Transient expression method of sandalwood callus and application thereof

Abstract

The invention discloses a sandalwood callus transient expression method and application thereof. The method comprises the following steps: by taking sandalwood embryogenic callus as a transformation receptor, instantaneously introducing a target gene with a GFP tag into the embryogenic callus by adopting an agrobacterium-mediated method, and screening a positive material by utilizing fluorescence microscopic observation, so that the transient expression of the target gene in the callus can be quickly detected; further collecting samples, performing gene expression or GC-MS (gas chromatography-mass spectrometry) analysis on metabolites, and identifying gene / enzyme functions.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a method for transient expression of Santalum album callus and its application. Background Art

[0002] Santalum album is a semi-parasitic evergreen small tree of Santalum in Santalaceae, known as sandalwood. The essential oil extracted from the heartwood is of extremely high value, known as "liquid gold". It can be used to prepare perfumes and spices, and has antibacterial, anti-tumor, anti-inflammatory and other effects. The price in the international market exceeds 5,000 US dollars per kilogram. Driven by the market demand and considerable economic value, the wild resources of Santalum album have been severely cut down and the resources are in shortage. There is no native distribution of Santalum album in China. In 1962, our garden successfully introduced Santalum album seeds from Indonesia for the first time; in the 1980s, "Laoshanxiang", that is, high-quality germplasm resources of Santalum album, were introduced from India and also achieved success. The main components of Santalum album essential oil are santalols, including α-santalol ((Z)-α-santalol) and β-santalol ((Z)-β-santalol), accounting for more than 80% of the total essential oil. With the development of biotechnology, the biosynthesis of Santalum album essential oil has attracted great attention from scientific researchers.

[0003] Terpenoids are one of the families with the largest number and the most diverse structures in natural products, and have antibacterial, anti-tumor and other activities. For example, the antimalarial drug artemisinin and the anticancer drug paclitaxel. Therefore, plant terpenoids have broad application prospects in the fields of medicine and fragrance industry. The upstream pathways of terpenoid biosynthesis mainly include the mevalonate pathway and the 2-methyl-D-erythritol 4-phosphate pathway. Terpenoid synthase (TPS) is the key enzyme in the downstream synthesis pathway. Therefore, the molecular regulation mechanism of plant terpenoid biosynthesis has always been the forefront and hot spot in the field of plant secondary metabolism research at home and abroad.

[0004] Transient expression is an important technique for rapidly studying gene expression and gene interaction. It can complete the expression and function analysis of target genes within several days, and has the advantages of simplicity, rapidity and high efficiency. It is a commonly used method in current functional genomics research. Transient expression methods include particle bombardment, protoplast transformation and Agrobacterium-mediated method. Among them, the Agrobacterium-mediated transient expression method has been widely used in the research of plant functional genes due to its simple operation, high transformation efficiency and low cost.

[0005] Under natural growth conditions, the growth of sandalwood is slow and the cycle is long, which greatly limits its genetic transformation operation, and the research progress of the functions of sandalwood-related genes is slow. At present, there is no report on the research of the transient expression system of Santalum plants. Therefore, the development of an efficient genetic transformation system is of great significance for the research of sandalwood functional genes. Summary of the Invention

[0006] In order to develop an efficient genetic transformation system for sandalwood genes, the object of the present invention is to provide a method for transient expression of sandalwood callus, using sandalwood embryogenic callus as the transformation receptor, and transiently introducing the target gene with GFP tag into the embryogenic callus by Agrobacterium-mediated method, and screening positive materials by fluorescence microscopy observation, which can quickly detect the transient expression of the target gene in the callus; further collect samples and perform gene expression or metabolite GC-MS analysis to identify the functions of genes / enzymes.

[0007] The first object of the present invention is to provide a transcription factor SaMYC2 that regulates the sesquiterpene synthase gene (SaSSY), and its nucleotide sequence is shown in SEQ ID NO.1.

