A bamboo stem elongation regulatory gene PeGPR10 and its application

Abstract

The present invention belongs to the technical field of plant molecular biology; in particular, the present invention relates to a bamboo stem elongation regulating gene PeGPR10 The present invention provides a bamboo stem elongation regulating gene PeGPR10 The nucleotide sequence (CDS coding sequence) is shown in SEQ ID No: 1. The present invention also provides uses of the aforementioned gene for negatively regulating internode length and plant height in rice. Specifically, compared to wild-type rice (Nipponbare), the transgenic rice exhibits reduced internode length and plant height.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant molecular biology; in particular, the present invention relates to a bamboo stem elongation regulating gene PeGPR10 and its applications. Background Art

[0002] Bamboo plants belong to the Poaceae family ( Gramineae ) Bambusoideae ( Bambusoideae Bamboo is a unique and important forest resource. The morphological development of bamboo culms is composed of shoot differentiation and culm height growth. Rapid bamboo growth is a key biological characteristic of bamboo plants, encompassing the process from shoot emergence, growth, branching and leafing, to the cessation of height growth. Bamboo culm height growth follows a "slow-fast-slow" pattern, with internode elongation driven by the continuous differentiation, division, elongation, and maturation of the internode meristem, ultimately achieving culm elongation.

[0003] The height growth of bamboo is regulated by the balance between different plant hormones, which affects the growth and development of bamboo shoots. Gibberellins, cytokinins and auxins are the main hormones that regulate stem cell division and elongation. Among them, the key genes for the biosynthesis, degradation and signal transduction of gibberellins also play an important regulatory role in the elongation of bamboo stems. In the early stage of bamboo height growth, the overall content of gibberellins is low; the content in the top internodes is high, and the content rises sharply in the middle growth period, with the highest content in the middle internodes; in the late growth period, the content in the top internodes is higher than that in the middle and lower parts. In addition, the exogenous application of GA3 will induce the elongation of the internodes of the bamboo seedlings, increase the plant height, and accumulate lignin. Overexpression of bamboo GA biosynthesis genes PeGA20ox1 Genes caused an increase in the number of internodes and plant height in transgenic rice; transgenic Arabidopsis also showed increased plant height, biomass, lignin and cellulose content. Brassinosteroids specifically regulate cell elongation by regulating gibberellin metabolism. Low concentrations of BR promote GA synthesis, while high concentrations of BR inhibit GA synthesis, thereby regulating cell division and elongation of the intercalary meristem and affecting plant height. PeGSK1It encodes GSK3 kinase, a negative regulator of cell elongation, and can interact with BZR1, a key regulator of brassinosteroid signal transduction. By participating in the biosynthesis and signal transduction pathways of BR, it regulates the elongation of internode cells, thereby affecting the elongation of the stem. In addition to plant hormones, the heterotrimeric G protein (G protein) signaling pathway, as a very conserved transmembrane signal transduction mechanism in eukaryotes, regulates signal pathways such as signal perception, signal transduction, hormone response and immune response, and plays an important role in the establishment of plant height morphology. The G protein complex is composed of three subunits: Gα, Gβ and Gγ. In rice, mutants of the G protein α subunit have shorter plant height, larger and darker green leaves, and are insensitive to exogenous GA. The G protein γ subunit has different functions depending on the C-terminal structure. Rice GS3 Overexpression of Group III genes encoding Gγ subunits negatively regulates rice internode length, possibly through cross-talk between hormone synthesis and signal transduction processes to regulate the elongation of stem internode cells.

[0004] To date, research on the functions of plant G protein signaling has primarily focused on a few species, including Arabidopsis, rice, and maize. Cross-talk between plant hormones and their coordination with environmental signals to control plant growth have also been scarce in woody plants. Bamboo stems elongate very rapidly, and further investigation into the molecular mechanisms by which the synthesis and signal transduction processes of multiple hormones in moso bamboo regulate rapid stem elongation is of great theoretical significance. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a bamboo stem elongation regulating gene that can change the plant height (such as rice stem height) PeGPR10 and its applications.

[0006] In order to solve the problems of the prior art, the present invention provides a bamboo stem elongation regulating gene PeGPR10 , whose nucleotide sequence (CDS coding sequence) is shown in SEQ ID No: 1.

