Aptamer biosensor and method for determining ochratoxin A based on aggregation-induced emission effect
By constructing a biosensor based on aggregation-induced luminescence effect based on nucleic acid aptamers and fluorescent dyes, the problem of high cost and long time for ochratoxin A is solved, and a low-cost and high-sensitivity detection effect is achieved.
Patent Information
- Application Number
- CN202510561647.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-30
- Publication Date
- 2025-08-05
AI Technical Summary
In the prior art, the detection cost of ochratoxin A is high, the detection scheme is complex and time-consuming, and the traditional antibody detection method is highly sensitive but costly and prone to inactivation, which limits its application and development.
The nucleic acid aptamer specifically recognized ochratoxin A was used to bind exonuclease and small molecule fluorescent dyes, and aptamer biosensor was constructed using the aggregation-induced luminescence effect, and the fluorescence signal was detected by the change.
It realizes low-cost, fast and sensitive ochratoxin A detection, with a sensitivity of up to 1.37ng/mL, reducing detection costs and simplifying the operation process.
Smart Images

Figure CN120424936A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of food safety detection, and in particular to an aptamer biosensor and a method for detecting ochratoxin A based on the aggregation-induced emission effect. Background Art
[0002] Ochratoxins are a group of toxic metabolites produced by several strains of the Aspergillus and Penicillium genera. Among the mycotoxins identified, ochratoxins are considered second only to aflatoxins in terms of their harmfulness. In addition to compounds A, B, C, and D, ochratoxins also include the methyl ester of ochratoxin A and the methyl or ethyl esters of ochratoxin B. Among these ochratoxin compounds, ochratoxin A (OTA) is the most widespread, toxic, and harmful, and has been designated a Class IIB carcinogen by the International Agency for Research on Cancer.
[0003] With the development of biotechnology, biosensor technology, characterized by its short detection time and simple sample pretreatment, is increasingly being applied to the detection of various food toxicants, becoming a rapidly emerging new detection technology. Recognition molecules, as key components of biosensors, are a key factor affecting their specificity, stability, and range of applications. Antibodies, currently the most commonly used recognition molecules in biosensors, offer high sensitivity and specificity, but their high cost and susceptibility to inactivation significantly limit their application and development.
[0004] Aptamers are oligonucleotide sequences selected from synthetic DNA or RNA libraries using the systematic evolution of ligands by exponential enrichment (SELEX) method. Under certain conditions, aptamers can efficiently and specifically recognize and bind to target molecules. Therefore, aptamers are also called "chemical antibodies." Compared with traditional antibodies, aptamers offer many advantages, such as ease of preparation, a wide range of target molecules, strong specificity, high affinity, and stable properties. Given these advantages, aptamers, as a new type of recognition molecule, have garnered widespread attention from researchers in molecular biology, nanomaterials, molecular recognition and analysis, and biomedicine, both domestically and internationally.
[0005] Traditional OTA detection methods include thin-layer chromatography, high-performance thin-layer chromatography, HPLC, enzyme-linked immunosorbent assay (ELISA), and fluorescence colorimetry. These methods often suffer from long detection cycles, expensive instrumentation, cumbersome procedures, and the need for specialized personnel, limiting their practical application. Therefore, there is a need for a new, rapid, convenient, low-cost, and highly sensitive detection method. Summary of the Invention
[0006] The present invention aims to provide an aptamer biosensor and method for detecting ochratoxin A based on aggregation-induced emission, addressing the aforementioned problems of the prior art. The present invention provides an aptamer biosensor for detecting ochratoxin A. By leveraging the differences in the hydrolysis performance of single- and double-stranded DNA by exonucleases and the aggregation-induced emission of small molecule fluorescent dyes that bind only to intact DNA strands, ochratoxin A is detected based on changes in the detected fluorescence signal. This method effectively addresses the high cost, complex detection protocols, and long detection times of existing ochratoxin A detection methods.
[0007] To achieve the above object, the present invention provides the following solutions:
[0008] The present invention provides an aptamer biosensor for measuring ochratoxin A based on the aggregation-induced emission effect. The aptamer biosensor comprises: a nucleic acid aptamer that specifically recognizes and binds to ochratoxin A, a cDNA complementary to the nucleic acid aptamer, a nuclease, and a small molecule fluorescent dye with aggregation-induced emission effect.
[0009] Preferably, the nucleotide sequence of the nucleic acid aptamer is shown as SEQ ID NO.1.