[0008] The second object of the present invention is to provide a sandalwood terpene synthase gene SaTPS11, and its nucleotide sequence is shown in SEQ ID NO.2.

[0009] The third object of the present invention is to provide a sandalwood terpene synthase gene SaTPS21, and its nucleotide sequence is shown in SEQ ID NO.3.

[0010] The fourth object of the present invention is to provide the application of the transcription factor SaMYC2 in catalyzing and promoting the production of products α-santalene, α-bergamotene, epi-β-santalene and / or β-santalene.

[0011] The fifth object of the present invention is to provide the application of the sandalwood terpene synthase gene SaTPS11 in catalyzing and promoting the production of cis-nerolidol ((Z)-nerolidol) and / or trans-nerolidol ((E)-nerolidol).

[0012] The sixth object of the present invention is to provide the application of the sandalwood terpene synthase gene SaTPS21 in catalyzing and promoting the production of cis-nerolidol ((Z)-nerolidol).

[0013] The present invention also provides a method for transient expression of sandalwood callus, which is to insert the target gene into an expression vector, then transform it into Agrobacterium, and infect the embryogenic callus of sandalwood through Agrobacterium-mediated method, and then obtain positive materials through screening.

[0014] Preferably, the expression vector is pGreen 35S-GFP(C17).

[0015] Preferably, the target gene is the transcription factor SaMYC2 that regulates the santalene synthase gene (SaSSY), or the sandalwood terpene synthase gene SaTPS11 or SaTPS21.

[0016] Preferably, the method for preparing the embryonic callus of sandalwood is:

[0017] The sandalwood stem segments are used as explants and inoculated on an embryonic callus induction medium for culture. The induction medium is: MS basic medium supplemented with 1-2 mg / L 2,4-D and 0.2-0.5 mg / L TDZ;

[0018] The embryonic callus is further cultured on a subculture medium to obtain a sandalwood embryonic callus; the embryonic callus is then subcultured to obtain a vigorous embryonic callus, which is used as a transformation recipient, wherein the subculture medium is MS basic medium supplemented with 0.2-0.5 mg / L 2,4-D and 0.1-0.2 mg / L TDZ;

[0019] The embryonic callus is placed in an Agrobacterium infection solution containing the target gene for infection, and the embryonic callus is transferred to a co-culture medium for dark culture to obtain a transient transformation material. The co-culture medium includes: MS minimal medium, 20-30 g / L sucrose, 1.5-2 g / L phytagel, 0.2-0.5 mg / L 2,4-D, 0.1-0.2 mg / L TDZ, and 40-100 mg / L acetosyringone.

[0020] The transient transformation material after dark culture was washed with sterile water, and then inoculated into MS basic medium, 20-30 g / L sucrose, 1.5-2 g / L phytagel, 0.2-0.5 mg / L 2,4-D, 0.1-0.2 mg / L TDZ, 50-200 mg / L timentin, and 0.05-0.1 mg / L BASTA, and cultured normally, and then positive materials were obtained through screening.

[0021] The screening is PCR screening, which obtains positive materials transformed with the target gene by amplifying the sequence in the target gene.

[0022] The present invention can be used to quickly analyze the regulatory effects of transcription factors on target genes or identify the functions of terpene synthase genes. The operation is simple and convenient, providing a technical means for screening target genes regulated by transcription factors and in-depth research on the functions of sandalwood genes. Alternatively, the present invention can provide technical support for more rapid identification of the functions of plant terpene synthase genes without the need for Escherichia coli protein expression and in vitro enzyme activity analysis. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1The expression of the SaSSY gene is regulated by transcription factors. A-B, GFP fluorescence signals in calli. A, wild-type calli; B, fluorescence signals in calli overexpressing transcription factors; C, expression levels of the SaSSY gene after transient expression of transcription factors; D, GC-MS detection of metabolites after transient expression of transcription factors. Peak 1, α-santalene; 2, α-bergamotene; 3, epi-β-santalene; 4, β-santalene. OE-TF represents positive Santalum album materials transformed with the target gene, and Empty vector represents Santalum album materials transformed with the empty vector.