[0007] As an improvement of the gene of the present invention: the nucleotide sequence also includes mutants, alleles or derivatives generated by adding, replacing, inserting or deleting one or more nucleotides in the nucleotide sequence shown in SEQ ID No: 1.

[0008] The present invention also provides the above-mentioned bamboo stem elongation regulating gene PeGPR10 The amino acid sequence of the encoded protein is shown in SEQ ID No. 2.

[0009] As an improvement of the protein of the present invention: the amino acid sequence also includes amino acid sequences or derivatives generated by adding, substituting, inserting or deleting one or more amino acids in the amino acid sequence shown in SEQ ID NO. 2 or homologous sequences of other species.

[0010] The present invention also provides a method containing the above-mentioned bamboo stem elongation regulating gene PeGPR10 The plasmid is: ProUbi::PeGPR10-GFP-Flag .

[0011] The present invention also provides a method for regulating the elongation of bamboo stems. PeGPR10 The overexpression vector (plant expression vector) is a vector for expressing a gene, wherein the multiple cloning site region is connected in sequence to the UBI promoter, PeGPR10 Gene, GFP and Flag genetic ProUbi::PeGPR10-GFP-Flag Plant expression vectors.

[0012] The present invention also provides uses of the above gene: regulating (reverse regulating) the internode length of rice and regulating (reverse regulating) the plant height of rice.

[0013] As an improvement in the use of the gene of the present invention: compared with wild-type rice Nipponbare, the transgenic rice has reduced internode length and plant height. Specifically, the plant height is reduced, and the lengths of the panicle, the first internode, the second internode, and the third internode are all reduced.

[0014] The present invention also provides a method for regulating (negatively regulating) the internode length of rice: PeGPR10 Transgenic rice plants are obtained by transforming the gene overexpression vector into rice (cultivating the transformed rice cells into plants), thereby regulating (negatively regulating) the internode length of the rice plant. Transformation can be carried out using conventional Agrobacterium-mediated methods or gene gun techniques.

[0015] The present invention also provides a method for cloning the bamboo stem elongation regulating gene. PeGPR10 The primer pair comprises an upstream primer and a downstream primer.

[0016] The present invention also provides a host cell, which contains the above plant overexpression vector, or has an exogenous gene such as a bamboo stem elongation regulating gene integrated into its genome. PeGPR10 The cell is an Escherichia coli cell, an Agrobacterium cell or a plant cell.

[0017] The bamboo G protein γ subunit of the present invention PeGPR10 Genes are important in regulating plant stem elongation.

[0018] The present invention has the following beneficial effects: the present invention provides for the first time a bamboo stem elongation regulating gene that regulates the internode length of rice (and thus regulates the plant height of rice) PeGPR10 The protein and its application. Through Agrobacterium-mediated transformation of rice mature embryo callus, PeGPR10 The gene overexpression vector was transformed into the japonica rice variety Nipponbare. Results showed that the stem internode length of the overexpressing strains was significantly altered compared to the wild-type strain, resulting in a significantly shorter stem. This result provides a theoretical basis for studying stem elongation and rapid growth in moso bamboo and also provides an important resource for improving rice plant architecture.

[0019] It should be noted that the currently known rice grain size regulatory genes GS3 , its cDNA is 88.09% identical to that of the present invention, but this locus is the main effect QTL controlling rice grain weight and grain length, which is different from the present invention PeGPR10 The purpose of genes is completely different. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The specific embodiments of the present invention are further described in detail below with reference to the accompanying drawings.

[0021] Figure 1 For the present invention PeGPR10 A diagram showing the structural domain division of proteins encoded by genes.

[0022] Figure 2 For the present invention PeGPR10 Bar graph showing gene expression pattern analysis in different parts of fast-growing internodes of Moso bamboo.

[0023] Figure 3 Constructed for the present invention PeGPR10 Overexpression vector---- -ProUbi::PeGPR10-GFP-Flag Graph information.

[0024] Figure 4 For the present invention PeGPR10 Positive identification diagram of overexpressing transgenic rice; N is the negative control, P is the positive control, and 1-9 are the transgenic plant numbers.

