading to inconsistent efficacy and limiting their widespread application and popularity.

[0004] These challenges reflect the industry's urgent need for a new solution with multi-target and multi-mechanism synergistic effects to achieve rapid inhibition of nerve conduction and immediate relief of skin sensitivity symptoms, thereby meeting the market's pressing demand for efficient, safe, and fast-responding products. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a stress-relieving composition containing camellia extract and its application. The raw material components in the composition work synergistically to produce a multi-target, multi-mechanism synergistic effect, which can achieve rapid inhibition of nerve conduction and immediate relief of skin sensitivity symptoms, thus meeting the market's urgent demand for efficient, safe, and fast-response products.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides a stress-relieving composition containing camellia extract, comprising the following components: camellia extract, *Porphyra yezoensis* extract, *Illicium verum* leaf extract, and vetiver extract, wherein the weight ratio of the camellia extract, *Porphyra yezoensis* extract, *Illicium verum* leaf extract, and vetiver extract is (0.1-5):(0.01-5):(0.1-3):(0.01-1).

[0008] Camellia extract, derived from plants of the Theaceae family, is rich in active ingredients such as flavonoids and kaempferol. It rapidly relieves burning sensations and pain signal transmission caused by external stimuli by inhibiting the overactivation of TRPV1 receptors in the sensory nerve endings of the skin and reducing the release of neuropeptides induced by calcium ion influx, such as substance P and calcitonin gene-related peptide CGRP. It also synergistically blocks the expression of histamine receptor H1R, reducing neurogenic redness and swelling.

[0009] The extract of *Porphyrinus purpureus* contains unique phycocyanin and sulfated polysaccharides. Its core mechanism involves regulating the expression of the skin's vascular endothelial cell adhesion molecule-1 (ICAM-1), inhibiting mast cell degranulation and the release of histamine and TNF-α, and blocking the vasodilatory pathway in neurogenic inflammation. By balancing nitric oxide synthase activity, it effectively reduces stimulation-induced persistent erythema and temperature-sensitive reactions.

[0010] The main active components of the leaf extract of *Illicium verum* are shikimicin derivatives and terpenoids. It selectively inhibits the phosphorylation and activation of the sodium ion channel Nav1.7, blocking the transmission of abnormal action potentials to the central nervous system, targeting the hyperexcitability of skin neurons. Simultaneously, it reduces the sensitivity of nerve fibers transmitting itch sensation by activating the κ-opioid receptor (KOR) pathway, thus inhibiting the generation of itch at its source.

[0011] Vetiver extract is characterized by sesquiterpenes such as vetiverol and camphene. It enhances the inhibitory effect of GABA receptors on sensory neurons in the skin, thus desensitizing C-fiber-mediated itch signal transmission. It also regulates the activation of transient receptor potential M8 (TRPM8) channels, producing a cooling and soothing effect, neutralizing heat-induced pain sensitivity, and repairing damaged nerve barriers.

[0012] Preferably, the weight ratio of the camellia extract, the purple algae extract, the false star anise leaf extract, and the vetiver extract is (0.5-3):(0.05-2):(0.5-1):(0.05-0.5).

[0013] More preferably, the weight ratio of the camellia extract, the purple algae extract, the false star anise leaf extract and the vetiver extract is (0.5-1):(0.05-0.5):(0.6-0.8):(0.1-0.3).

[0014] Secondly, the present invention provides the application of the stress-relieving composition containing camellia extract described in the first aspect in the preparation of skin care products.

[0015] Preferably, the skin care product is any one of toner, lotion, cream, mask, serum or spray, and the amount of the composition added is 0.5%-5% of the total weight of the skin care product.

[0016] Thirdly, the present invention provides an essence comprising the following ingredients by weight percentage: 0.5%-5% of the composition described in the first aspect, 0.05%-0.3% of a thickener, 0.5%-10% of a moisturizer, 0.5%-5% of a preservative, and 0.01%-0.3% of a pH adjuster, with the balance being deionized water.

