Oligonucleotide aptamer M8 for high-specificity recognition of ergosterol and verification of oligonucleotide aptamer M8

Abstract

The invention discloses an oligonucleotide aptamer M8 for high-specificity recognition of ergosterol and verification of the oligonucleotide aptamer M8, and belongs to the field of molecular biomedicine. The nucleotide sequence of the oligonucleotide aptamer M8 is as shown in SEQ ID NO. 1. The method comprises the following steps: screening random nucleotides by using an ergosterol solution, continuously replacing a reverse screening target, finally screening to obtain a plurality of oligonucleotide aptamer sequences, sequencing, carrying out sequence alignment, constructing a family tree according to homology, determining four oligonucleotide aptamer sequences, and carrying out specificity and affinity verification. The result shows that the oligonucleotide aptamer M58 has strong affinity and high specificity to the ergosterol, and the affinity and the specificity of the oligonucleotide aptamer M58 to the ergosterol are verified by the oligonucleotide aptamer M8 obtained by truncation. The invention can be used for early diagnosis of ergosterol fungal infection.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biomedicine, and particularly relates to an oligonucleotide aptamer M8 for highly specific recognition of ergosterol and its verification. Background Art

[0002] Approximately 3 million fungal species exist widely in nature, with over 120,000 currently recognized, including approximately 400 species associated with human infections. Globally, approximately 3 million people develop chronic, severe fungal infections each year, nearly 1.9 million of whom develop acute invasive fungal infections. Fungal infections claim at least 1.6 million lives annually, a number comparable to the deaths from malaria and tuberculosis. Invasive fungal infections are serious infections caused by fungi that invade the bloodstream, organs, or spread throughout the body. Therefore, timely detection of fungal infections is crucial for improving patient survival. Ergosterol, a characteristic steroid of fungi, is the most abundant naturally occurring lipid in fungal cell membranes and a key component of the membrane. It plays a crucial role in maintaining membrane structural integrity, membrane permeability, cargo transport, and cell viability. Based on the assumption that ergosterol is rapidly degraded upon fungal death, it is often used as a biomarker for measuring viable fungal biomass. Currently, the main methods for detecting ergosterol include ultraviolet spectrophotometry, thin-layer chromatography scanning, high-performance liquid chromatography, gas chromatography, high-performance liquid chromatography-tandem mass spectrometry, and quantitative nuclear magnetic resonance. The above detection methods are time-consuming and costly. Therefore, it is of great significance to develop a low-cost and easy-to-operate method to detect ergosterol.

[0003] Aptamers are a class of short DNA or RNA oligonucleotides that evolved from SELEX (Systematic Evolution of Ligands by Exponential Enrichment). They recognize target molecules such as small molecules, proteins, and ions by forming unique structures such as stems, loops, hairpins, bulges, pseudoknots, and G-quadruplexes. As a new type of recognition element, aptamers possess high affinity and selectivity for their targets. Unlike antibodies, they offer unique advantages such as simple preparation, ease of modification, and high stability. Therefore, they are widely used in research areas such as early disease diagnosis, cell recognition, and targeted drug delivery.

[0004] Methods for screening small molecule aptamers typically include graphene oxide-SELEX (GO-SELEX) and capillary electrophoresis-SELEX (CE-SELEX). GO-SELEX is based on the nonspecific adsorption of ssDNA by graphene oxide, with shorter ssDNA chains exhibiting greater adsorption. Upon binding to the target molecule, ssDNA undergoes conformational changes, resulting in a relatively weaker adsorption capacity to GO. GO-SELEX does not require library or target immobilization, and aptamer-target binding occurs in a homogeneous phase. This eliminates the need to consider factors such as structural changes caused by immobilization that may affect binding. However, research on the biological effects and safety of graphene oxide is still limited. If applied to organisms, questions remain regarding whether it will bind to biomacromolecules such as DNA and affect normal physiological functions. Capillary electrophoresis (SELEX) can separate substances with different migration efficiencies directly in solution using the efficient separation capabilities of capillary electrophoresis. Free nucleic acids and nucleic acid-target complexes in the reaction system have different migration capabilities, and capillary electrophoresis (CE)-SELEX technology allows for rapid separation, thereby improving the efficiency of SELEX screening. However, this screening method places high demands on screening equipment and is not suitable for basic laboratory research. Ergosterol is a lipid-soluble small molecule with few characteristic functional groups, so selecting a suitable nucleic acid aptamer screening method for ergosterol is crucial. Summary of the Invention

