Larimichthys crocea trypanosomosis lf-rpa rapid detection kit, method of use and application thereof

Through LF-RPA technology, combined with specific primers and probes, rapid, simple and highly sensitive detection of large yellow croaker trypanosomes was achieved, solving the problems of expensive equipment and complex operation in existing technologies, and is suitable for grassroots laboratories and breeding sites.

CN120425069BActive Publication Date: 2025-10-10ZHEJIANG OCEAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510921175.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-04
Publication Date
2025-10-10
Estimated Expiration
2045-07-04

AI Technical Summary

Technical Problem

The existing technology for detecting trypanosomes in large yellow croaker has problems such as expensive instruments and equipment, low detection efficiency, low sensitivity, low specificity and high operator requirements, making it difficult to achieve rapid and accurate on-site detection.

Method used

Recombinase polymerase amplification combined with lateral flow test strip (LF-RPA) technology is used to design specific primers and probes. The biotin-labeled amplification product is combined with the test strip detection line, and detection is achieved through a colorimetric reaction, which simplifies the operation process and reduces the technical requirements for equipment and personnel.

Benefits of technology

It achieves fast, simple, sensitive and specific trypanosome detection, reduces detection costs, is suitable for grassroots laboratories and breeding sites, and can detect as few as 50 copies of DNA, reducing false positive results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120425069B_ABST
    Figure CN120425069B_ABST
Patent Text Reader

Abstract

The application discloses a LF-RPA rapid detection kit for trypansomatosis of large yellow croaker, a use method and application thereof, and belongs to the technical field of gene detection.The application provides a LF-RPA rapid detection kit for trypansomatosis, which comprises a LF-RPA reaction system, freeze-dried powder, a buffer and a test strip.The LF-RPA reaction system comprises the following components in volume fractions: 30 parts of Rehydration buffer, 1-2.5 parts of an upstream primer, 1-2.5 parts of a downstream primer, 0.5-1 part of a probe, 2.5 parts of an L activator, 1-5 parts of a template, and sterilized ultrapure water is added to supplement the volume of the LF-RPA reaction system to 50 parts.The LF-RPA detection method of the kit is simple and convenient to operate, the test strip detection result is intuitive, and professional technical personnel are not needed;expensive PCR reaction instruments are not needed, so that the cost is reduced;the detection speed is fast;the sensitivity is high;and the specificity is good.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection, and in particular relates to a large yellow croaker trypanosomiasis RPA rapid detection kit, a use method and an application thereof. Background Art

[0002] Large yellow croaker ( Larimichthyscrocea ) is an important marine aquaculture fish in China and occupies an important position in the fishery economy. However, with the continuous expansion of aquaculture scale and changes in aquaculture environment, large yellow croaker is facing the threat of various diseases, among which trypanosome infection is one of the important factors affecting its health and aquaculture benefits. Trypanosoma Trypanosomes (spp.) are parasitic protozoa that can infect a variety of aquatic animals, including large yellow croaker. Large yellow croaker infected with trypanosomes can experience a range of symptoms, including loss of appetite, slowed growth, anemia, and decreased immunity. In severe cases, these infections can lead to fish death, causing significant economic losses to the large yellow croaker aquaculture industry. Accurate and rapid detection of trypanosomes in large yellow croaker is crucial for timely prevention and control measures, minimizing disease spread and economic losses.

[0003] Currently, traditional methods for detecting trypanosomes primarily include blood smear microscopy and conventional PCR testing. Blood smear microscopy is a relatively straightforward method, involving preparing a smear from fish blood, staining it, and then examining it under a microscope for the presence of trypanosomes. However, this method has limitations, including low sensitivity, which can easily miss samples with early or mild infection. The procedure is relatively cumbersome, requiring specialized personnel for smear preparation and microscopic observation, and the test results are significantly affected by human factors. While conventional PCR testing offers high sensitivity, it also presents several challenges. First, the PCR reaction requires specific temperature cycles, which relies on specialized PCR equipment, such as a PCR amplifier. The high cost of this equipment limits its application in primary laboratories and field testing. Second, the PCR process is complex, involving multiple steps, including DNA extraction, primer design, amplification reaction, and product detection. The overall testing cycle is lengthy, making it difficult to meet the needs of rapid diagnosis. Furthermore, PCR testing requires a high level of laboratory environment and operator skill, making it susceptible to contamination and false-positive results.

[0004] With the development of molecular biology techniques, some new detection techniques have been gradually applied in the field of aquatic animal disease detection. For example, the fluorescence quantitative PCR (qPCR) technology can monitor the PCR amplification process in real time by adding a fluorescent group to the PCR reaction system, has higher sensitivity and accuracy, and can be used for quantitative analysis. However, qPCR also requires expensive fluorescence quantitative PCR instruments, complex operation, and strict experimental conditions. For example, in the detection of P. novacula trypanosomes, specific primers and probes for 18S rDNA of trypanosomes were selected, such as the specific qPCR primers Q18S2-F and Q18S2-R. During the reaction, the fluorescence signal intensity increases continuously with the PCR amplification. By monitoring the change of fluorescence signal in real time, the target DNA in the sample is quantitatively analyzed using a standard curve. qPCR has the advantages of high sensitivity and accurate quantification, but it requires fluorescence quantitative PCR instruments, has high cost, and the experimental operation and data analysis are relatively complex, requiring high operating personnel.