[0010] Preferably, the small molecule dye is 4,4'-(1E,1'E)-2,2'-(anthracene-9,10-diyl)bis(ethylene-2,1-diyl)bis(N,N-dimethylaniline) or DSAI.
[0011] Preferably, the nucleotide sequence of the cDNA is shown as SEQ ID NO.3.
[0012] The present invention provides a method for constructing the above-mentioned aptamer biosensor, comprising the following steps:
[0013] Prepare nucleic acid aptamer solution, cDNA solution, ochratoxin A standard sample solution of different concentrations, exonuclease solution and small molecule fluorescent dye solution;
[0014] The nucleic acid aptamer solution and the cDNA solution are evenly mixed, and the ochratoxin A standard sample solutions of different concentrations, the exonuclease solution and the small molecule fluorescent dye solution are sequentially added to obtain the aptamer biosensor.
[0015] The present invention provides the use of the above-mentioned aptamer biosensor in detecting ochratoxin A.
[0016] The present invention provides a method for detecting ochratoxin A based on the above-mentioned aptamer biosensor, comprising the following steps:
[0017] Prepare nucleic acid aptamer solution, cDNA solution, ochratoxin A standard sample solution of different concentrations, exonuclease solution and small molecule fluorescent dye solution;
[0018] The aptamer solution and the cDNA solution are uniformly mixed, and the ochratoxin A standard sample solutions of different concentrations, the exonuclease solution, and the small molecule fluorescent dye solution are sequentially added thereto, and a fluorescence test is performed to establish a standard curve according to the fluorescence intensities corresponding to the ochratoxin A standard sample solutions of different concentrations;
[0019] According to the obtained standard curve, ochratoxin A in the sample to be tested is detected to obtain the content of ochratoxin A in the sample to be tested.
[0020] Preferably, the volume ratio of the aptamer solution, the cDNA solution, the ochratoxin A standard sample solutions of different concentrations, and the small molecule fluorescent dye solution is 1:1:1:1;
[0021] The concentration of the nucleic acid aptamer in the nucleic acid aptamer solution is 500 nM; the concentration of the cDNA in the cDNA solution is 500 nM; the amount of the exonuclease added is 30 U; and the concentration of the small molecule fluorescent dye in the small molecule fluorescent dye solution is 30 μM.
[0022] Preferably, the scanning wavelength of the fluorescence test is 450-650 nm, the excitation wavelength is 430 nm, the slit width is 5 nm, and the number of scans is 3 times.
[0023] As an additional solution, the present invention provides a method for detecting ochratoxin A based on aggregation-induced luminescence effect, comprising the following steps:
[0024] 1) Prepare ochratoxin A standard solutions of different concentrations using 10 mM Tris buffer;
[0025] 2) Prepare aptamer solution, cDNA solution, small molecule fluorescent dye (DSAI) solution and exonuclease Exo III solution using 10 mM Tris buffer;
[0026] 3) mixing the aptamer solution and cDNA solution obtained in step 2) in proportion, heating at 95° C. for 5 min, slowly cooling to room temperature, incubating at 37° C. for 30 min, adding the ochratoxin A standard solution obtained in step 1), and incubating at 37° C. for 15 min;
[0027] 4) adding the exonuclease Exo III solution to the mixed solution obtained in step 3), incubating at 37° C. for 30 minutes, and then mixing with the small molecule fluorescent dye solution obtained in step 2), allowing to react at room temperature in the dark for 10 minutes, and then scanning using a fluorescence spectrophotometer to establish a standard curve based on the relationship between the concentration and the corresponding fluorescence intensity value;
[0028] 5) According to the standard curve obtained in step 4), negative actual samples spiked with known concentrations of ochratoxin A are tested to determine the ochratoxin A content.
[0029] Further preferably, the 10 mM Tris buffer in step 1) comprises 120 mM NaCL, 5 mM KCL, 20 mM MgCl2, 20 mM CaCl2, and has a pH of 8.5.
[0030] Further preferably, the nucleotide sequence of the nucleic acid aptamer in step 2) is as shown in SEQ ID NO.1, specifically: 5'-GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACA-3'; the concentration of the nucleic acid aptamer in the nucleic acid aptamer solution is 500 nM; the concentration of the cDNA in the cDNA solution is 500 nM; the concentration of the small molecule fluorescent dye in the small molecule fluorescent dye solution is 30 μM; and the amount of the exonuclease solution added is 30 U.
[0031] Further preferably, in step 4), the scanning is performed using a fluorescence spectrophotometer, the scanning wavelength range is: 450-650 nm, the excitation wavelength is 430 nm, the slit width is 5 nm, and the number of scans is 3 times.