[0024] Figure 2 It is the transient expression of terpene synthase genes. A-C, GFP fluorescence signals in calli. A, wild-type calli; B, fluorescence signals in calli overexpressing SaTPS11; C, fluorescence signals in calli overexpressing SaTPS21; D, GC-MS detection of metabolites after transient expression of SaTPS11 and SaTPS21. Peak 1, cis-nerolidol; 2, trans-nerolidol; E, nerolidol isomer standard. OE-SaTPS11 and OE-SaTPS12 respectively represent positive Santalum album materials transformed with the target genes SaTPS11 and SaTPS21, and Empty vector represents Santalum album materials transformed with the empty vector. Specific implementation manners

[0025] The following examples further illustrate the present invention rather than limiting it.

[0026] Example 1:

[0027] A method for transient expression of Santalum album calli and its application, comprising the following steps:

[0028] 1. Insert the target gene into the EcoRⅠ and XbaⅠ restriction enzyme sites of pGreen 35S-GFP(C17) (for the preparation method of the vector, see the literature: Hou XL, Zhou JN, Liu C, Liu L, Shen LS, Yu H (2014) Nuclear factor Y-mediated H3K27me3 demethylation of the SOC1 locus orchestrates flowering responses of Arabidopsis. Nat Commun 5:4601. https: / / doi.org / 10.1038 / ncomm s5601), and thus obtain the overexpression vector pGreen 35S-target gene; then transform the overexpression vector pGreen 35S-target gene and pGreen 35S-GFP(C17) (empty vector) into the Agrobacterium tumefaciens strain GV3101 respectively, inoculate them on the LB medium (containing 10 g of Tryptone, 5 g of Yeast extract, 10 g of NaCl, 15 g of agar powder per liter, autoclaved at 121 °C for 20 min) containing 50 μg / ml kanamycin (kan), and culture them in an inverted position at 28 °C for 2 - 3 d to screen for positive clones, obtaining the Agrobacterium tumefaciens monoclonal carrying the target gene and the Agrobacterium tumefaciens monoclonal transfected with the empty vector; transfer the monoclonal to 100 ml of LB liquid medium and shake until the OD 600 value is 0.6 - 0.8, centrifuge at 1000 g for 5 min, discard the supernatant, suspend the cells with the infection solution, and place them in the dark at 28 °C for 2 - 3 h. The infection solution: 10 g / L MES + 40 mg / L acetosyringone + 0.05% Silwet L-77.

[0029] The target genes are SaMYC2 (its nucleotide sequence is shown in SEQ ID NO.1), the sandalwood terpene synthase gene SaTPS11 (its nucleotide sequence is shown in SEQ ID NO.2), and SaTPS21 (its nucleotide sequence is shown in SEQ ID NO.3). The target genes include GFP-tagged proteins.

[0030] 2. Using the sandalwood stem segment as the explant, inoculate it on the embryogenic callus induction medium and culture for 2 - 3 weeks. The induction medium is the MS basal medium supplemented with 2 mg / L 2,4 - D and 0.5 mg / L TDZ. Continue to culture the embryogenic callus on the subculture medium to obtain sandalwood embryogenic callus; then subculture the embryogenic callus for 2 weeks to obtain vigorously growing embryogenic callus as the transformation receptor. The subculture medium is the MS basal medium supplemented with 0.5 mg / L 2,4 - D and 0.2 mg / L TDZ. The light conditions for induction culture and subculture are a light intensity of 80 - 120 μmol / m 2 s -1 , and a light duration of 14 h / d.

