Aptamer specifically combined with beta-lactoglobulin and application thereof

Abstract

The invention relates to an aptamer specifically combined with beta-lactoglobulin and application of the aptamer, and belongs to the technical field of biological detection. According to the aptamer and the preparation method thereof, a binding domain base, participating in recognition, of the aptamer is predicted through molecular docking firstly, then the binding domain base is subjected to directional mutation, the aptamer with the recognition performance improved is obtained, the affinity of the aptamer to beta-lactoglobulin is 10.6 nM, and the aptamer has no recognition capacity on alpha-lactalbumin, casein, bovine serum albumin, immune globulin G, lactose and the like and can be used for preparing the aptamer with the recognition performance improved. Therefore, the aptamer disclosed by the invention has good sensitivity and specificity on the beta-lactoglobulin. On the basis, a fluorescence polarization method is directly constructed by utilizing the characteristic that the beta-lactoglobulin is a biomacromolecule, when the beta-lactoglobulin exists, an aptamer marked by a fluorophore FAM recognizes the beta-lactoglobulin to form an aptamer beta-lactoglobulin compound, and the fluorescence polarization value is relatively large, so that the beta-lactoglobulin compound can be used for identifying the beta-lactoglobulin. Therefore, the specific detection of the low-concentration beta-lactoglobulin is realized.

Description

Technical Field

[0001] This invention relates to the field of biodetection technology, and in particular to an aptamer that specifically binds to β-lactoglobulin and its applications. Background Technology

[0002] Milk contains a variety of essential amino acids and minerals, making it highly nutritious and often hailed as a "near-perfect food," thus enjoying widespread consumer popularity. However, milk is one of the eight most common allergenic foods. Studies show that over 80% of milk allergy cases are triggered by β-lactoglobulin, which is therefore considered the most critical allergen in milk and can serve as a marker for assessing milk's allergenicity. Accurate detection of β-lactoglobulin not only helps manufacturers determine the allergenic risk of their foods but also provides safe dietary guidelines for people with milk allergies.

[0003] Currently, common detection methods for the food allergen β-lactoglobulin mainly include immunoassays, molecular biology methods, and mass spectrometry. Enzyme-linked immunosorbent assay (ELISA) has good sensitivity and specificity, making it suitable for high-throughput screening; however, its performance depends on antibody quality, antibody preparation is complex, stability is limited, and it is difficult to chemically modify. Molecular biology techniques such as PCR identify proteins by detecting coding genes, offering high sensitivity, but they are indirect detection methods, prone to false negatives due to DNA degradation during processing, and cannot reflect the actual protein content. Liquid chromatography-tandem mass spectrometry (LC-MS / MS) performs qualitative and quantitative analysis based on characteristic peptides, offering high accuracy and specificity; however, it has stringent requirements for equipment, operators, and pretreatment procedures, and is costly, hindering widespread adoption.

[0004] Aptamers are single-stranded nucleic acid molecules (DNA or RNA) obtained through in vitro screening techniques, capable of binding with high specificity to specific target molecules (such as proteins, small molecules, metal ions, etc.). They possess antibody-like recognition functions but offer advantages such as better stability, ease of synthesis and modification, thus showing broad application prospects in fields such as biosensing, disease diagnosis, drug delivery, and targeted therapy. Current aptamers cannot simultaneously achieve high sensitivity and high specificity, exhibiting insufficient detection capability for β-lactoglobulin, necessitating the search for new aptamers. Summary of the Invention

[0005] Therefore, the technical problem to be solved by the present invention is to overcome the lack of an aptamer with high affinity and high specificity for β-lactoglobulin in the prior art.

[0006] To address the aforementioned technical problems, this invention provides an aptamer that specifically binds to β-lactoglobulin and its applications. This invention first uses molecular docking to predict the binding domain bases involved in aptamer recognition, then directionally mutates these binding domain bases to obtain an aptamer with improved recognition performance. The aptamer of this invention has an affinity of 10.6 nM for β-lactoglobulin and exhibits no recognition ability for α-lactalbumin, casein, bovine serum albumin, immunoglobulin G, lactose, etc. Therefore, the aptamer of this invention possesses good sensitivity and specificity for β-lactoglobulin. Based on this, we utilize the characteristic of β-lactoglobulin itself as a biological macromolecule to directly construct a fluorescence polarization method. In the absence of β-lactoglobulin, the FAM-labeled aptamer is free in solution with a low fluorescence polarization value; when β-lactoglobulin is present, the FAM-labeled aptamer recognizes β-lactoglobulin to form an aptamer-β-lactoglobulin complex with a high fluorescence polarization value, thereby achieving specific detection of low concentrations of β-lactoglobulin.

