Preparation method of silicon-coated gold nanorod coated with protein halo and PCR (polymerase chain reaction) amplification method and kit based on silicon-coated gold nanorod coated with protein halo

Abstract

The invention discloses a preparation method of a protein halo-coated silicon-coated gold nanorod and a PCR amplification method and kit based on the protein halo-coated silicon-coated gold nanorod, and belongs to the technical field of PCR detection. The photo-thermal nano material is composed of an AuNR coated SiO2 core-shell structure and an external protein halo layer, the protein halo layer avoids inhibition of AuNR on a PCR reaction system, meanwhile, adsorption of AuNR on biological small molecules is effectively reduced, non-specific amplification is reduced, and normal amplification of PCR reaction is guaranteed; and the protein halo layer is used as a thermal insulation layer to optimize heat exchange and maintain the temperature uniformity of the reaction liquid. When the kit is applied to a photo-thermal PCR detection reagent, DNA of a pathogen to be detected can be efficiently and stably amplified and detected within 10 minutes, the kit has huge application potential in the fields of early screening of infectious diseases, food safety detection and the like, collaborative optimization of photo-thermal conversion efficiency, biocompatibility, detection sensitivity and operation convenience is achieved, and the kit has a wide application prospect. And an efficient solution is provided for prevention and control of infectious diseases, food safety monitoring and biomedical research.

Description

Technical Field

[0001] The present invention belongs to the technical field of PCR detection, and relates to a preparation method of silica-coated gold nanorods coated with a protein corona layer, a PCR amplification method based thereon, and a kit. Background Art

[0002] Nucleic acid amplification detection technology is an important means in molecular biology research and clinical diagnosis. As the gold standard technology for nucleic acid amplification detection, polymerase chain reaction (PCR) has high sensitivity and specificity. It can achieve highly sensitive detection of pathogens, genetic disease markers, etc. by amplifying specific nucleic acid sequences. Among them, polymerase chain reaction (PCR), as the gold standard technology for nucleic acid amplification detection, plays an irreplaceable role in fields such as disease diagnosis, gene expression analysis, and forensic identification by virtue of its high sensitivity and specificity. Although the PCR technology has significant advantages, traditional PCR instruments still have many limitations in practical applications: traditional PCR instruments usually use a thermal block or hot air circulation method for temperature control, resulting in large thermal inertia and slow heating and cooling rates, which not only prolongs the time of the PCR amplification cycle, reduces the detection efficiency, but also may increase the risk of non-specific amplification and affect the accuracy of the detection results; in addition, traditional PCR instruments are usually large in size, not convenient to carry and operate on-site, and are particularly inconvenient in scenarios such as rapid response and on-site detection, restricting the wide application of the PCR technology.

[0003] To overcome the limitations of traditional PCR technology, in recent years, the application of photothermal nanomaterials in nucleic acid amplification detection has received extensive attention. Photothermal nanomaterials have excellent photothermal conversion properties, capable of rapidly absorbing light energy and converting it into heat energy, thereby achieving rapid heating and cooling control of the PCR reaction system. Gold nanorods (AuNRs) exhibit unique photothermal conversion characteristics due to their anisotropic structure. Gold nanorods can efficiently absorb light energy of a specific wavelength and convert it into heat energy, significantly enhancing the heating and cooling rates of the PCR reaction system and shortening the PCR cycle time. However, there are still some problems with bare gold nanorods in practical applications. Due to their positive charge, bare gold nanorods are prone to adsorbing biomolecules, especially target DNA, which may not only interfere with the specificity of the PCR reaction but also reduce the amplification efficiency. Additionally, bare gold nanorods are prone to aggregation, and this aggregation phenomenon will directly inhibit the PCR reaction, resulting in amplification failure. To solve these problems, some studies have further modified gold nanorods with silica coating. However, there are still certain drawbacks with the silica-coated gold nanorods. First, their surface may carry a large number of hydroxyl groups (-OH) or other reactive groups (such as silyl groups), and these groups are prone to adsorbing key components in the PCR system (such as DNA polymerase, primers, dNTPs, etc.) through electrostatic or hydrophobic interactions, leading to a decrease in the effective concentration of these key components, thereby affecting the progress of the PCR reaction. Second, DNA polymerases such as Taq enzyme are prone to adsorbing on the surface of nanomaterials, resulting in conformational changes or the masking of active sites, thus reducing the catalytic efficiency and affecting the specificity and efficiency of PCR amplification. Finally, the nanoparticles may interfere with the binding of primers to templates or hinder the extension of DNA polymerase on the template strand through steric hindrance, further affecting the effect of PCR amplification and limiting its application in complex biological samples. Summary of the Invention

