Enterococcus pluvialis capable of effectively regulating uric acid metabolism as well as fungicide and application of enterococcus pluvialis

Abstract

The invention discloses an intestinal strain capable of effectively regulating uric acid metabolism, a microbial agent of the intestinal strain and application of the intestinal strain in uric acid reducing products, and belongs to the technical field of microorganisms. According to the enterococcus pluvialis ZQ205, the enterococcus pluvialis ZQ205 which is free of toxic and side effects and capable of effectively relieving and treating the hyperuricemia is found for the first time, and the collection number of the enterococcus pluvialis ZQ205 in the China Center for Type Culture Collection is CCTCC NO: M 2025844; the strain can significantly reduce the levels of uric acid, creatinine and urea nitrogen in serum of mice, can effectively reduce the levels of inflammatory factors such as IL-6 and TNF-alpha in serum of hyperuricemia mice, and can improve kidney injury caused by hyperuricemia.

Description

Technical Field

[0001] The present invention belongs to the field of microbial technology, and specifically relates to an intestinal bacterial strain and a bacterial agent that effectively regulates uric acid metabolism, and its use in uric acid-lowering products. Background Art

[0002] Hyperuricemia is a metabolic disease caused by excessive uric acid levels in the body. Hyperuricemia is a long-lasting condition with recurring symptoms, and can easily develop into gout, posing a serious threat to health. Currently, the main medications used in the clinical treatment of hyperuricemia include allopurinol, colchicine, febuxostat, and benzbromarone. While these medications can effectively lower uric acid levels in the body, they can also cause adverse reactions such as allergies, liver and kidney damage, diarrhea, abdominal pain, and rashes.

[0003] In recent years, studies have found that uric acid metabolism is closely related to an imbalance in the intestinal flora. Alleviating the symptoms of hyperuricemia through the action of intestinal microorganisms has aroused great interest. Currently, the use of intestinal probiotics to treat a variety of intestinal diseases has achieved good results and has significant advantages over traditional methods. Hyperuricemia, as a chronic metabolic disease, can also be treated with intestinal probiotics. However, the discovery and exploration of key intestinal probiotics involved in hyperuricemia is an extremely complex and difficult task. Currently, only a small number of strains may be involved in the metabolic regulation of hyperuricemia.

[0004] Enterococcus is part of the normal intestinal flora of humans and animals. Previous research has focused on harmful effects of enterococci, such as urinary tract infections and skin and soft tissue infections. However, recent studies have found that enterococci may play an important role in promoting human health, particularly in regulating uric acid metabolism. Patent CN116515674A discloses that the chicken-derived Enterococcus faecalis CML390 strain has biological activity in reducing serum uric acid levels in hyperuricemic mice. Patent CN117866839A discloses that the culture supernatant of Enterococcus faecalis XY7, isolated from human feces, exhibits xanthine oxidase inhibitory activity, potentially preventing and alleviating hyperuricemia and gout. Patent CN117866841A discloses a strain of Enterococcus faecalis XY2 isolated from human feces. This strain exhibits superior protease activity and can inhibit α-glucosidase, acetylcholinesterase, and xanthine oxidase activities, showing promising applications in gastrointestinal conditioning and gout relief. However, E. faecalis has long been considered a pathogen, and its commercial application for the treatment of hyperuricemia is uncertain.

[0005] Enterococcus casseliflavus, a member of the genus Enterococcus, is commonly used in the healthcare field to regulate the intestinal or skin microbiome and alleviate inflammatory diseases. A search of domestic and international literature has revealed no strains of Enterococcus casseliflavus that can lower serum uric acid, creatinine, or urea nitrogen. Summary of the Invention

[0006] In view of the shortcomings of existing bacterial resources, the first purpose of the present invention is to provide a lead-flavor Enterococcus that effectively regulates uric acid metabolism, so as to enrich the existing microbial resources and provide a probiotic product with more outstanding efficacy for the treatment of patients with hyperuricemia.