[0031] 3. Directly place the embryogenic callus into the infection solutions containing Agrobacterium tumefaciens GV3101 with the target gene and Agrobacterium tumefaciens GV3101 with an empty vector respectively for infection for 10 - 15 min, gently shake it every 5 min, transfer it to the filter paper to fully absorb the excess bacterial liquid, and transfer the embryogenic callus to the co - culture medium for dark culture for 2 - 3 d to obtain transient transformation materials. The co - culture medium: MS basal medium, 30 g / L sucrose, 1.5 g / L phytagel, 0.5 mg / L 2,4 - D, 0.2 mg / L TDZ, 100 mg / L acetosyringone.

[0032] 4. Wash the callus after dark culture twice with sterile water, and then inoculate it on the medium of MS basal medium, 30 g / L sucrose, 1.5 g / L phytagel, 0.5 mg / L 2,4 - D, 0.2 mg / L TDZ, 50 mg / L ticarcillin, 0.05 mg / L BASTA for normal culture for 5 - 7 d, with a light intensity of 80 - 120 μmol / m 2 s -1 , and a light duration of 14 h / d; observe and screen the transformation results with a fluorescence microscope.

[0033] 5. Take 200 mg of the sample, extract RNA, and use One - Step gDNA Removal and cDNA Synthesis SuperMix (Beijing, TransGen Biotech) kit to reverse transcribe it into cDNA, and perform quantitative analysis of gene expression with qRT - PCR primers (Table 1).

[0034] 6. Take 1 g of the sample and place it in a 10 mL headspace vial, put in the SPME adsorption rod, adsorb at a constant temperature of 30 °C for 20 min, detect by GC - MS, analyze the metabolites, and identify the function of the target gene.

[0035] 7. In the present invention, the target gene is a transcription factor (SaMYC2, whose nucleotide sequence is shown in SEQ ID NO.1) that regulates the santalene synthase gene (SaSSY). Through transient expression in embryogenic callus, transient transformation materials were obtained and co-cultured. Fluorescence microscopy observation showed that there was a strong GFP fluorescence signal in the samples after transient overexpression of the transcription factor ( Figure 1 A - B), indicating that the transcription factor was successfully overexpressed in embryogenic callus with a transformation efficiency of 100%. Gene expression analysis showed that the expression level of the SaSSY gene increased by about 4 - fold ( Figure 1 C). The GC-MS detection results showed that after transient overexpression of the transcription factor, the relative contents of the products α-santalene, α-bergamotene, epi-β-santalene, and β-santalene catalyzed by the SaSSY enzyme increased by about 4 - 5 times ( Figure 1 D).

[0036] 8. In the present invention, the target genes are two santalene synthase genes, SaTPS11 (whose nucleotide sequence is shown in SEQ ID NO.2) and SaTPS21 (whose nucleotide sequence is shown in SEQ ID NO.3). Through transient expression in embryogenic callus, transient transformation materials were obtained and co-cultured. Fluorescence microscopy observation showed that there was a strong GFP fluorescence signal in the overexpression samples ( Figure 2 A - C), indicating that these enzyme genes were successfully expressed in embryogenic callus with a transformation efficiency of 100%. The GC-MS detection results showed that the SaTPS11 enzyme catalyzed the formation of two products, cis-nerolidol and trans-nerolidol, and the SaTPS21 enzyme catalyzed the formation of only one product, (Z)-nerolidol ( Figure 2 D).

[0037] Using this technology can quickly analyze the regulatory effect of transcription factors on target genes or identify the functions of terpene synthase genes. The operation is simple, providing a technical means for screening transcription factors to regulate target genes and further studying the functions of sandalwood genes; or it can provide technical support for more quickly identifying the functions of plant terpene synthase genes without the need for expressing proteins in Escherichia coli and in vitro enzyme activity analysis.