[0005] In addition to the above two methods, some studies have tried to combine nucleic acid amplification technology with other detection methods to improve the convenience and accuracy of detection. For example, PCR amplification products are combined with lateral flow test strips (LFD), and specific markers (such as biotin) are added to the PCR primers, so that the amplification products can specifically bind to the probes on the test strip, and the detection results are determined by observing the color development of the test line and the control line on the test strip. However, these methods still have room for improvement in primer design, reaction condition optimization, and detection specificity and sensitivity, and have not yet formed a mature and efficient detection system.

[0006] In the detection of P. novacula trypanosomes, in addition to the LF-RPA technology mentioned above, there are other alternative solutions that can achieve the same detection purpose. For example, immunological analysis-based methods such as enzyme-linked immunosorbent assay (ELISA). This method uses the principle of specific binding of antigens and antibodies, and first prepares antibodies against specific antigens of trypanosomes, which are fixed on a solid carrier. When the sample containing the sample (P. novacula tissue extract) is added, if the sample contains trypanosome antigens, the antigens will bind to the fixed antibodies, and then the enzyme-labeled secondary antibody is added, and the result is determined by enzyme-catalyzed substrate color development. ELISA has high sensitivity and specificity, and can detect samples in batches. However, it requires high-quality antibodies, has high requirements for sample processing, and the detection results are easily affected by antibody quality and cross-reaction, and cannot directly detect nucleic acids.

[0007] The loop-mediated isothermal amplification (LAMP) method combined with lateral flow strips: LAMP technology can efficiently and rapidly amplify nucleic acids under isothermal conditions. Multiple sets of primers are designed for specific genes of trypanosomes. The reactions are carried out in a constant temperature device (e.g., 60-65°C). The strand displacement activity of BstDNA polymerase is utilized to amplify the DNA to form a product with a stem-loop structure. Combined with a lateral flow strip, the results can be observed visually. Its advantages are simple operation, rapid reaction, and low equipment requirements, making it potentially applicable in the field or in grassroots laboratories. However, primer design is relatively complex, making nonspecific amplification more likely. Moreover, the specificity of LAMP reaction products is sometimes inferior to that of PCR technology, which may lead to false-positive results.

[0008] Nucleic acid sequencing technology: High-throughput sequencing or Sanger sequencing is performed directly on genomic DNA extracted from large yellow croaker liver tissue. High-throughput sequencing can sequence a large number of DNA fragments simultaneously, enabling comprehensive detection of nucleic acid sequences from various pathogens in a sample. This not only detects known trypanosomes but also potentially identifies new pathogens or variants. Sanger sequencing precisely sequences specific target fragments, providing accurate and reliable results. However, nucleic acid sequencing is costly, requires specialized sequencing equipment and data analysis capabilities, and has a relatively long testing cycle, making it unsuitable for large-scale, rapid on-site testing. Summary of the Invention

[0009] In response to the shortcomings of the above-mentioned prior art, and to address the expensive instrumentation, low detection efficiency, low detection sensitivity, low specificity, and high operator requirements of existing detection methods, the purpose of the present invention is to design and provide a method for detecting trypanosomes in large yellow croaker using recombinase polymerase amplification combined with lateral flow test strips (LF-RPA). The LF-RPA experiment of the present invention is based on conventional RPA and utilizes biotin-labeled primers and FAM-labeled probes. When the RPA reaction occurs and the target sequence is present, the biotin-labeled amplification product binds to the streptavidin on the test line of the test strip, and the FAM-labeled probe binds to the target sequence. The result is displayed on the test strip through a colorimetric reaction, enabling convenient on-site detection. Throughout the entire detection process, each experimental step is closely linked, from sample processing and reaction setup to result determination, one link after another, ensuring high efficiency.

[0010] In order to achieve the above object, the present invention adopts the following technical solutions:

[0011] On the one hand, the present invention provides a trypanosome detection primer set, which includes an upstream primer nucleic acid sequence as shown in SEQ ID NO.1, a downstream primer nucleic acid sequence as shown in SEQ ID NO.2, and a probe nucleic acid sequence as shown in SEQ ID NO.3.

[0012] In a second aspect, the present invention provides a LF-RPA rapid detection reagent for trypanosomiasis, comprising a LF-RPA reaction system;

[0013] The LF-RPA reaction system contains the following components by volume: 30 parts rehydration buffer, 1-2.5 parts upstream primer, 1-2.5 parts downstream primer, 0.5-1 part probe, 2.5 parts L activator, 1-5 parts template, and the volume of the LF-RPA reaction system is made up to 50 parts with sterile ultrapure water;

[0014] The nucleic acid sequence of the upstream primer is shown in SEQ ID NO.1, the nucleic acid sequence of the downstream primer is shown in SEQ ID NO.2, and the nucleic acid sequence of the probe is shown in SEQ ID NO.3;

[0015] Preferably, the LF-RPA reaction system comprises the following components: 30 μL rehydration buffer, 1-2.5 μL upstream primer, 1-2.5 μL downstream primer, 0.5-1 μL probe, 2.5 μL activator, 1-5 μL template, and the volume of the LF-RPA reaction system is made up to 50 μL with sterile ultrapure water;

[0016] Preferably, the concentrations of the upstream primer and the downstream primer are both 10 μM;

[0017] Preferably, the concentration of the probe is 10 μM.

[0018] In the LF-RPA rapid detection reagent for trypanosomiasis, the activator is MgActivator or MnActivator.