[0007] In order to achieve the above purpose, the inventors discovered a strain of intestinal active bacteria with no toxic side effects and that can effectively relieve hyperuricemia from the feces of Kunming mice. Based on its colony morphology, molecular biology experiments and genome sequencing, the inventors finally determined that the bacteria was an Enterococcus genus, specifically Enterococcus casseliflavus, and named it ZQ205. The strain was deposited in the China Center for Type Culture Collection (CCTCC, Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province) on April 21, 2025, and its deposit number is CCTCCNO: M 2025844.

[0008] It should be noted that the isolated Enterococcus pyogenes ZQ205 of the present invention has the following morphological and growth characteristics: the Enterococcus pyogenes ZQ205 is a facultative anaerobic bacterium, and the optimal growth condition is anaerobic culture at 37°C. The colonies cultured on blood agar plates for 24 hours are milky white, opaque, round, with irregular wavy edges and a diameter of about 1-2 mm ( Figure 3 The growth curve after 24 hours of culture in the culture medium is as follows: it enters the logarithmic growth phase at 4 hours, enters the plateau phase at 12 hours, and begins to decline at 24 hours ( Figure 4 Culture medium formula: yeast extract 2 g, peptone 2 g, mulberry linalool 2 g, sodium bicarbonate 2 g, bile salt 0.5 g, sodium chloride 0.1 g, dimethyl phosphate 0.04 g, potassium dihydrogen phosphate 0.04 g, calcium chloride 0.01 g, magnesium sulfate 0.01 g, hemin 0.02 g, Tween-80 2 mL, L-cysteine 0.5 g, resazurin sodium salt (1%) 1 mL, vitamin K (0.1 mg / mL) 10 mL.

[0009] The 16S rRNA gene of the above-mentioned Enterococcus fusogenus ZQ205 contains the DNA molecule shown in SEQ ID NO.1 in the sequence list, and its specific nucleotide sequence is as follows:

[0010] GGGGTTCCTATACATGCAAGTCGAACGCTTTTTCTTTCACCGGAGCTTGCTCCACC

[0011] GAAAAAAAAGAGTGGCGAACGGGTGAGTAACACGTGGGTAACCTGCCCATCAG

[0012] AAGGGGATAACACTTGGAAAACAGGTGCTAATACCGTATAACACTATTTTCCGCATG

[0013] GAAGAAAGTTGAAAGGCGCTTTTGCGTCACTGATGGATGGACCCGCGGTGCATTA

[0014] GCTAGTTGGTGAGGTAACGCTCACAAGGCAACGATGCATAGCCGACCTGAGAG

[0015] GGTGATCGGCCACACTGGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGC

[0016] AGTAGGGAATCTTCGGCAATGGAACGAAGTCTGACCGAGCAACGCCGCGTGAGTG

[0017] AAGAAGGTTTTCGGATCGTAAAACTCTGTTGGTTAGAAAAAAGGATGAGAGT

[0018] AAAATGTTCATCCCTTGACGGTATCTAACCAGAAAGCCACGGCTAACTACGTGCCA

[0019] GCAGCCGCGGTAATACGTAGGTGGCAAGCGTTGTCCGGGATTATTGGGCGTAAAGC

[0020] GAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGG

[0021] GTCATTGGAAACTGGGAGACTTGAGTGCAGAAGGAGAGTGGAATTCCATGTGT

[0022] AGCGGTGAAATGCGTAGATATATGGAGGAACACCAGTGGCGAAGGCGGCTTCTCTG

[0023] GTCTGTAACTGACGCTGAGGCTCGAAAGCGTGGGGAGCGAACAGGATTATATACC

[0024] CTGGTAGTCCACTCCGTAA

[0025] The culture of the aforementioned Enterococcus fusogenus ZQ205 also falls within the scope of protection of the present invention. The culture is obtained by culturing the aforementioned Enterococcus fusogenus ZQ205 strain in a microbial culture medium (including shake flask culture and fermentation tank culture). For example, the culture contains Enterococcus fusogenus ZQ205 and a substance secreted into a liquid culture medium (i.e., a fermentation broth), or contains Enterococcus fusogenus ZQ205 and a substance secreted into a solid culture medium.