[0004] Aiming at the deficiencies of silica-coated gold nanorods in PCR amplification, the present invention aims to provide a preparation method of silica-coated gold nanorods coated with a protein corona layer, a PCR amplification method based on the same, and a kit. By coating the protein corona layer, the adsorption of key components of PCR by surface active groups is reduced, the inactivation of DNA polymerase is avoided, the interference of steric hindrance on primer binding and enzyme extension is reduced, and the specificity and efficiency of PCR amplification are improved.

[0005] To achieve the above object, the present invention is implemented by adopting the following technical solutions: The present invention provides a silica-coated gold nanorod coated with a protein corona layer, characterized in that the silica-coated gold nanorod coated with a protein corona layer is composed of an AuNR@SiO2 core-shell structure and a protein corona layer coated outside the AuNR@SiO2 core-shell structure, and the absorption wavelength of the silica-coated gold nanorod coated with a protein corona layer is 750 - 860 nm.

[0006] The protein corona layer is composed of any one of bovine serum albumin (BSA), human transferrin (TF), and lysozyme (LYS).

[0007] The present invention provides a method for preparing silica-coated gold nanorods coated with the above protein corona layer, which is obtained by mixing an AuNR@SiO2 solution with a protein solution and incubating them.

[0008] The incubation temperature is 30~40 °C, and the incubation time is 15~40 min.

[0009] Furthermore, the incubation temperature is 37 °C, and the incubation time is 30 min The volume ratio of the AuNR@SiO2 solution to the protein solution is 1~2:1, wherein the absorbance of the AuNR@SiO2 solution is 1~2 OD.

[0010] Furthermore, the concentration of the protein solution is 1.5 μM.

[0011] The present invention provides the application of the silica-coated gold nanorods coated with the above protein corona layer in the preparation of photothermal PCR detection products.

[0012] The present invention provides a photothermal PCR detection kit, which includes the silica-coated gold nanorods coated with the above protein corona layer.

[0013] Furthermore, the PCR detection kit further includes a PCR amplification solution.

[0014] Furthermore, the PCR amplification solution includes DEPC water, SYBR Ⅰ fluorescent dye with a working concentration of 0.5~1×, DNA polymerase with a final concentration of 0.2 U / μL, dNTP Mixture with a final concentration of 200 μM, 10×FastBuffer Ⅰ with a final concentration of 1×, target template strand solution with a final concentration of 5×10 -4 ng / mL, 0.5 μM forward primer and 0.5 μM reverse primer.

[0015] The present invention provides a photothermal PCR detection method, which adds the silica-coated gold nanorods coated with the above protein corona layer and the pathogen DNA to be detected into the PCR amplification solution, controls the denaturation temperature and the renaturation / extension temperature by laser irradiation of the PCR amplification solution and combining with infrared temperature measurement to complete PCR amplification, and performs fluorescence quantitative detection to obtain the detection result of the pathogen DNA.

[0016] The PCR amplification solution includes DNA polymerase, dNTPs, reaction buffer, fluorescent dye, pathogen DNA template strand solution to be detected, and primers for amplifying the pathogen DNA template strand.

[0017] The volume ratio of the protein corona-coated silica-coated gold nanorod solution, the pathogen DNA solution to be detected and the PCR amplification solution is 4:1:20, and the time for laser irradiation of the PCR amplification solution is 8 to 20 min.