[0019] In a third aspect, the present invention provides a trypanosomiasis detection primer set and the use of the trypanosomiasis LF-RPA rapid detection reagent in preparing a trypanosomiasis LF-RPA rapid detection kit.

[0020] In a fourth aspect, the present invention provides a trypanosomiasis LF-RPA rapid detection kit, comprising the trypanosomiasis LF-RPA rapid detection reagent, lyophilized powder, buffer solution and test strips.

[0021] In the LF-RPA rapid detection kit for trypanosomiasis, the lyophilized powder is EIANfo Lyophilized Powder Mix.

[0022] In a fifth aspect, the present invention provides the use of the LF-RPA rapid detection kit for trypanosomiasis in detecting trypanosomiasis genes in biological samples for non-disease diagnosis purposes;

[0023] Preferably, the biological sample is large yellow croaker.

[0024] In a sixth aspect, the application provides a method for non-diagnostic purposes using the LF-RPA rapid detection kit for trypanosomiasis, comprising the following steps:

[0025] (1) extracting DNA from biological tissue;

[0026] (2) weighing Rehydration buffer, sterilized ultrapure water, upstream and downstream primers and probes, mixing them uniformly, transferring them to a reaction tube containing lyophilized powder, oscillating to mix them uniformly, adding activator and template, mixing them thoroughly, and then incubating them in an incubator to obtain a reaction product;

[0027] (3) pre-warming the test strip to room temperature, adding the reaction product obtained in step (1) to the buffer, mixing them gently, and then vertically inserting the test strip into the reaction product, incubating it at room temperature, and observing whether only the control line appears red, which is a negative result; whether both the detection line and the control line appear red, which is a positive result; or whether only the detection line appears red, which is invalid detection.

[0028] In the method, the biological tissue DNA in step (1) is DNA from the liver tissue of Pseudosciaena crocea.

[0029] In the method, the incubation conditions of the incubator are 37-42℃ and the incubation time is 15-30 min.

[0030] The volume ratio of the reaction product to the buffer is 1: (45-55), and preferably the volume ratio of the reaction product to the buffer is 1:49; because the RPA product is sticky, it flows slowly on the test strip, so it is appropriate to dilute it before detection, and the product state is not too sticky after dilution.

[0031] The room temperature is 18-28℃.

[0032] The room temperature incubation time is 5-10 min, and preferably the room temperature incubation time is 5 min.

[0033] Compared with the prior art, the application has the following beneficial effects:

[0034] 1. Simple operation: In the LF-RPA experimental procedure, the reaction system is pre-mixed and added to the lyophilized powder reaction tube. The activator and template are then added. After incubation, the reaction product is directly mixed with the buffer solution and inserted into a test strip for visual observation. Traditional detection methods, such as standard PCR, may require complex follow-up procedures such as electrophoresis and imaging, while quantitative fluorescence PCR (qPCR) relies on specific fluorescence quantification equipment. This method does not require complex instrumentation and equipment, and the operation process is simple. The test strip test results are intuitive and can be interpreted without the need for specialized technical personnel, reducing the technical requirements for operators and making the detection technology more easily applicable in grassroots laboratories and aquaculture sites.

[0035] 2. Rapid Detection: The incubation time for both RPA and LF-RPA experiments is 25 minutes, which, combined with the time for subsequent processing and result observation, makes the entire detection process relatively quick. In comparison, conventional PCR reactions typically take several hours, including steps such as PCR amplification and agarose gel electrophoresis. While qPCR amplification is faster, the initial sample processing and preparation are also time-consuming, and result analysis requires specialized software and equipment, resulting in a longer overall detection time. This method significantly shortens the detection cycle and enables rapid results.

[0036] 3. High sensitivity: through serial dilution T. larimichthysi Plasmid evaluation assays demonstrate sensitivity. LF-RPA can detect as few as 50 copies of DNA. While qPCR also has a minimum detection limit of 50 copies of DNA, this method achieves similar sensitivity without the need for expensive equipment. Some traditional detection methods may be unable to detect target DNA at such low concentrations, and are prone to missing samples with low infection rates. This method offers a significant advantage in sensitivity.

[0037] 4. Good specificity: The present invention designs primers and probes for the trypanosome-specific 18S rDNA region, using T. larimichthysi Plasmid standards, other parasites ( Longicollum pagrosomi 、 Cryptocaryon irritans ) and four aquatic animal pathogenic microorganisms (iridescent virus, Vibrio harveyi, Pseudomonas fluorescens, Pseudomonas auriculatus) DNA were specifically verified, and the results showed that both RPA and LF-RPA experiments could successfully detect T. larimichthysi , and there is no cross-reaction with the DNA of other parasites and pathogens. This shows that the present invention can accurately distinguish trypanosomes from other related pathogens, reducing misdiagnosis and providing more reliable detection results compared to traditional detection technologies that may have cross-reactions.