[0032] The present invention provides the use of the above-mentioned aptamer biosensor or the above-mentioned method in detecting ochratoxin A in food and / or food raw materials.
[0033] The present invention discloses the following technical effects:
[0034] 1. The present invention uses nucleic acid aptamers that can specifically bind to ochratoxin A as recognition elements to construct a fluorescent biosensor based on aggregation-induced emission for the detection of ochratoxin A. This improves the sensitivity of ochratoxin A detection and can detect ochratoxin A at a minimum concentration of 1.37 ng / mL.
[0035] 2. As a method for detecting ochratoxin A based on the aggregation-induced luminescence effect, the present invention greatly reduces the cost of detecting the target toxin and is simple and convenient to operate;
[0036] 3. The present invention solves the problems of high ochratoxin A detection costs, complex detection protocols, and prolonged detection time. The present invention utilizes nucleic acid aptamers that specifically recognize ochratoxin A, combined with the selective hydrolysis of single- and double-stranded DNA by exonucleases and the aggregation-induced luminescence effect of small molecule fluorescent dyes. This significantly improves detection sensitivity and reduces detection costs, eliminating the need for complex detection methods and expensive instruments. This represents a novel, rapid, convenient, low-cost, and highly sensitive detection method.
[0037] In summary, the present invention provides an effective method for detecting ochratoxin A and other harmful substances. BRIEF DESCRIPTION OF THE DRAWINGS
[0038] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0039] Figure 1 The principle of detecting ochratoxin A is based on the aggregation-induced emission effect;
[0040] Figure 2 Optimization of the length of complementary chain cDNA; A is the fluorescence intensity of the system with / without ochratoxin A corresponding to different lengths of cDNA, With OTA means with ochratoxin A, Without OTA means without ochratoxin A; B is the relationship between relative fluorescence intensity and cDNA;
[0041] Figure 3 This is the standard curve obtained by detecting the ochratoxin A standard solution; where A is the fluorescence spectrum curve of ochratoxin A at different concentrations, ai represents 9 different concentrations (0, 5, 10, 20, 50, 100, 200, 500 and 1000 ng / mL) of ochratoxin A standard solution; B is the fluorescence intensity corresponding to different concentrations (0, 5, 10, 20, 50, 100, 200, 500 and 1000 ng / mL) of ochratoxin A. The built-in graph is the standard curve. DETAILED DESCRIPTION
[0042] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0043] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.
[0044] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.
[0045] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.
[0046] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0047] Unless otherwise specified, the reagents, materials, instruments and methods used in the following examples are conventional reagents, materials, instruments and methods in the art and can be obtained from commercial channels by those skilled in the art.
[0048] The technical principle of the present invention is as follows Figure 1Specifically, when ochratoxin A is present in the system, the aptamer dissociates from the complementary cDNA strand due to its stronger binding affinity with ochratoxin A, forming two single-stranded DNA sequences. Adding the exonuclease Exo III, which only hydrolyzes double-stranded DNA, prevents Exo III from hydrolyzing the single-stranded aptamer and cDNA sequence, leaving the DNA strands intact. Adding a small fluorescent dye that binds to intact DNA and exhibits aggregation-induced emission (AIEL) results in the dye only binding to and aggregating with intact DNA strands. This AEL effect produces a significantly enhanced fluorescence signal. Conversely, when ochratoxin A is absent from the system, the aptamer and the complementary strand form a double-stranded structure through base pairing. Adding the exonuclease ExoIII, which hydrolyzes only double-stranded DNA, hydrolyzes the double-stranded DNA formed by the aptamer and the complementary strand. Adding a small molecule fluorescent dye with aggregation-induced emission (AIE) produces no or only a weak fluorescent signal because the dye only binds and aggregates with intact DNA strands. Therefore, the present invention can achieve quantitative detection of ochratoxin A based on the difference in detected fluorescent signals.
[0049] Example 1: Construction and Detection Method of an Aptamer Biosensor for Determining Ochratoxin A Based on Aggregation-Induced Luminescence Effect
[0050] 1. Optimization of complementary chain length
[0051] Because the complementary chain competes with ochratoxin A for binding to the aptamer, the length of the complementary chain in the reaction system is a crucial factor. If the complementary chain sequence is too short, the aptamer and the complementary chain will bind too loosely, resulting in weak competitive force and increased background signal. Conversely, if the complementary chain is too long, the aptamer and the complementary chain will bind too tightly, resulting in strong competitive force and low background signal. Therefore, the length of the complementary chain in the reaction system has a crucial impact on the sensitivity of the detection system.