[0025] Figure 5 The overexpression of the present invention PeGPR10 Phenotypic analysis diagram of transgenic rice;

[0026] Figure 5 Middle: A is the phenotype of overexpression transgenic rice at the heading stage; B is the phenotype of overexpression transgenic rice PeGPR10 A is a bar graph of relative expression levels; C is a bar graph of plant height of overexpressing transgenic rice;

[0027] Bar=10cm; NPB represents the wild type variety Nipponbare (control), PeGPR10 -OE-1 is overexpressed PeGPR10 Transgenic rice line 1, PeGPR10 -OE-2 is overexpressed PeGPR10 Transgenic rice line 2.

[0028] Figure 6 For overexpression PeGPR10 Analysis of internode length of transgenic rice;

[0029] Figure 6 Middle: A is overexpression PeGPR10 Figure B shows the phenotype of transgenic rice internode length; Figure B shows the statistical analysis of transgenic rice internode length;

[0030] Bar = 10 cm; PL represents panicle length, I represents the first internode from top to bottom, II represents the second internode from top to bottom, III represents the third internode from top to bottom, and IV represents the fourth internode from top to bottom; NPB represents the wild-type variety Nipponbare (control), PeGPR10 -OE-1 is overexpressed PeGPR10 Transgenic rice line 1, PeGPR10 -OE-2 is overexpressed PeGPR10 Transgenic rice line 2. DETAILED DESCRIPTION

[0031] The following is a detailed description of a specific embodiment of the present invention. This embodiment is implemented based on the technical solution of the present invention, and provides a detailed implementation method and specific operation process. However, the protection scope of the present invention is not limited to the following embodiment.

[0032] The following methods of the present invention can all be performed by referring to the experimental methods in the conventional "Concise Molecular Biology Experiment Guide" in this industry.

[0033] Example 1: Bamboo PeGPR10 Cloning and expression pattern analysis of

[0034] 1.1 Bamboo G protein γ subunit PeGPR10 Cloning and protein domain analysis

[0035] (1) Gene sequence acquisition and bioinformatics analysis:

[0036] Based on the genome information of Phyllostachys edulis included in the plant genome database PLAZA, the keyword [G protein gamma subunit] was used to search and identify the annotated gene number of the target G protein gamma subunit gene ( PH02Gene39775 ). Download the predicted coding sequence (CDS) and corresponding protein sequence of the gene from the database.

[0037] The predicted PeGPR10 protein sequence was submitted to the InterPro protein domain and function classification database for online analysis. The analysis results showed that the protein contains a typical G protein γ subunit domain (G_gamma_2 domain), confirming its functional characteristics as a G protein γ subunit ( Figure 1 ).

[0038] (2) Primer design and synthesis:

[0039] According to the obtained PeGPR10 Full-length CDS sequence of the gene, design of specific amplification primers:

[0040] Forward primer ( PeGPR10 -cDNA-F): 5'- ATG GCGATGGCGGCGAAGCCC-3' (SEQ ID NO.3),

[0041] Reverse primer ( PeGPR10 -cDNA-R): 5'-TAAACACACGCAACACCGA-3' (SEQ ID NO.4);

[0042] The primers include the start codon ATG (underlined) and the stop codon TGA. The primers can be synthesized by Zhejiang Shangya Biotechnology Co., Ltd. and purified by PAGE.

[0043] (3) Preparation of cDNA template:

[0044] Moso bamboo seedlings were collected, quickly frozen in liquid nitrogen, and stored at -80°C. Total RNA was extracted using the Zhongdao Life Science ZDSM-RE100 RNA Extraction Kit. RNA quality was verified by 1% agarose gel electrophoresis and a NanoDrop ND-1000 spectrophotometer (A260 / A280 ≈ 1.8-2.0, A260 / A230 > 1.8, and clear 28S / 18S bands). First-strand cDNA synthesis was performed using the PrimeScript™ II 1st Strand cDNA Synthesis Kit (Baori Medical Biotechnology). The RNA sample size was 2 μg, and the sample volume was no larger than 8 μL. The following steps were used:

[0045] Prepare the following reaction mixture in a PCR tube, as shown in Table 1:

[0046] Table 1. RNA denaturation and reverse transcription reaction mixture

[0047]

[0048] After the above reaction mixture is mixed, anneal and denature at 65°C for 5 min, and then cool on ice.

[0049] Prepare the reverse transcription reaction solution in the above reaction solution (10 μL). The system is shown in Table 2 below:

[0050] Table 2. Reverse transcription reaction solution

[0051]

[0052] Continue reverse transcription in a PCR instrument using the following program (Table 3);

[0053] Table 3. Reaction procedure

[0054]

[0055] The obtained bamboo cDNA was stored in a -20℃ refrigerator for future use.