[0038] 5. Reduce costs: Reduce dependence on instruments. The recombinase polymerase amplification combined with lateral flow test strips (RPA-LFD) detection method established by the present invention does not require expensive PCR amplifiers or fluorescent quantitative PCR instruments. Only a constant temperature device is needed for nucleic acid amplification, which greatly reduces the cost of instruments and equipment, enabling grassroots laboratories and small-scale breeding enterprises to carry out detection work; reduce reagent costs. By optimizing the reaction system and primer probe design, the utilization efficiency of reagents is improved, and unnecessary reagent consumption is reduced, thereby reducing detection costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] 图1 The complete process of detecting trypanosomes in large yellow croaker using RPA combined with lateral flow test strips;

[0040] 图2 It is a partial configuration system of the kit of the present invention;

[0041] 图3 For lateral flow test strip result analysis;

[0042] 图4 Agarose gel electrophoresis results, where A is the agarose gel image of RPA detection; B is the lateral flow test strip showing the detection limit of LF-RPA, NT: no template (water) control; C: quality control line; T: test line;

[0043] 图5 is the amplification curve result;

[0044] 图6 The electrophoresis diagram and test strip results are shown in Figure 1. A is the agarose gel image of the test; B is the lateral flow test strip specific for LF-RPA; from left to right are TL: Trypanosoma spp. ( Trypanosoma larimichthysi ); LP: Red sea bream long-necked spiny head worm ( Longicollum pagrosomi ); CI: Cryptocaryon irritans ( Cryptocaryon irritans ); IV: Iridovirus; VH: Vibrio harveyi ( Vibrio harveyi ); PF: Pseudomonas fluorescens ( Pseudomonas fluorescens ); PP: Pseudomonas auriculatus ( Pseudomonas plecoglossicida ); NT: no template (water) control; C: quality control line; T: test line. DETAILED DESCRIPTION

[0045] The present invention will be further described below with reference to the accompanying drawings and examples.

[0046] Example 1:

[0047] 1. The kit comprises LF-RPA primers, probes, templates, lyophilized powder, rehydration buffer, buffer, sterilized ultrapure water, activator and test strip.

[0048] The LF-RPA primers are RPA18S-5F (SEQ ID NO. 1 is 5'-AGTGGTTCCCTTCCTGATTTTCGCATGTCAT-3') and RPA18S-5R (SEQ ID NO. 2 is 5'-AACCAACAAAAGCCGAAACGGTAGCTCATAGG-3'), and the LF-RPA probe (SEQ ID NO. 3 is 5'-FAM-AAGTGTGACCAAAGCAGTCATCCGACTTGAA-(THF)-TAGAAAGCATGGGATAAC-3'), the FAM label at the 5' end is used for subsequent detection signal generation, the THF label in the middle and the C3Spacer label at the 3' end have specific functions in the detection process, which together guarantee the accuracy of the detection.

[0049] The lyophilized powder is EIANfo Lyophilized powder Mix, which is provided with ATG ® The EIA Nfo Kit (Lyophilized) is provided together.

[0050] The activator is MgActivator, which is provided with ATG ® The EIA Nfo Kit (Lyophilized) is provided together.

[0051] The buffer is Rehydration Buffer.

[0052] The template is genomic DNA extracted from the liver tissue of large yellow croaker.

[0053] The test strip: a universal nucleic acid detection test strip (Biotin / Fam) is used for the final result determination of the LF-RPA experiment. The test strip has a detection line and a control line, the detection line is used to capture the biotin-labeled RPA reaction product, if the sample is positive, the reaction product binds with the corresponding substance on the detection line, and a red band appears under the color development of the marker (such as FAM); the control line is used to verify the effectiveness of the test strip, under normal circumstances, a red band will appear at the control line regardless of the sample result, ensuring the reliability of the detection result.

[0054] 2. The kit contains LF-RPA reaction system, lyophilized powder, buffer and test strip. The ratio of the LF-RPA reaction system is:

[0055] 30 μL Rehydration buffer, 2.4 μL of each of the upstream and downstream primers (10 μM) and 0.75 μL of the probe (10 μM), 10.95 μL of sterilized ultrapure water, 2.5 μL of the activator, 1 μL of the template; the total reaction system is kept at 50 μL.

[0056] Example 2:

[0057] Preparation process of the kit of Example 1 of the present application:

[0058] 1. Design and screening of primers and probes:

[0059] For T. larimichthysi Highly conserved region 18S rDNA was designed for multiple RPA primers and qPCR specific primers and probes, and primers and probes with high specificity were screened. Biotin was added to the 5' end of the RPA reverse primer, FAM was added to the 5' end of the probe, C3Spacer was added to the 3' end of the probe, and THF was added to the middle of the probe.

[0060] Determination of target sequence: the sequence of the highly conserved region 18S rDNA region of T. larimichthysi (GenBank accession no. PP897248-PP897259) was selected as the target sequence for DNA detection. This region is relatively stable in different T. larimichthysi individuals, which is conducive to improving the accuracy and reliability of the detection and avoiding detection failure caused by gene variation.

[0061] Design of primers: according to the guide recommendations of the kit (the length of the RPA primer is usually 30-35 bases, and the GC content is 40%-60%), multiple RPA primers were designed using an online RPA primer design website. The software will generate multiple sets of primer sequences according to the input target sequence and the set parameters. Multiple primers are designed to screen out primers with high specificity and good amplification effect in the future. Similarly, qPCR specific primers Q18S2-F and Q18S2-R were screened using the same method, and factors such as primer length, GC content, and complementarity to the target sequence were also considered during design.

[0062] Screening of primers: multiple RPA primers were screened. In ordinary RPA experiments, the kit ATG ®RPA was performed according to the instructions for the EIA Basic Kit (CK, Free). A 50 μL reaction system was prepared by premixing all components before adding the template (positive standard) for reaction. After completion of the reaction, the results were analyzed by 1.5% agarose gel electrophoresis. Primers were considered optimal if the purified product showed a clear, single band of the correct size. This method successfully identified a highly specific primer pair with a length of 31-32 bp, amplifying a target fragment of 164 bp.