[0052] The aptamer solution, cDNA solution, exonuclease Exo III solution, ochratoxin A solution of different concentrations and small molecule fluorescent dye solution were prepared using 10 mM Tris buffer (pH 8.5, 120 mM NaCl, 5 mM KCl, 20 mM MgCl2, 20 mM CaCl2); wherein the fixed aptamer concentration in the aptamer solution was 500 nM, the aptamer sequence was as shown in SEQ ID NO.1, specifically: 5'-GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACA-3', the exonuclease Exo The concentration of DSAI (small molecule fluorescent dye with aggregation-induced emission effect) in the single-stranded DNA binding solution was 30 μM. On this basis, complementary chain cDNA sequences of different lengths (10 nt, 11 nt, 12 nt, 13 nt, 18 nt, or 36 nt, as shown in Table 1) were added at a concentration of 500 nM. The fluorescence intensity of each system was measured when the ochratoxin A concentration of 100 ng / mL and the concentration was 0 for the cDNA sequences of different lengths. The experimental results are shown in Figure 1. Figure 2 As shown in A in Figure 1, as the length of the cDNA sequence increases, the overall fluorescence intensity of the samples containing ochratoxin A and those without ochratoxin A gradually decreases. Figure 2 The relative fluorescence intensity in Figure B) shows an initial increase followed by a decrease. When the cDNA length is 11 nt, the relative fluorescence intensity is highest, indicating that the system is most sensitive when the complementary chain length is 11 nt. Therefore, a complementary chain length of 11 nt was ultimately selected for the experiment, as this ensures good competitive binding while minimizing the risk of either too little or too much binding force on the aptamer DNA, which could reduce detection sensitivity.
[0053] Table 1 cDNA sequences of different lengths
[0054] cDNA specific sequence CS10 TGTCCGATGC, SEQ ID NO.2 CS11 TGTCCGATGCT, SEQ ID NO. 3 CS12 TGTCCGATGCTC, SEQ ID NO.4 CS13 TGTCCGATGCTCC, SEQ ID NO.5 CS18 TGTCCGATGCTCCCTTTA, SEQ ID NO.6 CS36 TGTCCGATGCTCCCTTTACGCCACCCACACCCGATC, SEQ ID NO.7
[0055] 2. Testing process and testing conditions
[0056] 10mM Tris buffer (pH 8.5, 120mM NaCL, 5mM KCL, 20mM MgCl2, 20mMCaCl2) was used to prepare nucleic acid aptamer solution, cDNA solution, ochratoxin A standard sample solutions of different concentrations, nuclease solution and small molecule fluorescent dye solution.
[0057] 100 μL of aptamer DNA solution and 100 μL of complementary strand cDNA solution (500 nM) were mixed in equal volumes, heated at 95°C for 5 minutes, slowly cooled to room temperature, and incubated at 37°C for 30 minutes. 100 μL of ochratoxin A solution of varying concentrations was added and mixed. The mixture was allowed to react at room temperature for 15 minutes. Then, 100 μL of 30 U of exonuclease Exo III (30 U / 100 μL) was added to each sample and incubated at 37°C for 30 minutes. Finally, 100 μL of 30 μM DSAI solution was added to each sample. The total volume was 500 μL. After equilibration at room temperature in the dark for 10 minutes, fluorescence was measured. The wavelength range was 450-650 nm, the excitation wavelength was 430 nm, the slit width was 5 nm, and the average of three scans was taken.
[0058] Example 2
[0059] 1. Sensitivity measurement
[0060] Ochratoxin A solutions of varying concentrations were prepared using 10 mM Tris buffer (pH 8.0, 120 mM NaCl, 5 mM KCl, 20 mM MgCl₂, 20 mM CaCl₂) to prepare ochratoxin A solutions at concentrations of 0, 25, 50, 100, 250, 500, 1000, 2500, and 5000 ng / mL. The detection method was the same as in Example 1.
[0061] According to the fluorescence spectrum curves corresponding to different concentrations of ochratoxin A solution ( Figure 3 A in the figure), select the fluorescence intensity value corresponding to the wavelength of 522nm, use the logarithm of the concentration of ochratoxin A as the horizontal axis and the fluorescence intensity value corresponding to 522nm as the vertical axis to make a standard curve ( Figure 3 B), the analysis showed that the system had a good fluorescence response to ochratoxin A within the range of 5-200 ng / mL, with a good linear relationship, and the regression equation was y=95.3339x
[0062] +3.3718, the correlation coefficient is R 2 =0.9919. Based on the 3σ / slope calculation rule, the detection limit of this method was calculated to be 1.37 ng / mL.