[0056] (4) PCR amplification and product verification

[0057] Using the bamboo gene cDNA prepared in step (3) as a template, primers PeGPR10 -cDNA-F and PeGPR 10-cDNA-R was amplified by PCR using 2×Phanta Max Master Mix (Dye Plus) high-fidelity DNA polymerase from Novozymes. PeGPR10 The complete coding sequence (CDS) of the gene was amplified.

[0058] The PCR reaction system is shown in Table 4 below:

[0059] Table 4. PCR reaction system

[0060]

[0061] After mixing the reaction mixture, set the following program (Table 5) in the PCR instrument to perform the amplification reaction:

[0062] Table 5. PCR amplification program

[0063]

[0064] The PCR product was observed by agarose gel electrophoresis to see whether the target gene band was amplified, and was recovered and purified using a DNA gel recovery kit.

[0065] The full-length CDS sequence of 573 bp was amplified, as shown in SEQ ID NO. 1, and its corresponding amino acid sequence is shown in SEQ ID NO. 2.

[0066] 1.2 PeGPR10 Analysis of expression patterns in fast-growing bamboo stems

[0067] (1) Sample collection and processing:

[0068] Take bamboo shoots in their rapid growth phase (approximately 2 meters tall), cut a 10-cm-long internode, and immediately divide the internode into three equal sections: top (up), middle (mid), and base (basal). The collected samples are quickly frozen in liquid nitrogen and stored in a -80°C ultra-low temperature freezer until needed.

[0069] (2) RNA extraction and cDNA synthesis:

[0070] Total RNA was extracted from frozen samples from each of the three sections using an RNA extraction kit (Zhongdao Life Science, ZDSM-RE100). The integrity, concentration, and purity of the extracted RNA were confirmed by agarose gel electrophoresis and spectrophotometry (NanoDrop). Genomic DNA (gDNA) removal and first-strand cDNA synthesis were performed on equal amounts (1 µg) of total RNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa) strictly following the manufacturer's instructions. The synthesized cDNA was diluted 5-10 times and used as a qPCR plate and stored at -20°C.

[0071] (3) Real-time fluorescence quantitative PCR (qPCR):

[0072] Target gene primers: used for detection PeGPR10 The primer sequences for gene expression are: forward primer ( PeGPR10 -RT-F): 5'-CGAACCATTCATAACGATTTCA-3' (SEQ ID NO.5), reverse primer ( PeGPR10 -RT-R):5'-AGATCCACGAGAGGTAGCTCAA-3' (SEQ ID NO. 6).

[0073] Internal reference gene primers: used to detect internal reference genes NTB The expression primer sequences were as follows: forward primer (NTB-RT-F): 5'-TCTTGTTTGACACCGAAGAGGA-3' (SEQ ID NO. 7), reverse primer (NTB-RT-R): 5'-AATAGCTGTCCCTGGAGGAGTTT-3' (SEQ ID NO. 8).

[0074] qPCR reaction system (20 µl): 2 × Q3 SYBR qPCR Master Mix (Universal) (TOLOBIO, #22204) 10 µl, forward primer (10 uM): 0.4 µl (final concentration 0.2 µM), reverse primer (10 µM): 0.4 µl (final concentration 0.2 µM), cDNA template 1 µl (corresponding to approximately 5–10 ng of total RNA before reverse transcription), and sterile nuclease-free water to make up to 20 µl.

[0075] qPCR amplification program (two-step method): initial denaturation: 95°C, 3 min; cycling stage (40 cycles): denaturation at 95°C, 15 s; annealing / extension / fluorescence acquisition: 60°C, 60 s.

[0076] Experimental setup: Each sample (top, middle, and base) was set up with at least three biological replicates, and each biological replicate was set up with three technical replicates. No template was also set up to exclude contamination.