[0017] Preferably, the thickener comprises at least one of xanthan gum, carbomer, hydroxyethyl acrylate / sodium acryloyldimethyl taurate copolymer, ammonium acryloyldimethyl taurate / VP copolymer, sclerotium gum, and cetyl alcohol.

[0018] Preferably, the moisturizer comprises at least one of allantoin, betaine, β-glucan, trehalose, caprylyl glycol, dipropylene glycol, sodium hyaluronate, 1,3-butanediol, glycerin, budding stalk polysaccharide, and ceramide.

[0019] Preferably, the pH adjuster includes at least one of arginine, tromethamine, and disodium EDTA.

[0020] Preferably, the preservative includes at least one selected from 1,2-propanediol, 1,2-hexanediol, and p-hydroxyacetophenone. More preferably, the preservative is 1,2-hexanediol and p-hydroxyacetophenone.

[0021] Fourthly, the present invention provides a method for preparing the essence in the third aspect, comprising the following steps:

[0022] S1. Mix the humectant, thickener and 50% of the amount of deionized water, and homogenize to obtain an aqueous solution.

[0023] S2. When the temperature of the aqueous solution in S1 drops to 55-65℃, add the preservative. When the system temperature drops to 40-45℃, further add the components of the composition described in the first aspect, the fragrance, and the remaining deionized water to the system, stir evenly, and finally add a pH adjuster to adjust the pH to obtain the essence.

[0024] Preferably, the homogenization temperature in step S1 is 75-85℃.

[0025] Preferably, in step S2, the pH is adjusted to 5.5-6.5.

[0026] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0027] This invention provides a multi-component synergistic stress-relieving composition that effectively combines camellia extract, *Porphyra yezoensis* extract, *Illicium verum* leaf extract, and vetiver extract. Utilizing their respective active mechanisms, these components work together to significantly improve discomfort such as redness, heat, itching, and pain caused by neurogenic inflammation. The four components synergistically regulate and intervene in the neuroinflammatory pathway, blocking the transmission of nerve stimulation signals, reducing the release of neuropeptides and inflammatory factors, and repairing the damaged nerve barrier, achieving a comprehensive effect in relieving skin sensitivity reactions. The composition fully utilizes the ability of each component to inhibit nerve sensory pathways, regulate vascular responses, and reduce inflammatory factors, achieving simultaneous anti-allergy effects through multiple mechanisms, addressing the root cause of problems that existing methods struggle to solve. Specifically, by inhibiting the overactivation of nerve receptors such as TRPV1 and PAR-2, it blocks the cascade reaction of neuroinflammatory reactions, thereby rapidly relieving burning and pain caused by stimulation while enhancing the skin's self-repair ability. Its advantages lie in achieving a combined effect of multiple points and mechanisms, which is significantly better than existing single therapies or simple formulations on the market. It not only has faster and longer-lasting effects, but also has good safety and applicability, and is especially suitable for skin protection and conditioning in highly sensitive skin and extreme environments. Attached Figure Description

[0028] Figure 1 This is a comparison chart showing the use of the serum before (day 0) and after (day 14) in Application Example 1 and Comparative Application Example 8 (blank control group). Detailed Implementation

[0029] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0030] The sources of the raw materials used in the following examples and comparative examples are as follows:

[0031] Camellia extract: Clariant-Personal Care, trade name

[0032] Purple algae extract: Manufacturer is BSF, product name is

[0033] False star anise leaf extract: manufactured by Lucas Meyer, trade name TazmanPepper TM AF;

[0034] Vetiver extract: manufactured by Givaudan, trade name Vetivyne TM .

[0035] Unless otherwise specified, all other materials and reagents used in the examples are commercially available.