[0007] The first object of the present invention is to provide an aptamer that specifically binds to β-lactoglobulin, the sequence of which is shown in SEQ ID NO.1.

[0008] Furthermore, SEQ ID NO.1:

[0009] AGCGGTTCGGAACGAACGGCTAGCTATGCGGCGTACCTATGCGTGCTACCG.

[0010] A second objective of this invention is to provide an application of the above-mentioned aptamer in the preparation of β-lactoglobulin detection products.

[0011] A third objective of this invention is to provide a detection product for β-lactoglobulin, the detection product comprising the aforementioned aptamer.

[0012] Furthermore, the aptamer is modified with modifiers.

[0013] Furthermore, the modifier includes one or more of the following: fluorescent groups, isotopes, electrochemical markers, enzyme markers, affinity ligands, and thiol groups.

[0014] A fourth objective of this invention is to provide the application of the above-mentioned aptamer or detection product in the preparation of β-lactoglobulin capture products.

[0015] The fifth objective of this invention is to provide a method for detecting β-lactoglobulin, the method comprising the following steps:

[0016] S1. Label the aptamer with a fluorescent group to obtain a fluorescently labeled aptamer. Co-incubate the fluorescently labeled aptamer with different concentrations of β-lactoglobulin and detect the fluorescence polarization value to establish a standard curve of β-lactoglobulin concentration versus fluorescence polarization value.

[0017] S2. Perform the operation in S1 on the sample to be tested, detect the fluorescence polarization value, and calculate the concentration of β-lactoglobulin in the sample to be tested based on the standard curve in S1.

[0018] Furthermore, the fluorescent group includes 5-carboxyfluorescein.

[0019] A sixth object of the present invention is to provide an application of the above-described aptamer in the preparation of products containing isolated and enriched β-lactoglobulin.

[0020] A seventh object of the present invention is to provide a composition for detecting β-lactoglobulin, the composition comprising the aptamer described above.

[0021] The beneficial effects of this invention are:

[0022] The aptamer of this invention has a linear structure and exhibits good affinity and specificity for β-lactoglobulin. Specifically, the aptamer of this invention has an affinity of 10.6 nM for β-lactoglobulin and shows no recognition ability for α-lactalbumin, casein, bovine serum albumin, immunoglobulin G, lactose, lactoferrin, etc. Therefore, the aptamer of this invention has good sensitivity and specificity for β-lactoglobulin and has broad application prospects in the detection of β-lactoglobulin. Attached Figure Description

[0023] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings.

[0024] Figure 1 It is based on the primitive aptamer T4M8, which is predicted by molecular docking, to recognize the binding domain bases of β-lactoglobulin;

[0025] Figure 2 The binding saturation curves of the original aptamer T4M8 and the mutated aptamer MG4 recognizing β-lactoglobulin are shown.

[0026] Figure 3 It is the secondary structure of the original aptamer T4M8 and the mutant aptamer MG4 fitted by Mfold;

[0027] Figure 4 It is specific to the mutant aptamer MG4;

[0028] Figure 5 This is a schematic diagram illustrating the principle of fluorescence polarization detection of β-lactoglobulin.