[0018] Compared with the prior art, the present invention has the following beneficial effects: The silica-coated gold nanorod with a protein corona provided by the present invention is composed of an AuNR@SiO2 core-shell structure and a protein corona layer coated on the outside of the core-shell structure. By forming a protein corona coating layer on the surface of the silica-coated gold nanorod, the silica-coated gold nanorod effectively reduces the cytotoxicity and immune response of the gold nanorod, can reduce the direct contact between the gold nanorod and the biological environment, thereby reducing its potential harm to cells; the protein corona layer can mask the immunogenic sites of the surface charge of the gold nanorod, reduce the recognition and attack of the immune system, and improve its stability and safety in the organism; the presence of the protein corona layer does not affect the light absorption performance of the silica-coated gold nanorod. By optimizing its surface structure or dielectric environment, the photothermal conversion efficiency is further improved. The protein corona layer can selectively adsorb PCR inhibitors, reduce non-specific amplification, and reduce the generation of dimers caused by non-specific adsorption during the annealing process, so as to balance the thermal effect and enzyme activity protection and improve the detection specificity; the protein corona layer can optimize the heat exchange between the gold nanorod and the surrounding environment as a "heat insulation layer", reduce heat dissipation, maintain the temperature uniformity of the reaction solution, reduce the adsorption of proteins or lipids on the surface of AuNRs in complex biological samples (such as blood, tissue lysate), ensure the stability of PCR amplification, effectively solve the problems of poor biocompatibility and insufficient stability of the silica-coated gold nanorod, and improve the photothermal conversion efficiency and detection sensitivity.

[0019] The preparation method of the silica-coated gold nanorod with a protein corona provided by the present invention is to mix and incubate the silica-coated gold nanorod (AuNR@SiO2) with a protein solution. The protein adsorbs on the surface of the nanoparticle through electrostatic interaction, hydrophobic interaction or hydrogen bond to form a dense protein corona layer. The protein corona layer can effectively shield the non-specific binding sites (such as silanol groups) on the surface of the nanoparticle, reduce the non-specific adsorption with biomolecules (such as DNA, enzyme), reduce the background noise, and improve the specificity of biological detection. The preparation method is simple, highly operable, and conducive to mass production.

[0020] The application of silica-coated gold nanorods coated with a protein corona layer in the preparation of photothermal PCR detection reagents. Since the silica-coated gold nanorods coated with a protein corona layer have rapid, efficient, and specific detection capabilities, the reagents provided by the present invention can be used for the early screening of infectious diseases, such as the rapid detection of pathogens such as monkeypox virus, and can also be used in the field of food safety detection to detect pathogens or harmful substances in food, ensuring food safety. It can be used as an efficient tool for multiple fields such as gene expression analysis and gene mutation detection.

[0021] The photothermal PCR detection kit provided by the present invention. The silica-coated gold nanorods coated with a protein corona layer in the kit achieve the coordinated optimization of photothermal conversion efficiency, biocompatibility, detection sensitivity, and operation convenience. It not only significantly improves the PCR amplification performance but also expands the application scenarios, providing an efficient, accurate, and low-cost solution for infectious disease prevention and control, food safety monitoring, and biomedical research.

[0022] The PCR amplification detection method provided by the present invention. Under the irradiation of a 750-860 nm laser, the silica-coated gold nanorods coated with a protein corona layer can quickly absorb light energy and convert it into heat energy, realizing the rapid heating and cooling of the PCR reaction system, significantly shortening the PCR cycle time, and improving the amplification efficiency. Through laser irradiation combined with infrared temperature measurement technology, the precise control of the PCR reaction temperature can be achieved, which helps to maintain the activity of the enzyme and the effective binding of the primer and the template, improving the stability and specificity of the amplification; the combination of fluorescence quantitative detection and the high efficiency of photothermal PCR amplification can achieve the accurate detection of low-concentration pathogen DNA; the whole detection process is simple to operate and easy to automate and integrate. Description of the Drawings