[0005] To address the above issues, the present invention provides a screening method for an immobilized library. This study is based on the Capture-SELEX technology. Streptavidin agarose magnetic microspheres are used to immobilize complementary chains of a random library with biotin. The complementary chains are hybridized with nucleic acids from the random library to screen aptamers for ergosterol from the immobilized nucleic acid library. To improve the specificity of the aptamer, two counter-screening targets, vitamin D2 and cholesterol, are introduced. Positive and counter-screening are performed alternately. qPCR verification reveals the aptamer M58 with high affinity and specificity for ergosterol. To improve the conformational stability of the aptamer, M58 is truncated to obtain M8. SYBR Green II dye assay verifies that M8 has high affinity and specificity for ergosterol.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions: An oligonucleotide aptamer M8 for highly specific recognition of ergosterol, characterized in that the nucleic acid sequence of the oligonucleotide M8 is as shown in SEQ ID NO.1.

[0007] The oligonucleotide aptamer M8 for highly specific recognition of ergosterol is characterized in that the derivative of the oligonucleotide aptamer M8 includes one or more compounds selected from the group consisting of biotin, digoxigenin, fluorescent substances / nanoluminescent materials, and enzyme labels bound to the 5' or 3' end of the oligonucleotide aptamer M8, and the chemical modification preferably includes phosphate backbone modification, truncation, extension, or transversion.

[0008] The oligonucleotide aptamer M8 for highly specific recognition of ergosterol is characterized in that the oligonucleotide aptamer M8 is prepared by a molecular biology method, and the molecular biology method is preferably in vitro chemical synthesis and PCR.

[0009] The oligonucleotide aptamer M8 for highly specific recognition of ergosterol is characterized in that the sequence of the oligonucleotide aptamer M8 further includes one of the following three sequences: ( = 1 \* roman i) an oligonucleotide sequence having a homology of more than 80% with the oligonucleotide aptamer M8; ( = 2 \* roman ii) sequence that hybridizes with the oligonucleotide adaptor M8; ( = 3 \* roman iii) The RNA sequence transcribed by the oligonucleotide adaptor M8.

[0010] Any of the above methods for screening an oligonucleotide aptamer M8 that recognizes ergosterol with high specificity is characterized by utilizing subtractive SELEX technology, using ergosterol as a positive screening target and cholesterol and vitamin D2 as counter-screening targets, and screening an oligonucleotide aptamer M58 that specifically binds to ergosterol from a random library through repeated incubation, elution, and amplification, obtaining the oligonucleotide aptamer M8 by truncation and verifying it using the SYBR Green II dye method.

[0011] Use of any of the oligonucleotide aptamers M8 in specifically recognizing ergosterol.

[0012] The application is characterized in that probe molecules are used for identification during the process of specifically identifying ergosterol.

[0013] Application of any one of the oligonucleotide aptamers M8 in the clinical diagnosis of fungal infection.

[0014] An antifungal drug, characterized in that the active ingredient of the antifungal drug comprises any one of the oligonucleotide aptamers M8.

[0015] A kit comprising any one of the oligonucleotide adaptors M8.

[0016] The present invention uses an ergosterol solution to screen random nucleotides, with the counter-screening target continuously changed. Multiple oligonucleotide aptamer sequences are ultimately screened and obtained. Sequence alignment is performed after sequencing, and a family tree is constructed based on homology. Four oligonucleotide aptamer sequences are identified for specificity and affinity verification. The results show that oligonucleotide aptamer M58 has a strong affinity and high specificity for ergosterol. By truncating the oligonucleotide aptamer M8, its affinity and specificity for ergosterol are verified. The present invention can be used for the early diagnosis of ergosterol fungal infections.

[0017] Compared with the existing technology, this study has the following beneficial effects: 1. The oligonucleotide aptamer M8 screened by the present invention is a sensitive molecular recognition element with stable properties, non-toxicity, easy synthesis and low production cost.

[0018] 2. The oligonucleotide aptamer M8 screened by the present invention can specifically recognize ergosterol. Therefore, the M8 sequence has certain application value in the clinical diagnosis of ergosterol fungal infections and related fields. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Binding ratio monitoring graph for oligonucleotide aptamer screening Figure 2 To verify the specificity of candidate oligonucleotide aptamers M1, M3, M58, and M103 binding to ergosterol by qPCR; Figure 3 is the Kd dissociation constant of the binding of oligonucleotide aptamer M58 to ergosterol; Figure 4 The affinity of oligonucleotide aptamer M8 to ergosterol was verified by SYBR Green II dye method.