[0077] (4) Data analysis:

[0078] The cycle threshold value (Ct value) of each reaction well was obtained using the qPCR instrument supporting software; the target gene ( PeGPR10 ) and internal reference genes ( NTB ) in each biological replicate; Calculate the ΔCt value: For each biological replicate, ΔCt = Ct( PeGPR10 ) - Ct (NTB ); Calculate the ΔΔCt value: take the sample at the top of the internode (Up) as the control group, and calculate the ΔΔCt value of the experimental group (Mid, Basal) relative to the control group: ΔΔCt = ΔCt(experimental group) - ΔCt(control group); Calculate the relative expression level: The relative expression level of the target gene in the experimental group relative to the control group (Relative expression level) is calculated as: Relative expression level = 2 ^(-ΔΔCt) Statistical analysis: Statistical analysis was performed using appropriate statistical methods (e.g., one-way ANOVA with Tukey's HSD multiple comparison test). PeGPR10 The significance level was set at P < 0.05.

[0079] (5) Results and Conclusions

[0080] qPCR analysis results showed that ( Figure 2 ), PeGPR10The gene expression level was highest in the top (Up) region of the fast-growing internode of the bamboo stem, and its relative expression level was set to 1 (control group). The relative expression levels in the middle (Mid) and base (Basal) regions were significantly lower than those in the top (P<0.05), at 0.42 and 0.37, respectively. The difference in expression between the middle and base regions did not reach a statistically significant level. This result indicates that PeGPR10 During the rapid elongation of bamboo stems, the gene is highly expressed mainly in the top area of ​​the internode (i.e., the active cell elongation area), while the expression level in the middle and base (the area where cell elongation slows down or stops) is significantly reduced. PeGPR10 The expression pattern of the gene is closely related to the rapid elongation growth of internodes in bamboo stems.

[0081] Example 2: Overexpression of bamboo PeGPR10 Functional verification

[0082] 2.1 Overexpression vector ProUbi::PeGPR10-GFP-Flag Construction

[0083] (1) Amplification and purification of target gene fragments

[0084] Primer design: Based on bamboo PeGPR10 The full-length CDS sequence of the gene (SEQ ID NO.1) was used to design specific primers with specific homologous recombination arms to amplify the target fragment. PeGPR10 -OE-F): 5'-tgttatacttctgcaggagctc ATG GCGATGGCGGCGAAGCCC-3' (SEQ ID NO. 9), reverse primer ( PeGPR10 -OE-R): 5'-ctcaccatggatccggtaccTAAACACACGCAACACCGA-3' (SEQ ID NO. 10); wherein lowercase letters represent homologous recombination arms.

[0085] PCR amplification: Using the bamboo cDNA prepared in Example 1 as a template, primers PeGPR10 -OE-F and PeGPR10 PCR amplification was performed using 2× Phanta Max Master Mix (Dye Plus) high-fidelity DNA polymerase from Novozymes. Reaction conditions were similar to the PCR protocol in Example 1, with the annealing temperature optimized to 60°C.

[0086] Product Verification and Purification: PCR products were analyzed by 1% agarose gel electrophoresis, confirming the presence of a single, clear band at the expected size (approximately 573 bp). The desired band was recovered by gel excision using the AxyPrep DNA Gel Extraction Kit (Axygen). The purified DNA was dissolved in an appropriate amount of sterile, nuclease-free water, and the concentration was determined spectrophotometrically. The sequence is identical to that of SEQ ID NO. 1.

[0087] (2) Linearization of overexpression vector

[0088] Vector information: The basic vector used in this experiment is named ProUbi::GFP-Flag This vector belongs to the existing known vector, namely the one in the patent CN118620953B "Application of Rice GS2 Gene in Regulating Rice Panicle Shape" pUbi-GFP- Flag .

[0089] 2 μg of vector plasmid DNA was digested with the restriction endonuclease Sac I (NEB, R3156) at 37°C for 2 hours. The digestion system was performed according to the manufacturer's instructions. The linearized vector fragment was purified using the AxyPrep DNA Gel Extraction Kit (Axygen) and dissolved in sterile nuclease-free water.

[0090] (3) Homologous recombination connection diagram

[0091] The purified product from step (1) PeGPR10 Linearization of gene fragment (with homology arms) purified in step (2) ProUbi:: GFP-Flag The vector fragment (with complementary homology arms) was further ligated to the vector using the ClonExpress® II One Step Cloning Kit from Novozymes.

[0092] Prepare the ligation reaction mixture as shown in Table 6 below.