[0038] Table 1 Primer sequences used in the present invention

[0039]

[0040] >SaMYC2 (SEQ ID NO.1)

[0041] ATGGCAGATTTCCGGCTACCGGCGATGAATCTGTGGACGGACGATAACGCCACGATGATGGATGCTTTCATGAGCTCCGA

[0042] TCTCTCTTCCATCGGATGGACTCCTCAATCATCCGCCGCATCCGCCGTTTCCAACTCCAGCGCAGCCCCACCCGCGCTGG

[0043] ACCCGTTCCGCACCGCCGCCGGCAGTCAATCGCAGCCACCGATTGTGTTGTTCAACCAGGAGACCCTTCAGCAGCGCCTC

[0044] CAAACCCTAATCGAGGAAGCGAAGGAGAGCTGGACCTACGCCATCTTCTGGCAGCCCTCCTCCGCGGACCCGTCCGGTGC

[0045] GGCGGCGCTCTTAGGGTGGGGCGACGGCTACTACAAGGGGGAGCAGAAGCAGCGGAGGACGACGACTCCATCCTCGGCGG

[0046] CGGAGCAGCAGCACCGGAAAAGGGTCCTCCGCGAGCTCAATTCCCTCATTTCCGGCGGCTCCGCCTCCATCGATGACGCC

[0047] GTCGACGAGGAGGTCACCGATACGGAGTGGTTCTTCCTTGTCTCGATGACGCAGTCTTTCGCCAACGGCACGGGGCTACC

[0048] GGGTCAGGCGTTCTTGAGGTCGAACCCGGTCTGGGTCACCGGCGCCGACCAACTCGCCGGTTCGGGGTGCGAACGGGCGA

[0049] GGCAGGGCCAGGTTTTCGGGTTGCGGACGATCGTGTGCGTTCCGCTGGCTAACGGGGTGGTGGAGTTGGGGTCGACGGAG

[0050] TTGATCTTCCAGACCCCGGATCTGATGAACAAGATTAGGGTTTTGTTCGATTTCAATAGCATGGAGATTGGGTCTTGGGG

[0051] AATCAATGGCGATCAGGGCGAGAACGACCCCTCCGCTCCGTGGATCGCCGACCACCCTTCATCTTCGTCCCTGGAAATTA

[0052] GGGATTCTGTGAACACAGCAACGAGTAATCACAACTTCAACCCTAGTAGTAGCAACCAGCACATTCCCAAGCCGATCCAG

[0053] TTCGAAAATCCGAGTTCAGATAGCTTAAATGATCAAAACCCTAGTGTTTTACATGTGAATTCTCATCCCTACCAGCATAA

[0054] CCAGCGCCGGCAAATCTCGCCGGCGGTGGGGGAAGCGGCGCCTTCGTCGCAGCCGACGCCGGGTTTTTTGACTCGGGATC

[0055] TGAATTTTGCGGAATTGGGGTACGAGGAGAGCCACCGTGTGAAGAACGGGTGCAAGGCGGAGGCCGGTGAGATACTGAAT

[0056] TTTGCGGAAAGTAAGAGGAGTCCGTGTAGTGGAACTAGGAGTTTATTTTCGACTCATTCTGAATTCGTGAGCGAGAAGAA

[0057] TAATAGGAAGCGAAGGTCGCCGCCGGAGGCGTCGAGAGGGAGCAACAACGAGGAGGGGATGCTCTCGTTCACTTCAGGGG

[0058] TGGTTCCGCCGTCCTCCGGTACTGCGAGGTCCACCGGCGGCGGTGATTCCGATCAATCTGATCTCGAGGCATCCGTGATT

[0059] CGAGAATCGGAGACCAGCAGAGTCGTAGATCCTGAAAAACGGCCTCGAAAACGGGGACGAAAACCCGCAAACGGAAGGGA

[0060] AGAGCCATTGAATCACGTTGAAGCGGAGCGGCAGCGGCGAGAGAAGCTCAATCAGAGATTCTACGCCCTCCGCGCCGAAG

[0061] TCCCAAACGTTTCAAAAATGGACAAGGCTTCCCTCCTCGGGGACGCCATTGCTTACATAAAAGAGCTCAAATCCAAGCTT

[0062] CAATCCGCTGAATCCGAGAATGAGGACTTGCAGAAGCAAGTGGACGGGTTGAATAAGGAGACGGCCCGAACCCCCTCACC

[0063] CGATCACGACCCCAAAATGTCGAACCGCGGTGGAGGGAAATTGGTGGACATTGACATTGAAGTGAAGATTATTGCTTGGG

[0064] ACGCAATGATCCGAATCCAATGCAGGAAGAGGAATCATCCGGCCGCGCGGTTAATGGTGGCGTTGAAAGAGCTGGATTTG

[0065] GATGTTCATCACGCCAGCGTTTCAGTGGTTAATGACTTGATGATACAGCAAGCCACAGTGAAGATGGGGACTCGATTTTA

[0066] CACTCAGGAGCAGCTCCGGATGATTTTATCTTGTAAGCTATCAGAGCACCCATGA

[0067] >SaTPS11(SEQ ID NO.2)