[0036] Example 1

[0037] A stress-relieving composition containing camellia extract, comprising camellia extract, purple algae extract, false star anise leaf extract and vetiver extract in a weight ratio of 0.7:0.3:0.7:0.2, wherein the total weight of the camellia extract, purple algae extract, false star anise leaf extract and vetiver extract is 100 parts.

[0038] Example 2

[0039] A stress-relieving composition containing camellia extract, comprising camellia extract, purple algae extract, false star anise leaf extract and vetiver extract in a weight ratio of 0.5:0.05:0.8:0.3, wherein the total weight of the camellia extract, purple algae extract, false star anise leaf extract and vetiver extract is 100 parts.

[0040] Example 3

[0041] A stress-relieving composition containing camellia extract, comprising camellia extract, purple algae extract, false star anise leaf extract and vetiver extract in a weight ratio of 1:0.5:0.6:0.1, wherein the total weight of the camellia extract, purple algae extract, false star anise leaf extract and vetiver extract is 100 parts.

[0042] Example 4

[0043] A stress-relieving composition containing camellia extract, comprising camellia extract, purple algae extract, false star anise leaf extract and vetiver extract in a weight ratio of 0.5:0.05:1:0.5, wherein the total weight of the camellia extract, purple algae extract, false star anise leaf extract and vetiver extract is 100 parts.

[0044] Example 5

[0045] A stress-relieving composition containing camellia extract, comprising camellia extract, purple algae extract, false star anise leaf extract and vetiver extract in a weight ratio of 3:2:0.5:0.05, wherein the total weight of the camellia extract, purple algae extract, false star anise leaf extract and vetiver extract is 100 parts.

[0046] Comparative Example 1

[0047] The difference between Comparative Example 1 and Example 1 is that Camellia extract and Illicium verum leaf extract were not added in Comparative Example 1, and the missing amounts were made up by using Porphyra yezoensis extract and Vetiver extract in a weight ratio of 0.3:0.2.

[0048] Comparative Example 2

[0049] The difference between Comparative Example 2 and Example 1 is that Comparative Example 2 does not add Porphyra yezoensis extract, but uses camellia extract, Illicium verum leaf extract and vetiver extract in a weight ratio of 0.7:0.7:0.2 to make up for the missing amount.

[0050] Comparative Example 3

[0051] The difference between Comparative Example 3 and Example 1 is that: in Comparative Example 3, vetiver extract was not added, and camellia extract, purple algae extract and false star anise leaf extract in a weight ratio of 0.7:0.3:0.7 were used to make up for the missing amount.

[0052] Comparative Example 4

[0053] The difference between Comparative Example 4 and Example 1 is that Comparative Example 4 uses camellia flower extract, purple algae extract, false star anise leaf extract and vetiver extract in a weight ratio of 0.7:0.3:0.07:0.2, and the total weight of the camellia flower extract, purple algae extract, false star anise leaf extract and vetiver extract is 100 parts.

[0054] Comparative Example 5

[0055] The difference between Comparative Example 5 and Example 1 is that Comparative Example 5 uses camellia flower extract, purple algae extract, false star anise leaf extract and vetiver extract in a weight ratio of 0.7:0.3:0.7:5, and the total weight of the camellia flower extract, purple algae extract, false star anise leaf extract and vetiver extract is 100 parts.

[0056] Comparative Example 6

[0057] The difference between Comparative Example 6 and Example 1 is that Comparative Example 6 uses camellia flower extract, purple algae extract, false star anise leaf extract and vetiver extract in a weight ratio of 7:0.3:0.7:0.2, and the total weight of the camellia flower extract, purple algae extract, false star anise leaf extract and vetiver extract is 100 parts.

[0058] Comparative Example 7

[0059] The difference between Comparative Example 7 and Example 1 is that Comparative Example 7 uses camellia extract, purple algae extract, false star anise leaf extract and vetiver extract in a weight ratio of 0.7:0.3:7:0.2, and the total weight of the camellia extract, purple algae extract, false star anise leaf extract and vetiver extract is 100 parts.