[0063] Probe Design and Screening: To enable direct detection of RPA reaction products using a test strip, a biotin label was added to the 5' end of the RPA reverse primer. Selected probes were labeled with FAM at the 5' end, C3Spacer at the 3' end, and THF in the middle. All primers and probes were synthesized by Shanghai Bioengineering Co., Ltd. The synthesized primers and probes were experimentally validated by combining LF-RPA experiments with lateral flow strips. The appearance of bands on the strips was observed to determine whether the probes could accurately detect RPA reaction products, thereby selecting probes with good performance for subsequent experiments.

[0064] The primer and probe sequences for PCR, qPCR, and LF-RPA obtained after design and screening are shown in Table 1 below.

[0065] Table 1 Primer and probe sequences for PCR, qPCR, and LF-RPA

[0066]

[0067] 2. Template construction

[0068] Design and use specific primers to amplify the 18S rDNA sequence of trypanosomes, and construct the T. larimichthysi The recombinant plasmid was used as the standard in subsequent experiments.

[0069] Specifically, construct T. larimichthysi The recombinant plasmid method is as follows:

[0070] (1) The present invention is aimed at T. larimichthysi Specific primers were designed and used based on the 18S rDNA sequence of Trypanosomes. The universal primers Trypanosomes-B (SEQ ID NO. 4: 5′−CGAACAACTGCCCTATCAGC−3′) and Trypanosomes-I (SEQ ID NO. 5: 5′−GACTACAATGGTCTCTAATC−3′) were used for target sequence amplification. These primers have specific base sequences complementary to the target DNA region and can accurately recognize and bind to the corresponding sites on the 18S rDNA to initiate the amplification reaction.

[0071] Amplify and recover the target sequence. Prepare a PCR reaction system in the appropriate proportions, adding template DNA, Trypanosomes-B, Trypanosomes-I, 2×PCRMix, and sterile distilled water. Place the reaction in a PCR instrument and run according to the programmed protocol. After completion, purify the amplified product using an agarose gel recovery kit to remove impurities such as excess primers and dNTPs to obtain a pure 18S rDNA fragment.

[0072] (2) Ligation and transformation. The recovered product was mixed with the vector in the pEZbluntSimpleCloningKit under the action of T4 DNA ligase according to the system requirements, and ligated at room temperature for five minutes to prepare the ligation product; the competent cells DH5α were melted on ice, and the ligation product was added. The cells were then treated with ice bath, heat shock, and ice bath again to allow the exogenous DNA to enter the cells; then LB liquid medium without antibiotics was added and shaken to allow the cells to recover; finally, the bacterial solution was plated on a plate containing ampicillin, cultured overnight, and the successfully transformed colonies were screened.

[0073] (3) Finally, plasmid extraction. Pick a single colony from the plate and expand it in LB liquid medium containing Amp resistance. Use universal primer M13 to perform PCR verification of the bacterial solution. Send the target fragment for sequencing. Select the bacterial solution with correct sequencing and expand it again. Use a plasmid DNA small-sample kit to extract the plasmid. Determine the concentration and save it for future use.

[0074] Example 3:

[0075] Thirty-four large yellow croaker samples were clinically tested using conventional PCR, qPCR, and the LF-RPA method of the kit of the present invention.

[0076] The specific process of the LF-RPA method of the kit of the present invention is as follows 图1 As shown:

[0077] (1) Extraction of DNA from large yellow croaker liver tissue

[0078] Large yellow croaker samples were collected from Zhoushan City, Zhejiang Province. Liver tissue was quickly removed from the croaker. A suitable DNA extraction kit was used. The extraction process typically includes tissue disruption, cell lysis, DNA isolation, and purification. Following extraction, the concentration and purity of the extracted DNA were measured using a nucleic acid concentration meter to ensure that its quality met the requirements of subsequent experiments.

[0079] (2) Preliminary conventional PCR detection: Using the extracted DNA from the liver tissue of large yellow croaker as a template, conventional PCR detection was performed using the universal primers Trypanosomes-B and Trypanosomes-I for trypanosomes to verify the infection status of trypanosomes.

[0080] Fluorescence quantitative PCR experiment: T. larimichthysi The recombinant plasmid was diluted 10-fold to obtain 10 7 ~10 1 Plasmid standards at varying concentrations were used as templates. The quantitative PCR reaction system consisted of 10 μL of TB Green Mixture (Takara, Dalian, China), 0.2 μL of each upstream and downstream primer (10 μM), 3.6 μL of sterile ultrapure water, and 1 μL of template (containing the plasmid standards at varying concentrations). Amplification was performed on an Eco™ Real-Time PCR System (Illumina, USA) using a program of 95°C for 30 s followed by 40 cycles of 95°C for 5 s and 60°C for 40 s. Amplification was confirmed by analyzing melting curves and standard curves. Sterile ultrapure water was used as a negative control, and each concentration was replicated three times.

[0081] For general RPA experiments, refer to the instructions of the ATG® EIA Basic Kit (CK, Free). For a 50 μL reaction system, first pre-mix 20 μL of EIA Basic Reaction Buffer, 10.5 μL of EIA Basic Enzyme Mix, 10.2 μL of sterile ultrapure water, and 2.4 μL of each of the upstream and downstream primers (10 μM). Then, add 1 μL of 5 mg / mL creatine kinase (CK) and gently pipette to mix. Then, add 1 μL of template ( T. larimichthysi For recombinant plasmids, add 2.5 μL of activator to the reaction tube cap. Place the reaction tube in a preheated thermostat (39.5°C) and incubate for 25 minutes. After incubation, add 7.5 μL of the 6× DNA Loading Buffer (with proteinase K) provided with the kit. Mix thoroughly by pipetting, incubate at 56°C for 5 minutes, and analyze the results by electrophoresis on a 1.5% agarose gel.