[0026] A second object of the present invention is to provide a bacterial agent comprising the aforementioned Enterococcus fusogenus ZQ205 or / and its metabolites or / and the aforementioned culture. It should be noted that the bacterial agent exhibits at least one of the following biological activities: (1) lowering serum uric acid levels; (2) lowering serum creatinine levels; (3) lowering serum urea nitrogen levels; and (4) reducing kidney damage.

[0027] It should be noted that the active ingredient of the above-mentioned bacterial agent may be Enterococcus fusogenum ZQ205 or / and metabolites of Enterococcus fusogenum ZQ205; the metabolites of Enterococcus fusogenum ZQ205 may be a fermentation broth of Enterococcus fusogenum ZQ205. The fermentation broth of Enterococcus fusogenum ZQ205 can be prepared by the following method: culturing Enterococcus fusogenum ZQ205 in a liquid fermentation medium, collecting the fermentation broth (containing Enterococcus fusogenum ZQ205 and substances secreted into the liquid medium), and the fermentation broth is the metabolite of Enterococcus fusogenum ZQ205.

[0028] The third object of the present invention is to provide a use of Enterococcus fulvidae ZQ205, its culture or its bacterial agent, wherein the use is selected from at least one of the following:

[0029] (1) Use in the preparation of products for lowering serum uric acid levels;

[0030] (2) Use in the preparation of a product for lowering serum creatinine levels;

[0031] (3) Use in the preparation of products for reducing serum urea nitrogen levels;

[0032] (4) Use in the preparation of products that reduce kidney damage;

[0033] (5) Use in the preparation of products for treating and / or alleviating hyperuricemia;

[0034] (6) Use in the preparation of products for treating and / or alleviating gout.

[0035] It should be noted that the Enterococcus fusogenum ZQ205 described in the present invention can reduce uric acid, creatinine, and urea nitrogen levels in mouse serum, and can effectively reduce the levels of inflammatory factors such as IL-6 and TNF-α in the serum of hyperuricemic mice. Therefore, the Enterococcus fusogenum ZQ205 described in the present invention can be used to prepare uric acid-lowering auxiliary drugs, health products, or feed additives. It has the advantages of low cost, no toxic side effects, and good effect in alleviating hyperuricemia, and has a very broad potential development prospect.

[0036] Compared to existing technologies, this invention discovered for the first time a novel, non-toxic strain of Enterococcus fuscae ZQ205 that effectively alleviates and treats hyperuricemia. This strain significantly reduced serum uric acid, creatinine, and urea nitrogen levels in mice. It also effectively reduced levels of inflammatory factors such as IL-6 and TNF-α in the serum of hyperuricemic mice and improved kidney damage caused by hyperuricemia. The discovery of this strain enriches the existing resource of Enterococcus fuscae strains and is expected to be developed into a new and effective probiotic, bringing hope to gout patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 :E.casseliflavus ZQ205 16S rDNA sequence alignment results;

[0038] Figure 2 : Phylogenetic tree constructed based on 16S rDNA gene sequence;

[0039] Figure 3 : Colony morphology and characteristics of Enterococcus leucoderma ZQ205;

[0040] Figure 4 : Growth curve of Enterococcus leucoderma ZQ205;

[0041] Figure 5 : Serum uric acid, creatinine and urea nitrogen levels in mice in different groups;

[0042] Figure 6 : Serum IL-6 and TNF-α levels in mice in different groups;

[0043] Figure 7 : HE staining of kidneys of mice in different groups. DETAILED DESCRIPTION

[0044] The present invention is further described below by preferred embodiments, however, the protection scope of the present invention is not limited to the following embodiments. Any changes or equivalent substitutions that do not deviate from the technical concept of the present invention are included in the protection scope of the present invention.