[0020] Figure 5 The specificity of oligonucleotide aptamer M8 and ergosterol was verified by SYBR Green II dye method. DETAILED DESCRIPTION

[0021] Unless otherwise specified, all reagents used in the present invention are purchased by those skilled in the art. The present invention will be further described below by examples and accompanying drawings. The same reference numerals in the accompanying drawings represent elements with the same or similar functions. Although various aspects of the embodiments are shown in the accompanying drawings, the drawings need not be drawn to scale unless otherwise specified.

[0022] Example 1 Preparation of oligonucleotide aptamer M58 (1) Construction of initial oligonucleotide library: 5'- CTATAGCAATGGGTACGGTACTTCC - (40N) - CAAAAGTGCACGCTACTTTGCTAA - 3' Wherein N represents any base among A, T, C, and G. The fixed sequence of the oligonucleotide library is the PCR amplification primer binding region, with a random sequence of 40 bases in the middle.

[0023] (2) Preparation of ergosterol solution: Dissolve 0.024 g of ergosterol powder in 30 mL of anhydrous ethanol to a concentration of 0.002 M, and dilute it to 0.2 μM with DEPC water.

[0024] (3) Preparation of vitamin D2 and cholesterol solution: The preparation method of vitamin D2 and cholesterol solution is the same as that of ergosterol solution.

[0025] (4) Library processing: Dissolve the oligonucleotide library in step (1) in sterile water, denature at 95°C for 5 min, ice bath for 5 min, and room temperature for 5 min to allow the ssDNA to form a specific tertiary structure.

[0026] (5) Preparation of streptavidin (SA) magnetic beads: Wash 100 mg of agarose carboxyl magnetic beads three times with 1 mL of MES solution, add EDC first, then add NHS and mix well, incubate at room temperature for 30 min, discard the supernatant, wash the magnetic beads three times with MES solution, add 500 μL of 0.1 mg / mL SA solution, and incubate at 37°C for 30 min.

[0027] (6) Fixation of random ssDNA library: Design a complementary chain P4 that is complementary to the primer region of the random ssDNA library and label it with biotin. Add 5 pmol of ssDNA library and P4 at a molar ratio of 1:2 to 350 μL binding buffer (BB) (0.05 mM HEPES, 0.1 mM NaCl, 0.001 mM MgCl2, 0.02 mM KCl, 0.001 mM CaCl2) and mix well. Perform slow denaturation in a PCR instrument (95 ℃ 10 min, 60 ℃ 1 min, 25 ℃ 1 min, cooling rate 0.1 ℃ / s). After complementation, the ssDNA library-P4 complex is incubated with SA magnetic beads and reacted at 37 ℃, 130 r / min for 1 h. Discard the supernatant to obtain ssDNA library magnetic beads. Wash with BB buffer three times to remove ssDNA not bound to the magnetic beads.

[0028] (7) Counter-screening: Add 250 μL of 0.2 μM vitamin D2 solution and 250 μL of 0.2 μM cholesterol solution to the random library magnetic beads and incubate with rotation at 37°C for 1 h. Retain the magnetic beads and wash them once with 1 mL of BB buffer solution.

[0029] (8) Positive screening: Add 500 μL of 0.2 μM ergosterol solution to the random library magnetic beads after reverse screening, incubate with rotation at 37°C for 1 hour, and monitor the nucleic acid content in the supernatant by qPCR.

[0030] (9) Preparation of secondary library by streptavidin magnetic bead method: The library bound to the positive screening target is amplified by PCR. The downstream primer carries biotin, so the complementary chain of the library is labeled with biotin. The PCR amplification product is incubated with streptavidin magnetic beads at 37 °C for 30 min, the supernatant is discarded, 1 mL of 5% formamide is added and the mixture is incubated in a 40 °C water bath for 5 min, 250 μL of 0.1 M NaOH solution is added, and the mixture is denatured at 95 °C for 5 min, ice bathed for 5 min, neutralized with 0.1 M HCl, and the supernatant is collected. This is the prepared secondary library for the next round of screening.

[0031] (10) Repeat the screening process of steps (5) to (8) using the secondary library prepared in step (9) for a total of 8 rounds of screening. Among them, the first 5 rounds were only positive screening, and the remaining 3 rounds were all reverse screening followed by positive screening. The screening PCR monitoring results are as follows Figure 1 As shown, the first five rounds of screening enriched the library for nucleic acid sequences that bound to the positive screen target. The binding ratio reached its maximum in the fourth round of screening. The products from the fourth round were used to prepare a secondary library, which was then subjected to counter-screening, resulting in a decrease in the binding ratio. Three more rounds of screening were performed, maintaining the binding ratio. High-throughput sequencing of the oligonucleotide libraries from the fourth and eighth rounds yielded the oligonucleotide aptamer M58.