[0082] LF-RPA experiment: 图2 As shown, the ATG® EIA Nfo Kit (Lyophilized) was combined with a universal nucleic acid detection strip (Biotin / Fam). First, pre-mix 30 μL of rehydration buffer, 10.95 μL of sterile ultrapure water, 2.4 μL of each upstream and downstream primer (10 μM), and 0.75 μL of probe (10 μM), totaling 46.5 μL. Transfer the mixture to a reaction tube containing the lyophilized powder (EIA Nfo Lyophilized Powder Mix) provided in the kit and vortex to mix again. Then, add 2.5 μL of the activator Mg Activator and 1 μL of the template (large yellow croaker liver tissue DNA) to the reaction tube cap. Mix thoroughly and incubate at 39.5°C for 25 minutes. Place the test strips in the test strip kit at room temperature (18-28°C) in advance, take 10 μL of the RPA reaction product and add it to 490 μL of buffer solution, mix gently and insert the test strip vertically, incubate at room temperature for 5 minutes, and observe the final result with the naked eye. If red strips appear at both the test line and the control line of the test strip, it is a positive result; if only the control line has a red strip, it is a negative result, and if only the test line has a red strip, the test is invalid. During this process, the template can be replaced with T. larimichthysi The recombinant plasmid was used as a positive control, and the results were judged by observing the color development of the test line and the control line on the test strip to evaluate the performance of the LF-RPA experiment.

[0083] The results are shown in Table 2 below. Among the 34 samples, conventional PCR detected 15 positive results and qPCR detected 17 positive results. Of the 15 PCR-positive samples, LF-RPA detected 2 negative results, with a sensitivity of 86.7%. Of the 19 PCR-negative samples, LF-RPA detected 4 positive results, with a specificity of 78.9%. The overall concordance between the two methods was 82.8%. The chi-square test showed no significant difference in the detection results between the two methods. The kappa test showed that while there was agreement between the two methods, the degree of agreement was suboptimal (k < 0.75).

[0084] Among 17 qPCR-positive samples, LF-RPA detected one negative sample, with a sensitivity of 94.1%. Among 17 qPCR-negative samples, LF-RPA detected three positive samples, with a specificity of 82.3%. The overall concordance between the two methods was 88.2%. The chi-square test showed no significant difference in the detection results between the two methods. The kappa test showed that although there was concordance between the two methods, the degree of concordance was high (k > 0.75).

[0085] Table 2 Statistical comparison between LF-RPA method, conventional PCR, and fluorescence quantitative PCR

[0086]

[0087] TP, true positive; FP, false positive; FN, false negative; TN, true negative

[0088] Sensitivity = (TP / (TP+FN)) × 100%

[0089] Specificity = (TN / (TN + FP)) × 100%

[0090] Accuracy = ((TP+TN) / (TP+TN+FP+FN))×100%.

[0091] Comparative Example 1: Minimum Detection Limit of Ordinary RPA

[0092] Common RPA experiments: refer to the ATG kit ® Follow the instructions for the EIA Basic Kit (CK, Free). For a 50 μL reaction volume, pre-mix 20 μL of EIA Basic Reaction Buffer, 10.5 μL of EIA Basic Enzyme Mix, 10.2 μL of sterile ultrapure water, and 2.4 μL of each upstream and downstream primer (10 μM). Add 1 μL of 5 mg / mL creatine kinase (CK) and gently pipette to mix. Then, add 1 μL of template (positive standard recombinant plasmid) and cap the reaction tube with 2.5 μL of activator. Incubate the reaction tube in a preheated thermostat (39.5°C) for 25 minutes. After incubation, add 7.5 μL of the 6× DNA Loading Buffer (supplemented with proteinase K) provided by the kit. Mix thoroughly by pipetting, incubate at 56°C for 5 minutes, and visualize the results by electrophoresis on a 1.5% agarose gel. The above experiment was conducted by continuously decreasing the template concentration until a clear band appeared on the test line of the test strip. This was the minimum DNA copy number that ordinary RPA could detect, which was used to evaluate its sensitivity.

[0093] Principle of detection: The existing ordinary RPA experiment is based on the principle of recombinase polymerase amplification. The recombinase can recognize and bind the homologous region of the primer and the template DNA at room temperature, forming a D-loop structure, and then the polymerase extends to synthesize a new chain with the primer as the starting point. The creatine kinase in the system provides energy to ensure the smooth progress of the reaction. After the reaction is completed, the agarose gel electrophoresis is carried out, and the size of the DNA fragment is different in the electric field. The migration speed difference is observed to determine whether a clear single and correct size band appears, and the primers are judged and the amplification is determined.

[0094] Results as shown in 图4 The agarose gel electrophoresis results in Example A show that weak bands showing a lower detection limit can be seen at 500 DNA copies, indicating that the existing ordinary RPA can detect the lowest 500 copies of DNA.