[0068] ATGGACTTATTTAGTGATAATGCACACAAGTGCACCAATGATGAAGATGATCATGCCTTTGCTTTAACCCCATCCCCCAG

[0069] CAGCTTTACCGATGAGTATTCCCTGGAAAAGGCACGAAAAGTGAAGGAGGTAAAGGCACTGCTCAACGAGGTGGCTTACG

[0070] AAGAGCCATCAGAAGGGTTGGAAGTGGTTGATGCCATCTATCGCCTAGGCATCGATCACCTTTTTAGAGATGAGATTGAA

[0071] GCACTTCTAAGGAAGCAATACATGAATTTAAGCATCTTGAGCCAAGATCTTGGTAGTGATCTTCATGAGGTTGCAATTAG

[0072] TTTTCGACTATTGAGACAAGAAGGTTATTATGTTCCTGCAGATATTTTTAGCAAATTCATGGACAAGGAAGGGAATTTCA

[0073] ATCAAAAACTATGTCAAGATATGAGAGGATTAATGGAGCTATATGAAGCTTCACACCTAAGCATAGAAGGAGATGATGAT

[0074] ATACTTGATCAGGGCAGAGACTTCAGCAGCCAACTCCTGAAGGCCCACATGACACAAGTTGATCATCTTCAGGCTGAAGT

[0075] GATTCGCAACACTTTGGCACTTCCCCAACGCTCGAGCCTTCCCATGTTCTCCACCACAAGCTTCCTCACTAGCGATTTCC

[0076] GTGAAAAGAGTAGTACTAGGAGTAGGTGGATGAATCTCCTCTCCCAATTGGCCAAAACTGACTTGCATTTGATGCGATCC

[0077] ATACACCATAAGGAAATACGTCAAGTATCCAAATGGTGGAAAGACATGGGTTTGGCCAAGGAATTGAAGTTTGCAAGAGA

[0078] TCAGCCACTAAAATGGTACATGTGGTCCAAAGTGGCTCTCGTGGATCCAATTTTATCAGAGGAGAGGGTTGACCTCACCA

[0079] AGCCCACTTCACTCATCTACATTATAGATGACATTTATGATGTCATGGGAACTCTTGATGAACTCACTCTCTTCACTCAA

[0080] GCTGTCAACAGCTGGGAGTCCTCTGAGCAACTACCAGAGTACATGAAGAAATGCTTCGATGCTCTCAATCAAGTCACGAA

[0081] TGAAATCAGTCATAAGGTCACTGTCAAGCACGGGTGGAACCCGGTGGACTCTCTCCGAAAGACGTGGGCAGACTTGTGCA

[0082] ATGCTTTTCTGGTGGAAGCGAAATGGTTTTCTTCAGGGAGGTTACCAAATTCAGAGGAGTACTTGAAGAATGGGATAGTG

[0083] AGTTCAGGAGCACACGTTGTGTTAGTTCACATTTTCTTTCTCTTGGGTGAAAATATAACTGAGGAGACTGCAGATGTTGT

[0084] GGATTTGACTCCGAGCATCATTTCTTCCACAGCAACCATTCTTCGCCTTTGGGATGACTTGGGAAGTGCAAAAGATGAGA

[0085] ATCAGGATGGCCATGACGGATCCTTCATAGAATGTTACATGAGGGAGAAACCAAGTGTATCGGTTCAGACCGCAAGAGAA

[0086] CACGTCACTGAAATGATATCGGAGGCGTGGAAGCTCCTCAATCGGGAGTGCCTCTCACCACCATCTCCATTCGCTGCAAG

[0087] TTTCAGGAGGGCTTGTCTCAATCTTGCAAAGATGGTGCCCTTGATGTACAAGTATGATGAGAATCACTGTCTCCCTCTGG

[0088] TTGAGGAACACGTGAAGTCCTTGCTCATAAATGGAGATGTCTCTCCATAG

[0089] >SaTPS21(SEQ ID NO.3)