[0093] Table 6. Homologous recombination ligation reaction system

[0094]

[0095] (4) Transformation and positive clone screening:

[0096] The homologous recombination product of step (3) was transformed into TSINGKE TSC-C14 DH5α competent cells, and then heat-shocked at 42°C for 45 seconds after ice bath for 30 minutes; after recovery, it was spread on LB solid plates containing Kna antibiotics and inverted cultured at 37°C for 12-16 hours; single colonies were picked and positive clones were identified using vector universal primers. The forward primer sequence for sequencing was detF:TTGATATACTTGGATGATGGCATA (SEQ ID NO.11), and the reverse primer sequence was detR:CACTGCACGCCGTAGGTGA (SEQ ID NO.12).

[0097] (5) Sequencing of positive clones and obtaining of recombinant plasmids:

[0098] The single colony with positive PCR result was sent to Zhejiang Shangya Biotechnology Co., Ltd. for sequencing using the det primer in step (4). The sequencing results confirmed that the inserted fragment sequence was completely consistent with SEQ ID NO: 1 and the reading frame was correct, forming ProUbi::PeGPR10-GFP-Fla g fusion gene plasmid ( Figure 3 ).

[0099] 2.2 Overexpression PeGPR10 Obtaining genetically modified rice

[0100] Agrobacterium tumefaciens ( Agrobacterium tumefaciens )-mediated genetic transformation method (Zhao et al., 2011; Plant Cell Tissue & Organ Culture. 2011, 106(3):475), the constructed recombinant overexpression vector was ProUbi::PeGPR10-GFP-Flag Introduced into the japonica rice variety 'Nipponbare'. Specific steps are as follows:

[0101] The recombinant plasmid was electroporated ProUbi::PeGPR10-GFP-Flag Agrobacterium strains EHA105 The callus tissue induced by mature embryos of rice variety Nipponbare was used. After 2 weeks of induction in the induction medium, the vigorous growing callus tissue was selected as the receptor material and placed in a medium containing ProUbi::PeGPR10-GFP-Flag of EHA105Agrobacterium suspension, shake and infect for 30 minutes; spread the infected callus tissue of Nipponbare on sterile filter paper, wait for the bacterial liquid to be dried, and then transduce the callus tissue and co-cultivate it in the dark at 28℃ for 3 days; wash the co-cultivated callus tissue with sterile water containing 400mg / L carboxybenzyl, and spread the callus on the screening medium containing 50mg / L Hygromycin and 400mg / L carboxybenzyl and culture it under light for about 20 days; transfer the pre-differentiated callus to the differentiation medium and continue to culture it under light conditions until resistant callus seedlings grow; transfer it to the rooting medium and continue to culture it. After the seedlings grow to 10-15cm and take root, open the sealing film of the vial, pour in sterile water, and after hardening the seedlings for 3 days, transplant them to the greenhouse. The resulting callus is named overexpression PeGPR10 Genetically modified rice.

[0102] Note: The screening medium, differentiation medium, and rooting medium mentioned above can all refer to "Agrobacterium tumefaciens-mediated transformation of japonica rice" in Chapter 8 of the "Rice Protocol e-book".

[0103] 2.3 Overexpression PeGPR10 Screening and identification of positive transgenic plants

[0104] (1) Genomic DNA extraction: CTAB method PeGPR10 Genomic DNA from leaf tissues of overexpressing transgenic rice plants.

[0105] (2) PCR detection: The genomic DNA extracted in (1) was used as a PCR amplification template (the concentration was approximately 50-100 ng / µL). The specific primer sequences were forward primer F: 5'-TTGATATACTTGGATGATGGCATA-3' (SEQ ID NO. 13) and reverse primer R: 5'-ATGTGGCACTGCACCTAGGAC-3' (SEQ ID NO. 14) for PCR molecular detection.

[0106] PCR amplification was performed using 2× Taq Master Mix (Dye). The reaction system is as shown in Table 7:

[0107] Table 7. PCR amplification reaction system

[0108]

[0109] Set the following program (Table 8) in the PCR instrument for amplification:

[0110] Table 8. PCR reaction program

[0111]

[0112] The PCR products were subjected to 1.5% agarose gel electrophoresis and observed in a gel imaging system ( Figure 4 ).in, Figure 4 The negative control N is the transgenic rice transformed with an empty vector, and the positive control P is the plasmid ProUbi::PeGPR10- GFP-Flag , Lanes 1-9 represent 9 transgenic rice seedlings obtained.