[0063] 2. Specificity determination
[0064] Specificity studies were conducted using ochratoxin A structural analogs ochratoxin B (OTB) and warfarin, as well as two other mycotoxins, aflatoxin B1 (AFB1) and zearalenone (ZEA), as detection targets in place of ochratoxin A. The concentrations of the two structural analogs and other mycotoxins added were 10 times that of ochratoxin A, and the detection method was the same as in Example 1. The fluorescence intensity values of the two structural analogs and two mycotoxins at 522 nm showed no significant difference compared to a blank sample without any target added. This indicates that the nucleic acid aptamer does not recognize structural analogs and mycotoxins other than ochratoxin A, demonstrating good specificity.
[0065] 3. Sample addition and recovery
[0066] Negative red wine samples were diluted 50-fold with Tris buffer, and different concentrations of ochratoxin A standards were added to achieve final ochratoxin A concentrations of 5 ng / mL, 10 ng / mL, 20 ng / mL, 50 ng / mL, and 100 ng / mL, respectively. The recovery rates of the standards were determined using the method provided in Example 1, with the final recovery rates ranging from 92.1% to 108.6%. This demonstrates that the aptamer biosensor and detection method provided by the present invention can be used for the determination of actual samples.
[0067] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.
Claims
1. An aptamer biosensor for determining ochratoxin A based on aggregation-induced emission effect, characterized in that: The aptamer biosensor comprises: a nucleic acid aptamer that specifically recognizes and binds to ochratoxin A, cDNA complementary to the nucleic acid aptamer, a nuclease exonuclease, and a small molecule fluorescent dye with aggregation-induced luminescence effect.
2. The aptamer biosensor according to claim 1, wherein The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.
1.
3. The aptamer biosensor according to claim 1, wherein The small molecule dye is 4,4'-(1E,1'E)-2,2'-(anthracene-9,10-diyl)bis(ethylene-2,1-diyl)bis(N,N-dimethylaniline) or DSAI.
4. The aptamer biosensor according to claim 1, wherein The nucleotide sequence of the cDNA is shown in SEQ ID NO.
3.
5. The method for constructing the aptamer biosensor according to claim 1, characterized in that: The following steps are involved: Prepare nucleic acid aptamer solution, cDNA solution, ochratoxin A standard sample solution of different concentrations, exonuclease solution and small molecule fluorescent dye solution; The nucleic acid aptamer solution and the cDNA solution are evenly mixed, and the ochratoxin A standard sample solutions of different concentrations, the exonuclease solution and the small molecule fluorescent dye solution are sequentially added to obtain the aptamer biosensor.
6. Use of the aptamer biosensor according to any one of claims 1 to 4 in detecting ochratoxin A.
7. A method for detecting ochratoxin A based on the aptamer biosensor according to any one of claims 1 to 4, characterized in that: The following steps are involved: Prepare nucleic acid aptamer solution, cDNA solution, ochratoxin A standard sample solution of different concentrations, exonuclease solution and small molecule fluorescent dye solution; The aptamer solution and the cDNA solution are uniformly mixed, and the ochratoxin A standard sample solutions of different concentrations, the exonuclease solution, and the small molecule fluorescent dye solution are sequentially added thereto, and a fluorescence test is performed to establish a standard curve according to the fluorescence intensities corresponding to the ochratoxin A standard sample solutions of different concentrations; According to the obtained standard curve, ochratoxin A in the sample to be tested is detected to obtain the content of ochratoxin A in the sample to be tested.
8. The method according to claim 7, characterized in that The volume ratio of the aptamer solution, the cDNA solution, the ochratoxin A standard sample solutions of different concentrations, and the small molecule fluorescent dye solution is 1:1:1:1; The concentration of the nucleic acid aptamer in the nucleic acid aptamer solution is 500 nM; the concentration of the cDNA in the cDNA solution is 500 nM; the amount of the exonuclease added is 30 U; and the concentration of the small molecule fluorescent dye in the small molecule fluorescent dye solution is 30 μM.
9. The method according to claim 7, characterized in that The scanning wavelength of the fluorescence test is 450-650 nm, the excitation wavelength is 430 nm, the slit width is 5 nm, and the number of scans is 3.
10. Use of the aptamer biosensor according to any one of claims 1 to 4 or the method according to any one of claims 7 to 9 in detecting ochratoxin A in food and / or food raw materials.