[0029] Figure 6 This is a standard curve for the detection of β-lactoglobulin. Detailed Implementation

[0030] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0031] 1. Synthesis of aptamers

[0032] FAM-labeled aptamers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0033] 2. Flowchart for directional mutation of aptamer sequences of binding domains predicted by molecular docking

[0034] After docking of aptamer T4M8 with β-lactoglobulin, it was found that the bases C4, G5, G19, C20, T21, A22, G30, G31, T34, and G41 are the binding domain bases for aptamer recognition of β-lactoglobulin. These bases are located in the stem and loop regions of the secondary structure of T4M8, respectively. Since the secondary structure of the aptamer plays an important role in maintaining the conformational stability of the aptamer, the bases in the stem of the aptamer still maintain complementary pairing during mutation. For example, the C4 base is complementary to the G18 base, and the combination when the C4 base is mutated is G5-C18, T5-A18, or A5-T18. The bases in the loop are randomly mutated. For example, the T34 base is located in the loop region of the secondary structure, and the change in mutation is A34, G34, or C34. There are 10 binding domain bases in total. Mutating according to the above principles resulted in 30 mutant sequences. Affinity experiments verified the sequence’s affinity for β-lactoglobulin and its ability to recognize analogs or coexisting substances.

[0035] 3. Characterization of aptamer sequences

[0036] (1) Aptamer affinity analysis

[0037] Affinity was measured using a fluorescence method. The synthesized sequence was diluted with TE buffer to prepare a 10 μM solution, which was stored at -20 °C as a stock solution. Aptamers and 1×SG dye were denatured at 95 °C for 10 min, followed by incubation at room temperature for 60 min to form a stable secondary structure. Subsequently, aptamers at different final concentrations (25, 50, 100, 150, 200, 300 nmol / L) and β-lactoglobulin at a fixed final concentration (10 μg / mL) were co-incubated in binding buffer at room temperature in the dark for 60 min to promote complete binding. 150 μL of the reaction solution was added to the wells of an ELISA plate to detect fluorescence intensity, with samples without added β-lactoglobulin serving as controls. Each experiment was independently repeated three times. Binding affinity was assessed by the difference in sample fluorescence, and the dissociation constant (Kd) was calculated and saturation binding curves were plotted using GraphPad Prism5 software.

[0038] (2) Aptamer specificity analysis

[0039] After incubating the aptamer solution with a final concentration of 100 nmol / L with SG, other possible interfering substances (10 μg / mL, namely α-lactalbumin, casein, bovine serum albumin, immunoglobulin G, lactoferrin and lactose) were added to the solution. The solution was then incubated in aptamer binding buffer at room temperature for 60 min. Finally, 150 μL of the solution was taken out and placed in an ELISA plate to measure the fluorescence value.

[0040] 4. Detection of β-lactoglobulin based on fluorescence polarization method

[0041] (1) Construction of the detection system

[0042] In the detection system, the concentration of the aptamer labeled with the fluorescent group FAM was 10 nmol / L. Then, different concentrations of β-lactoglobulin were added, and the mixture was incubated in aptamer binding buffer for 60 min. Finally, 200 μL of the solution was taken out and the fluorescence polarization value of the solution was measured on a microplate reader.

[0043] (2) Actual sample testing

[0044] Infant amino acid formula milk powder was used as the actual sample for spiked recovery determination. The infant amino acid formula powder was dissolved in PBS buffer (formula powder: buffer = 1:6), thoroughly mixed, diluted 100-fold, and filtered to obtain the filtrate, which was then used for reprocessing. β-lactoglobulin was added to the filtrate at final concentrations of 50, 100, and 200 μg / mL, respectively, and the recovery rate of β-lactoglobulin in the samples was determined using fluorescence polarization assay.

[0045] Example 1: Directed Mutation of the Primitive Aptamer T4M8

[0046] The binding domains of the primitive aptamer T4M8 to β-lactoglobulin are located in the loop and stem regions of its three-dimensional structure, respectively, as... Figure 1 As shown, the 10 bases within the red box are binding domain bases. To maintain the stability of the secondary structure, the stem bases retain complementary pairing during mutations: the mutation of the C4 base is G4-C18, A4-T18, and T4-A18; the mutation of the G5 base is C5-G17, A5-T17, and T5-A17; the mutation of the G19 base is C19-G3, A19-T3, and T19-A3; the mutation of the C20 base is G20-C2, A20-T2, and T20-A2; and the mutation of the T21 base is... The mutations are A21-T1, C21-G1, and G21-C1; the mutations of the A22 bases are T22, C22, and G22; the mutations of the G30 bases are C30-G50, A30-T50, and T30-A50; the mutations of the G31 bases are C31-G49, A31-T39, and T39-A39; the mutations of the T34 bases are A34, G34, and C34; and the mutations of the G41 bases are C41, A41, and T41.