[0023] Figure 1 It is a characterization diagram of the silica-coated gold nanorods coated with a protein corona layer of the present invention. Among them, (a) is a TEM image, (b) is an ultraviolet spectrum diagram, (c) is a Zeta potential diagram, and (d) is a fluorescence correlation spectrum characterization of the gold rod protein corona; Figure 2 It is the PCR nucleic acid amplification result based on the silica-coated gold nanorods coated with a protein corona layer of the present invention. Among them, (a) is a qPCR amplification result diagram of the silica-coated gold nanorods coated with different concentrations of BSA protein corona layer, (b) is an ultrafast photothermal PCR amplification thermal cycle diagram, (c) is a physical picture of ultrafast photothermal PCR amplification of monkeypox virus, and (d) is the fluorescence intensity result; Figure 3 It is the PCR nucleic acid amplification result based on the silica-coated gold nanorods coated with a protein corona layer of the present invention. Among them, (a) is a qPCR amplification result diagram of the silica-coated gold nanorods coated with different concentrations of TF protein corona layer, and (b) is the fluorescence intensity result of ultrafast photothermal PCR amplification of monkeypox virus; Figure 4This is the PCR nucleic acid amplification result of silica-coated gold nanorods with a protein corona layer. Among them, (a) is the qPCR amplification result diagram of silica-coated gold nanorods with protein corona layers of different concentrations of lysozyme (LYS), and (b) is the fluorescence intensity result of ultrafast photothermal PCR amplification of monkeypox virus. Detailed implementation manners

[0024] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0025] The present invention will be further described in detail below with reference to the accompanying drawings: I. Preparation of silica-coated gold nanorods with a protein corona layer 1. Material preparation A plastic foam box is placed in an ice bath; a 50 mL conical centrifuge tube contains 20 mL of ultrapure water and is placed in a refrigerator at -20 °C. After 15 min (rapid cooling), it is placed in an ice bath; Prepare 100 mM NaBH4 and dilute it to a 10 mM NaBH4 solution (9 mL of water can be prepared in advance in an ice bath) and place it for 30 min; A water bath (set at 50 - 60 °C) is used to heat the crystals of cetyltrimethylammonium bromide (CTAB) solution to melt it into an aqueous solution state. 2. Preparation of AuNR seed solution Measure 9.75 mL of CTAB with a molar concentration of 0.1 M and 0.25 mL of HAuCl4 solution with a molar concentration of 10 mM. Stir and mix the two solutions for 5 minutes to obtain a mixed solution; measure 0.6 mL of ice-cold NaBH4 solution with a molar concentration of 10 mM and quickly add it to the mixed solution. Stir vigorously at room temperature for 10 minutes. When the color of the reaction solution quickly changes from yellow to brown, it indicates that the AuNR seed solution (the seed solution is placed at room temperature) has been formed, and let it stand for 10 minutes. Note: It needs to be protected from light and stored at 4 °C.

[0026] 3. Preparation of growth solution At room temperature, 1 mL of an aqueous solution of HAuCl4 with a molar concentration of 0.01 M, 20 mL of a CTAB solution with a molar concentration of 0.1 M, 0.2 mL of an AgNO3 solution with a molar concentration of 0.01 M, and 0.16 mL of an L-ascorbic acid solution with a molar concentration of 0.1 M were added in sequence, and mixed well to obtain a growth solution; 100 μL of HCl with a molar concentration of 0.1 M was added to the growth solution.

[0027] 4. Preparation of AuNR solution Take 48 μL of AuNR seed solution and 21.46 mL of growth solution, mix well and react for 8 - 12 h to obtain AuNR solution; Centrifuge the AuNR solution at 12000 rpm for 20 minutes, resuspend with 10 - 15 mL of deionized water and store at 4 °C for later use. 5. Preparation of AuNR@PEG solution Measure 400 μL of AuNR solution, add 20 μL (100 mM) SH-PEG-COOH to obtain a mixed solution; freeze the mixed solution at -80 °C for 15 min and then thaw it; wash with 0.01M phosphate buffer solution (PS, containing 0.1M NaCl, pH = 7.4), and centrifuge at 12400g at 4 °C for 20 min; centrifuge and concentrate to resuspend, centrifuge at 8000 rpm at 25 °C for 5 min; dissolve the centrifuged precipitate in 1.66 mL of water to obtain an AuNR@PEG solution with a concentration of 18 - 20 OD.