[0095] Comparative Example 2: The lowest detection limit of qPCR

[0096] The T. larimichthysi The recombinant plasmid was diluted by 10 times to obtain a concentration gradient of 10 7 ~10 1 copies / μL. The reaction system of the fluorescent quantitative PCR experiment was 10 μL, including 5 μL TB Green Mixture (Takara, Dalian, China), 0.2 μL of each of the upstream and downstream primers (10 μM), 3.6 μL of sterile ultrapure water, and 1 μL of template containing different concentration gradient plasmid standard. The amplification reaction was carried out on Eco TM Real-Time PCR System (Illumina, USA), and the program was 95℃, 30s; 40 cycles (95℃, 5s; 60℃, 40s). After the experiment was completed, the melting curve and the standard curve were analyzed to determine the amplification. Sterile ultrapure water was used as a negative control, and each concentration was repeated 3 times. 10-fold serially diluted T. larimichthysi -Blunt recombinant plasmid DNA was used to test the detection limit of fluorescent quantitative PCR, and the amplification curve showed that the fluorescent quantitative PCR could detect as low as 50 copies of DNA.

[0097] Principle of detection: Fluorescent quantitative PCR is based on the principle of TaqMan probe or SYBR Green fluorescent dye combined with PCR amplification. In the extension stage of each cycle of PCR, the fluorescence signal will be enhanced with the amplification of target DNA, and the instrument detects the change of fluorescence intensity in real time. According to the linear inverse relationship between Ct value (the number of cycles when reaching the set fluorescence threshold) and the logarithm of the initial template concentration, the standard curve is made by the known concentration of standard, and then the concentration of target nucleic acid in unknown sample is calculated. The melting curve analysis is to use the difference of melting temperature of different double-stranded DNA to judge the specificity of the amplification product, and the single sharp melting peak indicates the high specificity of the amplification product.

[0098] As 图5 The amplification curve result shows that the minimum detection limit of qPCR is 50 copies of DNA.

[0099] Example 4: Minimum detection limit of LF-RPA

[0100] Kit ATG ® EIA Nfo Kit (Lyophilized) and universal nucleic acid test strip (Biotin / Fam) were performed. First, 30 μL Rehydration buffer, 10.95 μL of sterile ultrapure water, 2.4 μL of each of the upper and lower primers (10 μM), and 0.75 μL of probe (10 μM) were mixed to a total of 46.5 μL, and then transferred to the reaction tube containing the lyophilized powder (EIA Nfo Lyophilized powder Mix) provided by the kit. Shake again to mix. Then add 2.5 μL of activator Mg Activator and 1 μL of template (positive standard recombinant plasmid) to the reaction tube cover, mix well, and incubate in a 39.5°C incubator for 25 min. The test strip in the test strip kit was preheated to room temperature (18-28°C), 10 μL of RPA reaction product was added to 490 μL of buffer solution, mixed gently, and then inserted vertically into the test strip. Incubate at room temperature for 5 min, and observe the final result with the naked eye. If red bands appear on the test line and control line of the test strip, it is a positive result; if only the control line shows a red band, it is a negative result. The concentration of recombinant plasmid was continuously reduced and the above experiment was performed until the test strip detection line just showed a clear band, which was the minimum DNA copy number that LF-RPA could detect, and thus the sensitivity was evaluated. The results of the agarose gel test strip showed that LF-RPA could detect as low as 50 copies of DNA.

[0101] As 图4 The results of the test strip showed that a clear band appeared on the test line at 50 DNA copies, indicating that LF-RPA could detect as low as 50 copies of DNA.

[0102] From comparative examples 1 and 2 and example 4, it can be seen that the LF-RPA detection method of the kit of the present application can achieve the same low copy detection line as the RPA detection method. The LF-RPA detection method of the kit of the present invention can achieve high sensitivity similar to that of the RPA detection method in a shorter time without using an expensive PCR instrument.

[0103] Example 5:

[0104] The existing common RPA method was used to detect the DNA of seven pathogenic microorganisms. The specific process is as follows:

[0105] Prepare the prepared Example 2 T. larimichthysi Recombinant plasmid as a positive control standard, and Longicollum pagrosomi 、 Cryptocaryon irritans DNA samples of four aquatic animal pathogens (iridovirus, Vibrio harveyi, Pseudomonas fluorescens, and Pseudomonas aeruginosa). These samples represent the target assay and potential cross-reactants. A 50 μL reaction system was prepared by pre-mixing 20 μL of EIA Basic Reaction Buffer, 10.5 μL of EIA Basic Enzyme Mix, 10.2 μL of sterile ultrapure water, and 2.4 μL of each upstream and downstream primer (10 μM). Then, 1 μL of 5 mg / mL creatine kinase (CK) was added and gently pipetted to mix. Then, 1 μL of template (positive standard recombinant plasmid) was added, and 2.5 μL of activator was added to the reaction tube cap. The reaction tube was placed in a preheated incubator (39.5°C) and incubated for 25 minutes. After the incubation is completed, use the 6× DNA Loading Buffer (with proteinase K added) provided by the kit, add 7.5 μL of 6× DNA Loading Buffer, mix well by pipetting, and incubate at 56°C for 5 minutes. After the reaction is completed, take an appropriate amount of the reaction product for agarose gel electrophoresis. During the electrophoresis process, the amplified products of different samples will migrate different distances in the gel according to their size. By comparing with the nucleic acid molecular weight standard, observe the amplified product bands of each sample. If T. larimichthysi The positive control standard of the recombinant plasmid showed the expected size band, while other non-target samples did not show the band, which preliminarily indicated that the RPA experiment was T. larimichthysi Be specific.