[0090] ATGGGGACGGCCGCAAAAGTTGCAACCATCTCTTCTCCGATGAATTCACCGGCGGCTCCCACCATTGCCACTCGTCTATG

[0091] GCGGATGACCTTCGTCCCCTCACAACAACACCGCTCATGCGCACCTATTTGCATGTCGTTGCCATTGCGGTTAAAGCCAC

[0092] TCGTAGAAAGCCATGACTCCGTCCTCACACCCCTTCCTCCTACTCACTCGGTCAATGGAAGCACCGTCAGGAGGGAACAA

[0093] CTGTATGAAAAGGCACTGTGTGAACTGAATGAAGCATCTGATGATCCTACGGCCGCCTTGATGACGATCGACACGATCCA

[0094] ACGGCTGGGGATCGGGTACCATTTCGAGGAAGACATCAGTGTCCTATTGCAACGGTTCTCGGAGGGGAGAGATGGTGACG

[0095] ATCTCTTCCTCACCTCGCTGCGTTTCCGGCTACTCAGGCAGCATGGCCGACAAGCCTCTCAAGATGTGTTTCATAAATTT

[0096] GTGGATAAGAATGGGCAATTCAAGGAAACCCTAAACAAAGACGTATGGGGCACATTGAGCTTGTACGAGGCCTCGAGCTT

[0097] AAGAGCAGAACACGAAGAGATACTGTCACAAGCCCTGCGTTTCTCAAAAGCGGCTCTCTCGCAATCAATGCCTTCTATGG

[0098] ACCAACAAGCTCGCCGATGCATCGCCGGAGCATTGGAGACTCCAAGACACTTGAGGACGCCGCGGTTAGAAGCGAGACAC

[0099] TACATCGATGAGTATGGCAAGGATAGCCGCCGTAATCCTACCCTTCTCGGCATGGCAAAGTTAGATTTCAACATGGTTCA

[0100] GTTACTCCATAGAAGTGAGTTGGCTGAGGTATCAAGGTGGTGGAAGGAGCTGGGTCTTGTTGAAAAGCTCAGCTTTGCAA

[0101] GAGATCGGCCCATGGAGTGCTACTTATGGACGGTTGGGATTTTTCCAGAACCGTATAACTCTCACTGCCGTATTGAGTTG

[0102] ACCAAAGTTATTGCTATTCTACTGGTCATTGATGACATCTTTGATTCTTATGGGTCCTTGGATGAACTTATCCTCTTCAA

[0103] TGATGCAATTAAAAGATGGGACCTTGGTGCAATGGAACAATTGCCAGAGTACATGAAGATATGTTACACAGCTTTGTATA

[0104] ACACAACTGGAAGTGTTGCCGACAAAGTCTTCCAAGAACATGGCTTGGGTATGGATATCACACAACACCTAAAACAAACG

[0105] TGGATGGACCTGTTTGAAGCTTTTCTAGCGGAAGCGAAATGGTTCAACAGTGGTTATGTGGCCACGATGGATGAATACCT

[0106] AGAAAATGGTGTGACCACCGGAGGAACATACATGGCCTTGGTACACACTTTCTTCCTCTTGGGGAAACTTGTGACTCAAG

[0107] AAACTGTGGCATTGTTGATGGATCCCTATCCCCAACTCTTCTCATGCTCCGGAAAAATCCTCCGACTTTGGGACGATTTA

[0108] GGAACCGCAAGGGAGGAGGAAGAAAGAGGAGACGTTGCTTCGAGCATGGAGTGTTACAGAAGGGAGAATGACATTTCATC

[0109] AGAGAGTGAGGGGAGGGAAGCTATAAGGAAGCTCATCAACACCGTATGGATACAACTCAATGCCCAACTCATTGCTCCAA

[0110] ATGGACTCCCCCTTTCCACCGTCAATGCTTCCTTGAACCTCTCAAGAACTTCACAACTCATTTATCAGCATGGGGATGACGAATAG。

Claims

1. The transcription factor SaMYC2 that regulates the santalene synthase gene, characterized in that, The nucleotide sequence is as shown in SEQ ID NO.

1.

2. The santalene synthase gene SaTPS11 is characterized in that, The nucleotide sequence is as shown in SEQ ID NO.

2.

3. The santalene synthase gene SaTPS21, characterized in that, The nucleotide sequence is as shown in SEQ ID NO.

3.

4. Use of the transcription factor SaMYC2 described in claim 1 in catalytically promoting the production of products α-santalene, α-bisabolene, epi-β-santalene and / or β-santalene.