[0060] Test Example 1: Inhibitory effect of the composition on neural sensory pathways

[0061] This experiment established a histamine-induced neurogenic inflammation model of keratinocytes to accurately simulate the skin stress state of "redness, heat, itching, and pain." Under histamine stimulation, the gene expression of the heat-sensing channel TRPV1 receptor and the itch-sensing channel PAR-2 ​​(F2RL1 receptor) in HaCaT cells was significantly upregulated, directly triggering neuropeptide release and vasodilation signals. Therefore, the strength of the composition's inhibitory effect on the neurosensory pathway can indicate the strength of the composition's stress-relieving ability.

[0062] Samples: Stress-relieving compositions prepared in Examples 1-5 and Comparative Examples 1-7;

[0063] Experimental cells: The cell line used was human keratinocyte HaCaT (Shanghai Yaji Biotechnology Co., Ltd.), which was cryopreserved to the 9th generation;

[0064] Experimental conditions: incubator temperature 37±1℃, humidity 90±5%, carbon dioxide 5±1%;

[0065] Cells were cultured and treated according to their groups, followed by testing. The testing methods are as follows:

[0066] (1) Sample preparation: The sample was completely dissolved in DMSO and then diluted with DMEM culture medium to form a sample solution, wherein the mass percentage of the sample in the sample solution was 1 wt%.

[0067] (2) The cell suspension was seeded into a 96-well cell culture plate at a density of 2000 cells / well, and 100 μL of culture medium was added to each well. The cells were cultured for 24 h.

[0068] (3) Induction and sample feeding: Discard the supernatant. Add 100 μL of DMEM medium (2105341, Gibco) containing 20 μM histamine solution to the control group. Add 100 μL of medium containing 20 μM histamine solution and 1 wt% sample solution to the sample group. Incubate for 24 h.

[0069] (4) The expression levels of TRPV1 channel receptor and F2RL1 PAR-2 ​​channel receptor genes in HaCaT cells of each group were detected by real-time quantitative PCR. Total RNA was extracted from HaCaT cells of each group using the TRIzol method. cDNA was synthesized by reverse transcription using the TaKaRa reverse transcription kit (total reaction volume: 20 μL). Real-time RT-PCR was performed on a CFX96 microarray. TM The PCR was performed on a real-time system (Bio-Rad, USA); the PCR conditions were as follows: 95°C pre-denaturation for 30 seconds, followed by 40 cycles, each cycle consisting of 95°C denaturation for 5 seconds, 60°C annealing for 30 seconds, and 72°C extension for 45 seconds; GAPDH was used as an internal control gene, and the relative expression level of each gene was calculated using 2...-ΔΔCT The method was used for calculation, and the primer sequences are shown in Table 1:

[0070] Table 1 Primer sequences

[0071] Gene Primer sequence (5'→3') TRPV1-F CTGGACCTGGTCAACCTCAT TRPV1-R GATGGGGATCTTGGTGTCAG F2RL1-F CCGTGACCGTGACTTTGTCT F2RL1-R GCGGATGATGGTGTTGTAGG GAPDH-F GAGTCAACGGATTTGGTCGT GAPDH-R TTGATTTTGGAGGGATCTCG

[0072] Calculate the gene repression rate using the following formula:

[0073] Gene suppression rate = |(target gene expression level) 对照组 - Target gene expression level 样品组 )| / Target gene expression level 对照组 ×100%;

[0074] in,

[0075] target gene expression level 对照组 This represents the target gene expression level in the control group.

[0076] target gene expression level 样品组 The target gene expression level in the sample group;

[0077] Test Example 2: Inhibitory effect of the composition on neurogenic inflammation

[0078] The experiment utilized capsaicin to specifically activate the TRPV1 channel in keratinocytes, directly triggering a neurogenic inflammatory cascade and inducing the massive release of key inflammatory factors such as TNF-α and IL-1α. This process precisely simulates the core mechanism of skin burning and redness: TNF-α amplifies vascular permeability leading to erythema, while IL-1α stimulates pain neurons to induce stinging. The strength of the composition's inhibitory effect on the inflammatory factors TNF-α and IL-1α indicates the composition's stress-relieving effect.