[0045] Example 1 Isolation, Culture and Identification of Enterococcus casseliflavus ZQ205 1. Isolation and Culture of Enterococcus casseliflavus

[0046] Mouse fecal contents were added to a fermentation medium containing mulberry linolenic acid polyphenols and then anaerobically fermented in a 37°C incubator for 24 hours to enrich various intestinal flora. Following fermentation and enrichment, the cultures were streaked onto blood (agar) plates (Huankai Biotechnology Co., Ltd.) using an anaerobic gas composition of 80:20 N2:CO2. Single colonies were then picked and streaked to obtain pure cultures of each individual colony.

[0047] 2. Sequencing and identification of strain 16S rDNA

[0048] Genomic DNA of the isolated strain was extracted using a reference kit (DNeasy® Brood & Tissue Kit, QIAGEN). After extraction, 16S rDNA universal primers were used to amplify the genomic DNA of qualified strains by PCR. Detection by 1% agarose gel electrophoresis revealed no smearing or tailing, confirming successful DNA extraction and purification. The ZQ205 bacterial suspension was stored at -20°C until use.

[0049] Upstream primer 27F: 5′-AGAGTTTGATCATGGCTCAG-3′;

[0050] Downstream primer 1492R: 5′-TAGGGTTACCTTGTTACGACTT-3′.

[0051] PCR amplification system and program settings:

[0052] PCR reaction system: 20 μL system contains 2.5 μL of strain genomic DNA template, 2.5 μL of upstream and downstream primers, and 15 μL of Gold Mix (Baori Medical Biotechnology Co., Ltd.).

[0053] The PCR reaction procedure is as follows:

[0054] Stage 1: 95°C, 3 min Stage 2: 95°C, 30 s, 58°C, 30 s, 72°C, 1 min, 30 cycles

[0055] Stage 3: 72℃, 5minStage 4: 12℃, ∞

[0056] The obtained 16S rDNA amplification products were detected by 1.5% gel electrophoresis, and the qualified amplified sequences were sent to Tianyi Huayu Gene Technology Co., Ltd. (Wuhan) for sequencing. The obtained 16S rDNA sequences were aligned in the NCBI database, and then a phylogenetic tree was constructed based on the 16S rDNA gene sequence.

[0057] The sequence comparison results are as follows Figure 1 As shown in the figure, the isolated and identified ZQ205 strain has homology with Enterococcus casseliflavus, with a total score of more than 7000. Figure 2 As shown, the E. casseliflavus ZQ205 identified by our laboratory shares some homology with E. casseliflavus AU11 and E. casseliflavus V311, but exhibits significant sequence divergence. The isolated ZQ205 strain was confirmed to belong to Enterococcus casseliflavus and named Enterococcus casseliflavus ZQ205. Enterococcus casseliflavus ZQ205 was deposited with the China Center for Type Culture Collection (CCTCC, located at 299 Bayi Road, Wuhan University, opposite the First Affiliated Primary School, Wuchang District, Wuhan, Hubei Province) on April 21, 2025, under the accession number CCTCC M 2025844.

[0058] Example 2 Analysis of the physicochemical properties of Enterococcus casseliflavus ZQ205 1. Colony morphology and characteristics of Enterococcus casseliflavus ZQ205

[0059] The isolated Enterococcus leucoderma ZQ205 strain was streaked on a blood agar plate and then incubated anaerobically at 37°C. After 24 hours of incubation, the colonies were light white, round, with irregular wavy edges and a diameter of about 1-2 mm ( Figure 3 ).