5. Use of the santalene synthase gene SaTPS11 described in claim 2 in catalytically promoting the production of cis-nerolidol ((Z)-nerolidol) and / or trans-nerolidol ((E)-nerolidol).

6. Use of the santalene synthase gene SaTPS21 described in claim 3 in catalytically promoting the production of cis-nerolidol ((Z)-nerolidol).

7. A method for transient expression of sandalwood callus, characterized in that, It is to insert the target gene into an expression vector, then transform it into Agrobacterium, and infect the embryonic callus of sandalwood through Agrobacterium-mediated transformation, and then obtain positive materials through screening.

8. The method according to claim 7, wherein The expression vector described is pGreen 35S-GFP(C17).

9. The method according to claim 7, characterized in that, The target gene described is the transcription factor SaMYC2 described in claim 1, the santalene synthase gene SaTPS11 described in claim 2 or SaTPS21 described in claim 3.

10. The method according to claim 7, characterized in that The preparation method of the embryonic callus of sandalwood described is: Using the sandalwood stem segment as an explant, inoculating it on an embryonic callus induction medium for culture. The induction medium is: MS basal medium supplemented with 1-2 mg / L 2,4-D and 0.2-0.5 mg / L TDZ; Continuing to culture the embryonic callus on a subculture medium to obtain sandalwood embryonic callus; then subculturing the embryonic callus to obtain embryonic callus with strong vitality as the transformation receptor. The subculture medium is MS basal medium supplemented with 0.2-0.5 mg / L 2,4-D and 0.1-0.2 mg / L TDZ; Putting the embryonic callus into an Agrobacterium infection solution containing the target gene for infection, transferring the embryonic callus to a co-culture medium for dark culture to obtain transient transformation materials. The co-culture medium: MS basal medium, 20-30 g / L sucrose, 1.5-2 g / L phytagel, 0.2-0.5 mg / L 2,4-D, 0.1-0.2 mg / L TDZ, 40-100 mg / L acetosyringone; Washing the transient transformation materials after dark culture with sterile water, and then inoculating them on a medium of MS basal medium, 20-30 g / L sucrose, 1.5-2 g / L phytagel, 0.2-0.5 mg / L 2,4-D, 0.1-0.2 mg / L TDZ, 50-200 mg / L ticarcillin, 0.05-0.1 mg / L BASTA for normal culture, and then obtaining positive materials through screening.

Images