[0079] Samples: Stress-relieving compositions prepared in Examples 1-5 and Comparative Examples 1-7;

[0080] Experimental cells: The cell line used was human keratinocyte HaCaT (Shanghai Yaji Biotechnology Co., Ltd.), which was cryopreserved to the 9th generation;

[0081] Experimental conditions: incubator temperature 37±1℃, humidity 90±5%, carbon dioxide 5±1%;

[0082] Cells were cultured and treated according to their groups, followed by testing. The testing methods are as follows:

[0083] (1) Sample preparation: The sample was completely dissolved in DMSO and then diluted with DMEM culture medium to form a sample solution, wherein the mass percentage of the sample in the sample solution was 1 wt%.

[0084] (2) The cell suspension was seeded into a 96-well cell culture plate at a density of 2000 cells / well, and 100 μL of culture medium was added to each well. The cells were cultured for 24 h.

[0085] (3) Induction and sample feeding: Discard the supernatant. Add 100 μL of DMEM medium (2105341, Gibco) containing 4.6 μg / mL capsaicin solution to the control group. Add 100 μL of medium containing 4.6 μg / mL capsaicin solution and 1 wt% sample solution to the sample group. Incubate for 24 h.

[0086] (4) Detection of inflammatory factors: Cells were lysed according to the instructions of the TNF-α ELISA kit (ml061140, Shanghai ELISA kit) and the IL-1α ELISA kit (ml061140, Shanghai ELISA kit), and the supernatant was collected. The absorbance at 450 nm was measured by ELISA to detect the concentrations (pg / mL) of TNF-α and IL-1α.

[0087] Calculate the TNF-α inhibition rate and IL-1α inhibition rate using the following method:

[0088] Inflammatory factor inhibition rate = |(Inflammatory factor content) 对照组 -Inflammatory factor content 样品组 )| / Inflammatory factor content 对照组 ×100%;

[0089] in,

[0090] Inflammatory factor levels 对照组 The inflammatory factor levels represent the control group.

[0091] Inflammatory factor levels 样品组 The levels of inflammatory factors in the sample group;

[0092] Table 2 Data on receptor inhibition rate and inflammatory factor inhibition rate of neurosensory pathways

[0093]

[0094] As shown in Table 2, the gene inhibition rate and inflammatory factor inhibition rate of Examples 1-5 and Comparative Examples 1-3 are significantly improved in Examples 1-5, which use a combination of four components: camellia extract, purple algae extract, false star anise leaf extract, and vetiver extract. This indicates that the four components have a synergistic effect, which enhances the stress-relieving ability of the composition.

[0095] Based on the data from Example 1 and Comparative Examples 4-7, it can be seen that when the weight ratio of Camellia extract, Porphyra yezoensis extract, Illicium verum leaf extract and Vetiver extract is (0.5-1):(0.05-0.5):(0.6-0.8):(0.1-0.3), the composition exhibits the best inhibition rates of TRPV1, F2RL1, TNF-α, and IL-1α, thus resulting in a better stress-relieving effect.

[0096] Application Example 1-5 and Comparative Application Example 1-7

[0097] The compositions of Examples 1-5 and Comparative Examples 1-7 were added to the serum at a concentration of 3 wt% to obtain the serums of Application Examples 1-5 and Comparative Application Examples 1-7. The formulations are shown in Table 3.

[0098] The preparation methods of the serums used in Application Examples 1-5 and Comparative Application Examples 1-7 include the following steps:

[0099] The preparation method of the serum includes the following steps:

[0100] S1. Mix the humectant, thickener and 1 / 2 volume of deionized water, and homogenize at 80°C to obtain an aqueous solution.