[0060] 2. Plotting the Growth Curve of Enterococcus leucoderma ZQ205

[0061] The lead-yellow Enterococcus ZQ205 was taken out of the -80°C refrigerator, streaked on a blood (agar) plate, and the plate was placed in a 37°C constant temperature incubator for culture; after culture for 24 hours, a single colony was picked from the plate and inoculated into 10 mL of modified YPD broth medium, and cultured in a 37°C constant temperature incubator for 24 hours; three identical sterilized centrifuge tubes containing 10 mL of modified YPD broth were prepared to constitute technical replicates, and the cultured bacterial liquid was transferred into three 10 mL culture solutions at a 1% inoculation volume; all the culture solutions were placed in a 37°C constant temperature incubator for culture, and the OD600nm value was monitored every 1 hour using a multifunctional microplate reader (Varioskan Flash, Thermo Corporation, USA) until the OD600nm value stopped rising and began to decline, and the monitoring was stopped; the growth curve of the lead-yellow Enterococcus ZQ205 was drawn with the monitoring time as the horizontal axis and the OD600nm value as the vertical axis.

[0062] The growth curve of Enterococcus leucoderma ZQ205 is as follows Figure 4 As shown, Enterococcus fulva ZQ205 entered the logarithmic growth phase at 3 h, entered the plateau phase at 10 h, and began to decline at 12 h.

[0063] Example 3 Analysis of the Effect of Enterococcus casseliflavus ZQ205 on Regulating Uric Acid Metabolism and Alleviating Hyperuricemia

[0064] 1. The mouse model used in this example was induced with hyperuricemia by oral administration of 200 mg / kg potassium oxonate and 200 mg / kg hypoxanthine for 35 days (once daily, with the daily oral administration volume adjusted based on the mouse's weight). During this period, the mouse was gavaged with Enterococcus fusogenum ZQ205. The details are as follows:

[0065] Forty SPF male Kunming mice (8 weeks old, 20±2g) were purchased from Hubei Experimental Animal Research Center. Experimental conditions: temperature 25±2℃, humidity 50±20%, 12-hour light-dark cycle, free access to water, and no dietary restrictions. After 7 days of adaptive feeding, the mice were randomly divided into four groups: blank control group (NC), model group (MC, 200mg / kg hypoxanthine + 200mg / kg potassium oxonate), allopurinol group (AP, 30mg / kg), and bacterial solution group (EC, 0.1mL / 10g). In this experiment, except for the blank control group, the hyperuricemia mouse model was established by gavage of 200mg / kg potassium oxonate and 200mg / kg hypoxanthine at 9 am every day in the other groups. The model was established for 7 consecutive days. The blank control group was gavaged with an equal amount of 0.5% sodium carboxymethyl cellulose. Starting from the 8th day, at 9:00 am every day, except for the blank control group, the other groups continued to be gavaged with 200 mg / kg potassium oxonate and hypoxanthine to establish hyperuricemia models. At 10:00 am, each drug group was gavaged with the corresponding drug. The normal group and the model group were gavaged with the same amount of 0.5% sodium carboxymethyl cellulose; the allopurinol group was gavaged with 30 mg / kg of allopurinol; the bacterial solution group was gavaged with 3.2×10 8 CFU / mL was administered orally, and 0.1mL / 10g was used; all groups were treated with oral gavage for 28 days. During the experiment, the mice were weighed and the feed was weighed daily to observe their daily body weight and diet, and the bedding was changed every 24 hours.

[0066] 2. Experimental results

[0067] 1) Enterococcus fulvidraco ZQ205 reduces serum uric acid, creatinine, and urea nitrogen levels in mice

[0068] like Figure 5 As shown in the data, compared with the mice in the NC group, after 5 weeks of modeling, the levels of serum uric acid, creatinine and urea nitrogen in the mice in the MC group were significantly increased (P<0.05). After intervention with allopurinol and Enterococcus fuscae ZQ205, their uric acid, creatinine and urea nitrogen levels were significantly decreased (P<0.05), indicating that Enterococcus fuscae ZQ205 can reduce the serum uric acid level in mice.