[0028] 6. Preparation of AuNR@PEG@SiO2 1.43 mL of ammonia - isopropanol solution (the volume percentage of ammonia in isopropanol solution is 3.84%) was slowly added dropwise to 0.4 mL of TEOS - isopropanol (the volume percentage of TEOS in isopropanol solution is 0.97 vol.%) in 4 portions under the condition of an ultrasonic power of 360 W, with an interval of 5 - 10 min each time (100 μL of TEOS - isopropanol was added dropwise each time per batch). After complete addition of the solution, react for two hours to obtain a reaction solution, and the water bath temperature of the ultrasonic instrument is 30 °C.

[0029] Centrifuge the reaction solution three times (8000 rpm for 10 min, 25 °C) until the supernatant is colorless, then resuspend the precipitate in methanol and measure UV - vis to obtain AuNR@PEG@SiO2.

[0030] 7. Preparation of silica - coated gold nanorods with a protein corona layer (1) Silica - coated gold nanorods coated with BSA Prepare an aqueous solution of 1 mg / mL BSA, mix it with the aqueous solution of AuNR@PEG@SiO2 in a volume ratio of 1:1. After ultrasonic treatment, incubate it in a water bath at 37 °C for 30 min to obtain the gold nanorod protein corona AuNR@SiO2@BSA.

[0031] (2)Silica-coated gold nanorods coated with TF Prepare an aqueous solution of 1.1 mg / mL TF, mix it with the aqueous solution of AuNR@PEG@SiO2 in a volume ratio of 1:1. After ultrasonic treatment, incubate it in a water bath at 37 °C for 30 min to obtain the gold nanorod protein corona AuNR@SiO2@TF.

[0032] (3)Silica-coated gold nanorods coated with LYS Prepare an aqueous solution of 0.2432 mg / mL LYS, mix it with the aqueous solution of AuNR@PEG@SiO2 in a volume ratio of 1:1. After ultrasonic treatment, incubate it in a water bath at 37 °C for 30 min to obtain the gold nanorod protein corona AuNR@SiO2@LYS.

[0033] See the appendix Figure 1 [[ID=ID=15]]For the relevant performance detection of the AuNR@SiO2@BSA of the present invention, (a) is the cryo-electron microscopy image of AuNR@SiO2, and it can be observed that there is an obvious silicon layer on the outer layer of the gold nanorods, and the thickness of the silicon layer is about 9 nm; among them, from the (b) ultraviolet spectrum and the (c) potential results of DLS, it shows that the bare gold nanorod solution prepared from the seed solution is positively charged with CTAB, and Au-S bonds are formed under low-temperature freezing conditions. Because SH-PEG-COOH is selected, the outermost layer is negatively charged, and the carboxylic acid group may form hydrogen bonds with the silanol (Si-OH) group, thus helping the adsorption and condensation of silicic acid on its surface. In addition, the steric hindrance effect of the PEG chain prevents the agglomeration of SiO2 particles, ensuring the uniformity and compactness of the coating layer. The (d) fluorescence correlation spectroscopy results show that the particle size of BSA is about 7 nm, the particle size of the gold nanorod protein corona is 18 nm, and the particle size of the silica-coated gold nanorod calculated by the equivalent volume is 9 nm, which is consistent with the particle size of 9 nm calculated by the equivalent volume of the silica-coated gold nanorod in the actual TEM, indicating that a photothermal nanomaterial with a gold nanorod protein corona structure is formed.

[0034] II. Ultra-fast PCR amplification of silica-coated gold nanorods based on the coated protein corona layer 1. Prepare the PCR amplification solution based on the silica-coated gold nanorods with a coated protein corona layer The PCR amplification solution includes DEPC water, 0.5 - 1×SYBR Ⅰ fluorescent dye, 0.2 U / μL DNA polymerase, 0.8 μL of 200 μM dNTP Mixture, 1× of 10×Fast buffer Ⅰ, and 0.5 μL of a target template strand solution with a final concentration of 5×10 -4 ng / mL, 0.5 μM forward primer and 0.5 μM reverse primer. Finally, a photothermal nanomaterial of AuNR@SiO2@BSA is added, and the total reaction volume is 10 μL.