[0101] S2. When the temperature of the aqueous solution in S1 drops to 60°C, add the preservative. When the system temperature drops to 40°C, further add the components, fragrance and remaining deionized water from the compositions of each example and comparative example to the system, stir evenly, and finally add a pH adjuster to adjust the pH to 6 to obtain the essence.

[0102] Table 3. Serum formulations for Application Examples 1-5 and Comparative Application Examples 1-7.

[0103]

[0104]

[0105] Comparative Application Example 8

[0106] The difference between Comparative Application Example 8 and Application Example 1 is that the essence in Comparative Application Example 8 does not contain the composition, but uses an equal amount of deionized water instead of the composition, and the preparation method is the same as that in Application Example 1.

[0107] Test Example 3: Short-term and long-term stress-relieving effects on the human body

[0108] This test case verifies the effect of the serums used in Examples 1-5 and the comparative examples 1-8 on improving facial barrier damage;

[0109] Samples: Essences prepared using Application Examples 1-5 and Comparative Application Examples 1-8;

[0110] Experimental Methods: Subjects were enrolled according to the safety testing methods specified in the "Cosmetic Safety Technical Specifications". Seventy-eight Asian adults aged 18-60 with sensitive skin were randomly divided into 13 groups of 6 participants each. On the day of the trial, participants washed their faces with water without applying any product. They sat quietly for 20 minutes in an air-conditioned room with a temperature of 21±1℃ and humidity of 50±10% before the facial zygomatic bone Tewameter was used for testing. TM Hex probe, The CM 825 and MX 18 probes were used to measure transcutaneous water loss (TEWL), water content, and erythema index (a* value) of the zygomatic bone as initial values, and Visia-CR was used to photograph the subject's facial condition.

[0111] Immediate testing: All subjects used a soap-based cleanser (Shiseido Perfect Whip) to wash their faces 6 times, each time for about 1 minute. After waiting 10 minutes, the TEWL (transparent skin hydration) and moisture content of the cheekbones were measured and recorded as values ​​after modeling. Subsequently, 1g of serum was applied to the entire face, and after waiting 10 minutes, the TEWL and moisture content of the cheekbones were measured as indicators after immediate use. The experiment found that washing the face 6 times did not cause facial redness, so the erythema index (a* value) was not measured in the immediate test.

[0112] Long-term test: Subjects used the sample twice a day, morning and evening. After 14 days, they were followed up and the TEWL of the cheekbone, moisture content, and erythema index (a* value) were measured as indicators for 14 days. Visia-CR was used to photograph the subjects' facial condition.

[0113] The experiment established a skin barrier damage model by washing the face 6 times. The higher the TEWL value during the immediate test, the more severe the skin barrier damage.

[0114] Calculate the immediate improvement rate and long-term improvement rate using the following formula:

[0115] Immediate Improvement Rate (%) = |(X) 使用后 -X 造模后 ) / (X 造模后 -X 初始值 )|×100%

[0116] 14-day improvement rate (%) = |(X) 使用后 -X 初始值 ) / X 初始值 |×100%

[0117] In the formula:

[0118] X 初始值 Data on various indicators tested before subjects used the product;

[0119] X造模后 Data on various indicators after six facial cleansing sessions during the subjects' immediate testing;

[0120] X 使用后 Data on various indicators tested after subjects used the product;

[0121] The calculated data are shown in Table 4 below;

[0122] Table 4. Application Examples and Comparative Application Examples: Test Data for Serums

[0123]

[0124] As shown in Table 4, the data from Application Examples 1-5 and Comparative Application Examples 1-3 indicate that the TEWL value improvement rate of Application Examples 1-5, which use a combination of four components—Camellia extract, Porphyra yezoensis extract, Illicium verum leaf extract, and Vetiver extract—significantly decreased, the moisture improvement rate significantly increased, and the erythema improvement rate was greater than 16%. This suggests that the four components—Camellia extract, Porphyra yezoensis extract, Illicium verum leaf extract, and Vetiver extract—work synergistically, and the stress-relieving ability of the combination is enhanced.