[0106] The LF-RPA method of the kit of the present invention was used to detect the DNA of seven pathogenic microorganisms. The specific process is as follows:

[0107] Combine the ATG® EIA Nfo Kit (Lyophilized) with a universal nucleic acid detection strip (Biotin / Fam). First, pre-mix 46.5 μL of a system (30 μL of rehydration buffer, 10.95 μL of sterile ultrapure water, 2.4 μL of each upstream and downstream primer (10 μM), and 0.75 μL of the probe (10 μM). Transfer the mixture to a reaction tube containing the lyophilized powder (EIA Nfo Lyophilized Powder Mix) provided in the kit and vortex to mix again. Then, add 2.5 μL of the activator Mg Activator and 1 μL of the template (positive standard recombinant plasmid) to the reaction tube cap. Mix thoroughly and incubate at 39.5°C for 25 minutes. Place the test strips in the test strip kit at room temperature (18-28°C) in advance, take 10 μL of RPA reaction product and add it to 490 μL of buffer solution, mix gently and insert the test strip vertically, incubate at room temperature for 5 minutes, and observe the quality control line (C line) and test line (T line) on the test strip. T. larimichthysi The C and T lines on the test strips corresponding to the plasmid standards were colored, while other non-target samples only had C lines colored and T lines were not colored, indicating that the LF-RPA experiment can specifically detect T. larimichthysi , and there is no cross reaction with other pathogenic microorganism DNA. 图6 As shown, the electrophoresis diagram and test strips show that both experimental methods can successfully detect T. larimichthysi , and with Longicollum pagrosomi 、 Cryptocaryon irritans There was no cross-reaction with the DNA of four other pathogenic microorganisms (iridovirus, Vibrio harveyi, Pseudomonas fluorescens, and Pseudomonas auriculatus). These results demonstrate that conventional RPA methods and the LF-RPA of the present invention can effectively distinguish other parasites from pathogens, with high specificity.

Claims

1. A trypanosome detection primer set, characterized in that: The trypanosome detection primer set includes an upstream primer nucleic acid sequence as shown in SEQ ID NO.1, a downstream primer nucleic acid sequence as shown in SEQ ID NO.2, and a probe nucleic acid sequence as shown in SEQ ID NO.

3.

2. A LF-RPA rapid detection reagent for trypanosomiasis, characterized in that: Contains LF-RPA reaction system; The LF-RPA reaction system contains the following components by volume: 30 parts rehydration buffer, 1-2.5 parts upstream primer, 1-2.5 parts downstream primer, 0.5-1 part probe, 2.5 parts activator, 1-5 parts template, and the volume of the LF-RPA reaction system is made up to 50 parts with sterile ultrapure water; The nucleic acid sequence of the upstream primer is shown in SEQ ID NO.1, the nucleic acid sequence of the downstream primer is shown in SEQ ID NO.2, and the nucleic acid sequence of the probe is shown in SEQ ID NO.

3.

3. The LF-RPA rapid detection reagent for trypanosomiasis according to claim 2, characterized in that: The activator is MgActivator or MnActivator; The LF-RPA reaction system contains the following components: 30 μL rehydration buffer, 1-2.5 μL upstream primer, 1-2.5 μL downstream primer, 0.5-1 μL probe, 2.5 μL activator, 1-5 μL template, and the volume of the LF-RPA reaction system is supplemented with sterile ultrapure water to 50 μL. The concentrations of the upstream primer and downstream primer were both 10 μM; The concentration of the probe was 10 μM.

4. Use of the trypanosomiasis detection primer set according to claim 1 and the trypanosomiasis LF-RPA rapid detection reagent according to claim 2 or 3 in the preparation of a trypanosomiasis LF-RPA rapid detection kit.

5. A LF-RPA rapid detection kit for trypanosomiasis, characterized in that: The invention comprises the trypanosomiasis LF-RPA rapid detection reagent as claimed in claim 2, lyophilized powder, buffer solution and test strips.

6. The LF-RPA rapid detection kit for trypanosomiasis according to claim 5, characterized in that: The lyophilized powder is EIANfo Lyophilized powder Mix or TwistAmp® Basic.

7. Use of the LF-RPA rapid detection kit for trypanosomiasis as claimed in claim 5 or 6 in detecting genes of trypanosomes in large yellow croaker for non-disease diagnosis purposes.

8. The use according to claim 7, characterized in that The following steps are involved: (1) Large yellow croaker liver tissue DNA was used as the test sample; (2) Weigh the rehydration buffer, sterile ultrapure water, upstream and downstream primers and probes, mix them evenly, transfer them to the reaction tube containing lyophilized powder, shake and mix them, add the activator and template, mix them thoroughly, and incubate them in an incubator to obtain the reaction product; (3) Place the test strip at room temperature in advance, take the reaction product obtained in step (2) and add it to the buffer solution, mix gently and insert the test strip vertically, incubate at room temperature, and observe. If only the control line has a red strip, it is a negative result; if red strips appear at both the test line and the control line, it is a positive result. If only the test line has a red strip, the test is invalid.

9. The use according to claim 8, characterized in that The incubation conditions of the incubator are: temperature 37-42°C, incubation time 15-30 min; The volume ratio of the reaction product to the buffer solution is 1:45-55; The room temperature is 18-28°C; The room temperature incubation time is 5 to 10 minutes.