[0035] Among them, the target template strand solution is the F3L gene in monkeypox virus ( Monkeypox Virus ): MonkeypoxVirus - F3L, Gene ID: MT250197.1, and the gene sequence is as follows: TCAGAATCTAATGATGACATAACTAAGAAGTTTATCTACAGCCAATTTAGCTGCATTATTTTTAGCATCTCGTTTAGATTTTCCATCTGCCTTATCGAATACTCTTCCGTCAATGTCTACACAGGCATAAAATGTAGGAGAGTTACTAGGCCCCACTGATTCAATACGAAAAGACCAATCTCTCCTAGTTATTTGACAGTACTCATTAATAACGGTGACAGGGTTAACACCTTTCCAATAAATAATTTTTTTAACCGGAATAACATCATCAAAAGACTTATGATCCTCTCTCATTGATTTTTCGCGGGATACATCATCTATTATAGCATCAGCATCAGAATCTGTAGGCCGTGTATCAGCATCCATTGTCGTAGACCAACGAGGAGGAGTATCGTTGGAGCTGTAAACCATAGCACTACGTTGAAGATCATACAGAGCTTTATTAACTTCTCGCTTCTCCAT(SEQ ID NO. 1).

[0036] The primer sequences used are shown in Table 1.

[0037] Table 1: PCR amplification primers for Mopx DNA

[0038] 2. Ultrafast photothermal PCR amplification reaction of silica - coated gold nanorods with a protein corona layer During the process of irradiating the PCR reaction solution with a power - adjustable laser, a coupled infrared temperature measuring instrument (temperature control module model HXKC - TC0102.01.02, with the function of program - segment temperature control, temperature control accuracy: 0.1 level, input linear voltage: 0 to 5V, output control signal: 0 to 5V, ≤50 PPm / ℃ (0.1 - 0.15 level), control method: HXKC - fuzzy - pid temperature control algorithm, with self - adaptive adjustment function) combines the proportional - integral - derivative control algorithm and pulse - width modulation technology to achieve the thermal cycle of denaturation temperature and annealing / extension temperature; where the denaturation temperature is 90 ± 1 ℃, the annealing / extension temperature is 60 ± 1 ℃, the temperature accuracy is within 1 ℃, 40 PCR thermal cycle amplifications can be completed within 550 s, and an enzyme - linked immunosorbent assay (ELISA) reader is used to detect the amplification result and compare the result with that of Bio - Rad qPCR.

[0039] See the appendix Figures 2-4 , the PCR nucleic acid amplification result of the silica - coated gold nanorods with a protein corona layer based on the present invention.

[0040] See the appendix Figure 2 , construct (a) an ultrafast PCR amplification system based on silica - coated gold nanorods with different BSA concentrations, and the BSA protein concentrations are 1.515, 15.15, 75.75, and 151.5 μM. Set the qPCR temperature control as: pre - denaturation temperature 95℃, 60 s; denaturation temperature 95 ℃, 10 s; annealing / extension temperature 58 ℃, 20 s; complete 40 thermal cycle processes according to this setting. From the Ct results of qPCR, the optimal pre - coated BSA concentration is 1.515 μM. The total time required for the ultrafast photothermal PCR thermal cycle based on this PCR reaction system is 514 s as shown in figure (b). Through the comparison of the physical pictures (c) before and after the PCR reaction under 365 nm ultraviolet light irradiation, green fluorescence can be observed. Finally, the fluorescence intensity of SYBR I is detected by an ELISA reader (set the fixed gain as 133), and the results are as follows: (d) the fluorescence intensity of the positive control (added with the monkeypox virus standard) is about 3 times higher than that of the negative control group. In the reaction system with 1.5 μM BSA added under ultrafast PCR amplification, its fluorescence result has no significant difference from that of qPCR.