[0125] Based on the data from Application Example 1 and Comparative Application Examples 4-7, it can be seen that when the weight ratio of Camellia extract, Porphyra yezoensis extract, Illicium verum leaf extract and Vetiver extract is (0.5-1):(0.05-0.5):(0.6-0.8):(0.1-0.3), the composition exhibits the best improvement rates in TEWL value, moisture content, and erythema, thus resulting in a better stress-relieving effect.

[0126] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A stress-relieving composition comprising a Camellia extract, characterized in that, Camellia extract, Porphyridium extract, Illicium lanceolatum leaf extract and Ophiopogon extract, the weight ratio of the Camellia extract, Porphyridium extract, Illicium lanceolatum leaf extract and Ophiopogon extract being (0.5-3):(0.05-2):(0.5-1):(0.05-0.5); wherein the Camellia sinensis extract is from the company Clariant - Personal Care under the name RedSnow ® ; the Porphyridium sp. extract is from the company BSF under the name SILIDINE ® ; the Schinus molle extract is from the company Lucas Meyer under the name Tazman Pepper™ AF; the Eupatorium odoratum extract is from the company Givaudan under the name Vetivyne TM .

2. The stress-relieving composition containing the extract of Camellia japonica according to claim 1, wherein The weight ratio of the Camellia extract, Porphyridium extract, Illicium lanceolatum leaf extract and Ophiopogon extract being (0.5-1):(0.05-0.5):(0.6-0.8):(0.1-0.3).

3. Use of the stress-relieving composition containing Camellia extract as claimed in claim 1 or 2 in the preparation of a skin care product.

4. Use of the stress-relieving composition containing the camellia flower extract according to claim 3 in the preparation of a skin care product, characterized in that, The skin care product is any one of a lotion, emulsion, cream, mask, serum or spray, and the composition is added in an amount of 0.5%-5% by weight of the total weight of the skin care product.

5. An essence characterized by, The raw materials include the following weight percentages: 0.5%-5% of the composition as claimed in claim 1 or 2, 0.05%-0.3% of a thickening agent, 0.5%-10% of a humectant, 0.5%-5% of a preservative and 0.01%-0.3% of a pH adjuster, and the balance being deionized water.

6. The serum of claim 5, wherein the serum is a serum for skin care. The raw materials are selected from at least one of (a)-(d): (a) the thickening agent includes at least one of xanthan gum, carbomer, hydroxyethyl acrylate / acryloyl dimethyl taurate sodium copolymer, acryloyl dimethyl ammonium taurate / VP copolymer, sordarium gum and cetyl alcohol; (b) the humectant includes at least one of allantoin, betaine, beta-glucan, trehalose, glycol, dipropylene glycol, sodium hyaluronate, 1,3-butanediol, glycerol, pullulan and ceramide; (c) the pH adjuster includes at least one of arginine, tromethamine and disodium EDTA; (d) the preservative includes at least one of 1,2-propanediol, 1,2-hexanediol and p-hydroxyacetophenone.

7. The method of claim 6, wherein the serum is prepared by the steps of: The steps include: S1, mixing the humectant, thickening agent and part of the deionized water, homogenizing and uniformly mixing to obtain an aqueous phase solution; S2, after the temperature of the aqueous phase solution in S1 is reduced to 55-65℃, adding the preservative, and when the temperature of the system is reduced to 40-45℃, further adding the components of the composition as claimed in claim 1 or 2, essence and the remaining deionized water in the system, stirring uniformly, and finally adding the pH adjuster to adjust the pH to obtain the serum.

8. The production method according to claim 7, wherein The homogenization temperature in step S1 is 75-85℃.

9. The production method according to claim 7, wherein The pH in step S2 is adjusted to 5.5-6.5.

Images