[0113] The results showed that: in the gel imaging results ( Figure 4 ), the sizes shown in lanes 1, 2, 4, 7, 8, and 9 were similar to those of the positive control P, indicating that the genomic DNA of these plants was successfully integrated. PeGPR10 The gene expression cassette was detected, and the transgenic plants were identified as positive. The negative control (lane N, transgenic rice transformed with empty vector) did not show the expected band. The positive control (lane P, plasmid ProUbi::PeGPR10-GFP-Flag ) showed a band of the expected size, verifying the effectiveness of the PCR detection system. The above 6 positive transgenic plants were self-pollinated and 6 independent overexpression lines were obtained. PeGPR10 transgenic rice lines.

[0114] 2.4 Overexpression PeGPR10 Phenotypic Analysis of Plant Height and Internode Length in Transgenic Rice

[0115] Phenotypic observation was performed on the six transgenic rice lines (Nipponbare background) overexpressing PeGPR10 obtained through the screening in step 2.3 above. Two of them were selected. PeGPR10 Detailed analysis was performed on strains with significant differences in expression levels and plant height phenotypes: PeGPR10 -OE1 (strain 1) and PeGPR10 -OE2 (Strain 2) ( Figure 5 A).

[0116] Plant growth stage: When the rice plants grow to maturity, the phenotypes of the wild-type Nipponbare and the transgenic lines overexpressing PeGPR10 are measured.

[0117] Determination of gene expression: The determination method was to determine the expression of wild-type Nipponbare and overexpressed PeGPR10 Overexpression lines PeGPR10 Gene expression level.

[0118] Phenotypic determination: Determine and record wild-type Nipponbare (NPB), PeGPR10 -OE1 (strain 1) and PeGPR10The following agronomic traits of -OE2 (line 2), including plant height, ear length, and lengths of the first, second, and third internodes from top to bottom, were analyzed for significant differences between the transgenic lines and wild-type controls using t-tests. Significance was set at P < 0.05 or P < 0.01.

[0119] The results showed that when rice grows to maturity, PeGPR10 -OE-1 PeGPR10 The expression level of Nipponbare (NPB) is 323 times that of the receptor. PeGPR10 -OE-2 PeGPR10 The expression level of the receptor Nipponbare is 521 times higher than that of Figure 5 B). Compared with wild-type rice Nipponbare (NPB), overexpression PeGPR10 The plant height of transgenic rice was significantly reduced ( Figure 5 C), and the spike length (PL), the length of the first internode, the second internode, and the third internode from top to bottom were significantly reduced ( Figure 6 ), resulting in the transgenic rice plant height being significantly shorter than that of the wild-type Nipponbare.

[0120] Finally, it should be noted that the above examples are merely specific embodiments of the present invention. Obviously, the present invention is not limited to the above examples and is subject to numerous variations. All variations that can be directly derived or conceived by a person of ordinary skill in the art from the disclosure of the present invention are considered to be within the scope of protection of the present invention.

Claims

1. A bamboo stem elongation regulating gene, PeGPR10, characterized by: The nucleotide sequence is shown in SEQ ID No:

1.

2. The protein encoded by the bamboo stem elongation regulating gene PeGPR10 according to claim 1, characterized in that: The amino acid sequence is shown in SEQ ID No.

2.

3. A plasmid containing the bamboo stem elongation regulating gene PeGPR10 according to claim 1, characterized in that it is ProUbi::PeGPR10-GFP-Flag.

4. An overexpression vector containing the bamboo stem elongation regulating gene PeGPR10 according to claim 1, characterized in that: The overexpression vector is a plant expression vector ProUbi::PeGPR10-GFP-Flag in which the UBI promoter, the PeGPR10 gene according to claim 1, and the GFP gene are sequentially connected to the multiple cloning site region.

5. The use of the gene according to claim 1, characterized in that: Overexpression of the PeGPR10 gene in bamboo negatively regulates rice plant height.

6. The use of the gene according to claim 5, characterized in that: The ear length, length of the first internode from top to bottom, length of the second internode, and length of the third internode all decreased.

7. A method for regulating internode length of rice, characterized by: The PeGPR10 gene overexpression vector was transformed into rice to obtain transgenic rice plants, thereby negatively regulating the internode length of rice. The nucleotide sequence of the PeGPR10 gene is shown in SEQ ID No: 1.

Images