[0041] See the appendix Figure 3, an ultrafast PCR amplification system based on silica-coated gold nanorods coated with TF was constructed, and the TF protein concentrations were 0.275, 0.55, 1.375, and 2.75 μM. The qPCR temperature control was set as follows: pre-denaturation temperature 95 °C, 60 s; denaturation temperature 95 °C, 10 s; annealing / extension temperature 58 °C, 20 s; 40 thermal cycles were completed according to this setting. From the Ct results of qPCR, it was shown that the optimal concentration of pre-coated TF was 1.375 μM; in the reaction system with 1.375 μM TF added, there was no significant difference in the fluorescence results between ultrafast PCR amplification and qPCR.

[0042] See the appendix Figure 4 , an ultrafast PCR amplification system based on silica-coated gold nanorods coated with LYS was constructed, and the LYS protein concentrations were 0.869, 1.738, 4.345, and 8.69 μM. The qPCR temperature control was set as follows: pre-denaturation temperature 95 °C, 60 s; denaturation temperature 95 °C, 10 s; annealing / extension temperature 58 °C, 20 s; 40 thermal cycles were completed according to this setting. From the Ct results of qPCR, it was shown that the optimal concentration of pre-coated LYS was 1.738 μM, and at this concentration, the PCR amplification efficiency was the highest; in the reaction system with 1.738 μM LYS added, there was no significant difference in the fluorescence results between ultrafast PCR amplification and qPCR.

[0043] The above content is only to illustrate the technical idea of the present invention and cannot be used to limit the protection scope of the present invention. Any changes made on the basis of the technical solution according to the technical idea proposed by the present invention shall fall within the protection scope of the claims of the present invention.

Claims

1. A silica-coated gold nanorod coated with a protein corona, characterized in that, The silica-coated gold nanorods with a protein corona layer are composed of an AuNR@SiO2 core-shell structure and a protein corona layer coated on the outside of the AuNR@SiO2 core-shell structure, and the absorption wavelength of the silica-coated gold nanorods with a protein corona layer is 750-860 nm.

2. The silica-coated gold nanorod coated with a protein corona layer according to claim 1, wherein, The protein corona layer is composed of any one of bovine serum albumin, human transferrin, and lysozyme.

3. The preparation method of the silica-coated gold nanorods with a protein corona layer according to any one of claims 1 to 2, characterized in that, It is obtained by mixing the AuNR@SiO2 solution and the protein solution and incubating.

4. The preparation method of the silica-coated gold nanorods with a protein corona layer according to claim 3, wherein The incubation temperature is 30-40 °C, and the incubation time is 15-40 min.

5. The preparation method of the silica-coated gold nanorods with a protein corona layer according to claim 3, wherein the volume ratio of the AuNR@SiO2 solution to the protein solution is 1-2:1, where The absorbance of the AuNR@SiO2 solution is 1-2 OD.

6. Use of the silica-coated gold nanorods with a protein corona layer according to any one of claims 1-2 in the preparation of a photothermal PCR detection reagent.

7. A photothermal PCR detection kit, characterized in that, The photothermal PCR detection kit includes the silica-coated gold nanorods with a protein corona layer according to any one of claims 1-2.

8. A photothermal PCR detection method, characterized in that, The silica-coated gold nanorods with a protein corona layer according to any one of claims 1-2 and the DNA of the pathogen to be detected are added to the PCR amplification solution, and the PCR reaction solution is irradiated with a laser, and the denaturation temperature and the annealing / extension temperature are controlled by combining infrared temperature measurement to complete PCR amplification, and fluorescence quantitative detection is carried out to obtain the detection result of the pathogen DNA.

9. The method for photothermal PCR detection according to claim 8, wherein The PCR amplification solution includes DNA polymerase, dNTPs, reaction buffer, SYBR I fluorescent dye, the DNA template strand solution of the pathogen to be detected, and primers for amplifying the DNA template strand of the pathogen to be detected.

10. A photothermal PCR detection method according to claim 8, characterized in that, The volume ratio of the solution of the silica-coated gold nanorods with a protein corona layer, the solution of the DNA of the pathogen to be detected, and the PCR amplification solution is 4:1:20, and the time for irradiating the PCR amplification solution with the laser is 8-20 min.

Images