[0069] 2) Enterococcus fulvicidal ZQ205 can reduce the levels of IL-6 and TNF-α in mouse serum

[0070] like Figure 6 As shown in the data, compared with the mice in the NC group, after 5 weeks of modeling, the serum IL-6 and TNF-α levels of the mice in the MC group were significantly increased (P<0.05). After the intervention of Enterococcus flavus ZQ205 in the EC group, the IL-6 level was significantly decreased (P<0.05), indicating that Enterococcus flavus ZQ205 can reduce the serum IL-6 and TNF-α levels of mice and alleviate the inflammatory response.

[0071] 3) Enterococcus fulvicus ZQ205 can alleviate kidney damage caused by hyperuricemia in mice

[0072] HE staining results Figure 7 As shown in the figure, kidney sections of mice in the NC group showed no obvious damage, and the morphology and structure of the glomeruli and renal tubules were normal. After hyperuricemia modeling, the renal interstitial area of the MC and AP groups was larger, accompanied by glomerular atrophy and inflammatory cell infiltration. However, treatment with Enterococcus fusogenum ZQ205 in the EC group improved these symptoms. No vacuoles were observed in the renal corpuscles of the mice, the renal tubules were improved, and inflammation was reduced, indicating that Enterococcus fusogenum ZQ205 can alleviate the renal damage caused by hyperuricemia in mice.

[0073] The above experimental results show that the present invention has successfully isolated and identified a strain of Enterococcus pyogenes ZQ205, which can significantly reduce the levels of uric acid, creatinine and urea nitrogen in mouse serum, and can effectively reduce the levels of inflammatory factors such as IL-6 and TNF-α in the serum of hyperuricemia mice and improve kidney damage caused by hyperuricemia.

Claims

1. An Enterococcus casseliflavus ZQ205, whose deposit number in the China Center for Type Culture Collection is CCTCC NO: M 2025844.

2. The Enterococcus casseliflavus ZQ205 according to claim 1, characterized in that The 16S rRNA gene of ZQ205 contains the DNA molecule shown in SEQ ID NO.1 in the sequence list.

3. A culture of Enterococcus casseliflavus ZQ205 according to claim 1 or 2, characterized in that: The substance is obtained by culturing the ZQ205 in a microbial culture medium.

4. A bacterial agent, characterized in that: The bacterial agent contains the ZQ205 according to claim 1 or 2 or / and the metabolite of ZQ205 according to claim 1 or 2 or / and the culture according to claim 3.

5. The use of Enterococcus casseliflavus ZQ205 according to claim 1 or 2, wherein the use is selected from at least one of the following: (1) Use in the preparation of products for lowering serum uric acid levels; (2) Use in the preparation of a product for lowering serum creatinine levels; (3) Use in the preparation of products for reducing serum urea nitrogen levels; (4) Use in the preparation of products that reduce kidney damage; (5) Use in the preparation of products for treating and / or alleviating hyperuricemia; (6) Use in the preparation of products for treating and / or alleviating gout.

6. Use of the culture according to claim 3, wherein the use is selected from at least one of the following: (1) Use in the preparation of products for lowering serum uric acid levels; (2) Use in the preparation of a product for lowering serum creatinine levels; (3) Use in the preparation of products for reducing serum urea nitrogen levels; (4) Use in the preparation of products that reduce kidney damage; (5) Use in the preparation of products for treating and / or alleviating hyperuricemia; (6) Use in the preparation of products for treating and / or alleviating gout.

7. The use of the microbial agent according to claim 4, wherein the use is selected from at least one of the following: (1) Use in the preparation of products for lowering serum uric acid levels; (2) Use in the preparation of a product for lowering serum creatinine levels; (3) Use in the preparation of products for reducing serum urea nitrogen levels; (4) Use in the preparation of products that reduce kidney damage; (5) Use in the preparation of products for treating and / or alleviating hyperuricemia; (6) Use in the preparation of products for treating and / or alleviating gout.

8. The use according to any one of claims 5 to 7, characterized in that The product is a medicine, a health product or a feed additive.

Images