[0032] Example 2 Verification of the specificity of oligonucleotide aptamer M58 and ergosterol solution by qPCR A fixed concentration of oligonucleotide aptamer M58 was prepared, and three identical random library magnetic beads were prepared according to the method described in Example 1. Equal amounts of ergosterol solution, vitamin D2 solution, and cholesterol solution were added, respectively, and incubated at room temperature for 1 h. The supernatant was collected and monitored by qPCR. The Ct value was used as the monitoring indicator. The results are shown in FIG. Figure 3 As shown, the oligonucleotide aptamer M58 has strong specificity for ergosterol solution.

[0033] Example 3 Detection of the binding ability of oligonucleotide aptamer M58 with ergosterol solution by qPCR The oligonucleotide aptamer M58 with different concentration gradients was prepared in equal volumes and incubated with ergosterol solution at room temperature for 1 h under rotation according to the method described in Example 1. The supernatant was collected and monitored by qPCR. The relative fluorescence intensity RFU (1 / Ct×10 3 ) as monitoring indicators, the results are as follows Figure 2 As shown, the equilibrium dissociation constant (Kd) between the oligonucleotide aptamer M58 and ergosterol solution was 20.36±2.813 nM.

[0034] Example 4: Truncation of oligonucleotide aptamer M58 to obtain M8 by computer simulation technology The ergosterol-binding domain in M58 is retained, and the redundant bases are trimmed to obtain the M8 nucleic acid aptamer. The oligonucleotide sequence is shown in SEQ ID NO.1.

[0035] Example 5 Verification of the affinity of nucleic acid aptamer M8 by SYBR Green II Prepare seven 2 mL centrifuge tubes and add 70 μL of 1 μM aptamer and 5 μL of SYBR Green II (100x) to each tube. Incubate at room temperature in the dark for 15 minutes to allow for full binding of the aptamer and dye. Add the incubated aptamer-dye complex to the wells of a 96-well black microtiter plate. Add 5 μL of target solution at 0, 0.5, 1, 2, 3, 4, and 5 μM, respectively. Incubate the plate at 37°C in the dark for 30 minutes to allow for full binding of the aptamer and target. Fluorescence intensity at an excitation wavelength of 490 nm and an emission wavelength of 550 nm was used as monitoring indicators. The equilibrium dissociation constant (Kd) between the aptamer and target was verified to be 62.05 ± 0.1249 nM.

[0036] Example 6 Verification of the specificity of nucleic acid aptamer M8 by SYBR Green II Prepare four 2mL centrifuge tubes and add 70μL of 1μM aptamer and 5μL of SYBR Green II (100x) to each tube. Incubate at room temperature in the dark for 15 minutes to allow full binding of the aptamer and dye. Add the incubated aptamer-dye complex to the wells of a 96-well black microtiter plate. Add 5μL of DEPC water, 5μM ergosterol solution, 5μM vitamin D2 solution, and 5μM cholesterol solution, respectively. Incubate the microtiter plate at 37°C in the dark for 30 minutes to allow full binding of the aptamer and target. Verify the affinity of the aptamer and target using fluorescence intensity at an excitation wavelength of 490 nm and an emission wavelength of 550 nm.

[0037] SEQUENCE LISTING <1> DNA (artificial sequence) <2> Nucleotide aptamer M8 <3> ggttacgaaaacc.

Claims

1. An oligonucleotide aptamer M8, characterized in that The nucleic acid sequence of the oligonucleotide adaptor M8 is shown in SEQ ID NO.

1.

2. The oligonucleotide aptamer M8 according to claim 1, characterized in that The oligonucleotide aptamer M8 can specifically recognize ergosterol.

3. The oligonucleotide aptamer M8 according to claim 1, characterized in that The oligonucleotide aptamer M8 can be chemically synthesized in vitro, or prepared by PCR or other molecular biological methods.

4. The oligonucleotide aptamer M8 according to claim 1, characterized in that The oligonucleotide aptamer M8 can be modified by phosphate backbone, truncated, extended, transverted, or chemically modified by base, or biotin, digoxigenin, fluorescent substances, nano-luminescent materials or enzyme labels can be combined at the 5' end or 3' end of the oligonucleotide aptamer M8.

5. Application of oligonucleotide aptamer M8 in the preparation of fungal diagnostic reagents.

Images