[0047] The affinities of the 30 sequences obtained are shown in Table 1. Affinity tests revealed that the G4-C18 base combination formed by mutating the C4 base to G4 in the original aptamer T4M8 sequence showed a 2-fold increase in affinity compared to the original aptamer, with a dissociation constant (Kd) of 10.6 nM, making it the optimal sequence obtained through mutation. Sequences MC5, MA5, and MG20 all exhibited better affinity than the original T4M8 sequence. These bases are all located in the stem region of the original T4M8 sequence, indicating that the bases in the stem region are auxiliary or structural support regions in the aptamer's recognition of β-lactoglobulin. The sequences formed by the mutations of T34 and G41 bases both lost their ability to recognize β-lactoglobulin, indicating that the loop bases they occupy are the core region for β-lactoglobulin recognition. Detailed base compositions of each sequence are shown in Table 2, and the secondary structures of the original T4M8 sequence and the optimal mutation sequence MG4 are shown in Table 2. Figure 3 The specificity of MG4 recognition of the optimal mutation sequence is shown in [link to relevant documentation]. Figure 4 .

[0048] Table 1. Affinity testing of aptamers obtained from different mutations.

[0049]

[0050] Table 2 Sequence information of different aptamers

[0051]

[0052] Example 2: Detection of β-lactoglobulin

[0053] The detection principle diagram is as follows Figure 5As shown, the detection system includes an aptamer labeled with the fluorescent group FAM and the target β-lactoglobulin. Because the FAM-labeled aptamer is in a free state, it rotates rapidly, resulting in a lower fluorescence polarization value. However, when the target β-lactoglobulin is present, the aptamer specifically recognizes β-lactoglobulin to form an aptamer-β-lactoglobulin complex. The larger molecular weight of the complex results in a slower spin, leading to a higher fluorescence polarization value. A standard curve for β-lactoglobulin fluorescence polarization detection was plotted based on the fluorescence polarization value and the concentration of β-lactoglobulin. (See [reference needed]). Figure 6 .

[0054] Example 3: Detection of β-lactoglobulin in real samples

[0055] After pretreatment, β-lactoglobulin was added to the filtrate at final concentrations of 50, 100, and 200 μg / mL, respectively. The recovery rate of β-lactoglobulin in the actual samples was determined by fluorescence polarization method, and the results are shown in Table 3.

[0056] Table 3. Detection and Spiked Recovery Rate of β-Lactoglobulin in Infant Amino Acid Formula Milk Powder

[0057]

[0058] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. An aptamer that specifically binds to beta-lactoglobulin, characterized in that, The sequence of the aptamer is shown as SEQ ID NO.

1.

2. Use of the aptamer of claim 1 in the preparation of a beta-lactoglobulin detection product.

3. A product for detecting β-lactoglobulin, characterized by, The detection product comprises the aptamer of claim 1.

4. The test product according to claim 3, characterized in that The aptamer is modified with a modifier.

5. The detection product according to claim 4, characterized in that, The modifier is selected from one or more of a fluorescent group, an isotope, an electrochemical label, an enzyme label, an affinity ligand, and a thiol group.

6. Use of the aptamer of claim 1 or the detection product of any one of claims 3-5 in the preparation of a beta-lactoglobulin capture product.

7. A method for detecting beta-lactoglobulin, characterized by, The detection method comprises the following steps: S1, labeling the aptamer of claim 1 with a fluorescent group to obtain a fluorescently labeled aptamer, co-incubating the fluorescently labeled aptamer with different concentrations of beta-lactoglobulin, and detecting the fluorescence polarization value to establish a standard curve of beta-lactoglobulin concentration and fluorescence polarization value; S2, detecting the fluorescence polarization value of the sample to be tested according to the operation of S1, and calculating the concentration of beta-lactoglobulin in the sample to be tested according to the standard curve in S1.

8. The detection method according to claim 7, characterized in that, The fluorescent group is 5-carboxyfluorescein.

9. Use of the aptamer of claim 1 in the preparation of a beta-lactoglobulin separation and enrichment product.

10. A composition for detecting beta-lactoglobulin, characterized by, The composition contains the aptamer of claim 1.

Images