Method for synthesizing D-mannitol by utilizing methanol and / or formaldehyde and fructose enzyme method

Abstract

The invention provides an engineering strain for producing mannitol from methanol and / or formaldehyde and fructose and a method for producing mannitol by using the engineering strain. According to the method, a reducing agent is methanol or formaldehyde, a catalyst is dehydrogenase capable of utilizing the methanol or the formaldehyde, a reduction-state cofactor NADH is provided while the methanol or the formaldehyde is oxidized by the dehydrogenase, and D-fructose is converted into D-mannitol by coupling mannitol dehydrogenase. According to the method and the technology, methanol dehydrogenase and / or formaldehyde dehydrogenase, formate dehydrogenase and mannitol dehydrogenase are over-expressed in recombinant escherichia coli, so that a novel method and a novel technology for synthesizing D-mannitol through multi-enzyme coupling catalysis are constructed. The invention establishes a preparation method for co-producing D-mannitol, methanol (or formaldehyde) and reduced NADH from cheap raw materials, and the preparation method has important significance for green and efficient production of D-mannitol.

Description

Technical Field

[0001] The present invention relates to the fields of gene editing, gene recombination-edited microbial strains, synthetic biology, and microbial whole-cell catalysis technology. Specifically, it relates to a method for synthesizing D-mannitol based on methanol and / or formaldehyde and fructose enzymatically, and relates to the field of bioengineering technology. Background Art

[0002] Nicotinamide adenine dinucleotide (NAD) is a key coenzyme involved in a variety of reactions, including intracellular energy metabolism, redox, and biosynthesis. Approximately 1,500 enzymatic reactions in microorganisms require the cofactors NAD(H) and NAD(P)H. Nicotinamide cofactors exist in two main forms: reduced NAD(P)H and oxidized NAD(P). + , which depends on NADP + The enzymatic reaction is more sensitive to NAD than + The enzymatic reaction is less, about 1:4. According to the current market value, the price of the reduced form is much higher than the oxidized form, and the structure is more unstable. Most researchers use multi-enzyme coupling to convert NAD(P) to oxidized form using cheap alcohols, acids or glucose as substrates. + The oxidation of NAD(P)H to reduced form and the co-production of high-value-added chemicals, coupled with the enzyme's cofactor recycling regeneration method, is an economical and effective biocatalytic system.

[0003] Compared with other reactions that catalyze the generation of NAD(P)H, the catalytic reaction based on one-carbon compounds has the advantages of abundant substrate sources, low price, easy preparation and abundant reserves. By using microbial cells through a coupled enzyme regeneration system, cheap one-carbon compounds such as methanol can be oxidized by their dehydrogenases to eventually generate other high value-added compounds. At the same time, it can alleviate problems such as energy shortages and environmental pollution, and is in line with the goals and tasks of energy conservation and emission reduction of the "Dual Carbon Plan". Therefore, NAD can be achieved by reducing one-carbon substrates through dehydrogenases. + The regenerative reduction method can utilize one-carbon compounds such as methanol or formaldehyde to achieve carbon conversion and energy transfer.

[0004] D-mannitol is a natural hexavalent alcohol. +The price of D-mannitol is relatively cheap. The main synthesis method is currently through the catalytic synthesis of D-fructose by D-mannitol dehydrogenase in the presence of the cofactor NAD(P)H. It is widely used in the food industry as a sweetener and stabilizer. At present, the synthesis of D-mannitol by oxidizing methanol or formaldehyde through a multi-enzyme coupled catalytic one-carbon compound oxidation system has not been reported. Therefore, a method for converting D-fructose into D-mannitol based on D-mannitol dehydrogenase coupled with a one-carbon compound coenzyme regeneration system is constructed. This can achieve the synthesis of high-value-added compounds through an enzyme-catalyzed method that combines the oxidation of methanol or formaldehyde with the utilization of NADH, and also provides guidance for the utilization of one-carbon compounds. Summary of the Invention

[0005] The invention discloses a method for synthesizing D-mannitol by enzymatic method using methanol or formaldehyde and fructose as co-substrates.

[0006] In response to existing technical difficulties and problems, the present invention provides a method and application of enzymatically synthesizing D-mannitol based on methanol or formaldehyde and fructose as co-substrates.

[0007] The present invention adopts the following technical solutions:

[0008] According to an exemplary embodiment of the present application, the present application provides a genetically recombinant Escherichia coli for producing D-mannitol, wherein (1) methanol dehydrogenase Medh and / or formaldehyde dehydrogenase Fadh, (2) formate dehydrogenase Fdh and (3) mannitol dehydrogenase Mdh are overexpressed or enhanced in the Escherichia coli, and the Escherichia coli produces D-mannitol enzymatically using (a) methanol and / or formaldehyde and (b) fructose as co-substrates.

[0009] Alternatively or optionally, the E. coli can use methanol and / or formaldehyde as a reducing agent, utilize methanol dehydrogenase and / or formaldehyde dehydrogenase as a catalyst, and provide reduced NADH while the methanol dehydrogenase and / or formaldehyde dehydrogenase oxidizes methanol and / or formaldehyde, thereby converting D-fructose into D-mannitol by coupling mannitol dehydrogenase.

[0010] According to an exemplary embodiment of the present application, the present application provides a method for producing D-mannitol, wherein D-mannitol is enzymatically produced using the Escherichia coli according to any of the aforementioned items, methanol and / or formaldehyde as a reducing agent, and D-fructose as a substrate.

[0011] Alternatively or alternatively, D-mannitol can be produced using the following methods: (1) disrupting the cells induced for overnight expression and resuspending them in the reaction system; (2) directly collecting the centrifuged cells and adding them to the reaction system. The amount of each recombinant enzyme in the reaction system is calculated based on the OD10-30 / mL of the cells expressing the enzyme protein, or an equal amount of lysate is used instead. The transformation time is 24 hours.

[0012] Alternatively or alternatively, in the buffer system used in the enzymatic process, the final concentration of the methanol compound is 50 mM-1 M and / or the final concentration of the formaldehyde compound is 50 mM-1 M, NAD + The final concentration of is 1 mM, the final concentration of fructose is 50 mM-1 M, the buffer system is a phosphate buffer, the buffer system has a pH value of 5-8, and the reaction temperature is 37-42 ° C.

[0013] According to an exemplary embodiment of the present application, the present application provides the use of any of the aforementioned Escherichia coli in producing D-mannitol.

[0014] The methanol dehydrogenase used in the present invention is a catalytic enzyme that uses methanol as a reducing agent to reduce NAD + The enzymes are active proteins in the corresponding reduced state. These enzymes are any of the methanol dehydrogenase BmMedh2 (UniProt ID: P31005, Protein SEQ ID: NO.1, DNA SEQ ID: NO.6) from Bacillus methanolicus and its mutants, or the methanol dehydrogenase LsMedh2 (UniProt ID: A0A2S5CWV3, Protein SEQ ID: NO.2, DNA SEQ ID: NO.7) from Lysinibacillus sphaericus and its mutants, such as the methanol dehydrogenase BmMedh2 mutant BmMedh2-S97G (BmMedh2-S97G represents a change of amino acid 97 of the methanol dehydrogenase BmMedh2 from S to G, and the same applies to the others).

[0015] The formaldehyde dehydrogenase used in the present invention is a enzyme that uses formaldehyde as a reducing agent to catalyze the reduction of NAD + The enzymes are the formaldehyde dehydrogenase PpFadh (UniProt ID: P46154, Protein SEQ ID: NO. 3, DNA SEQ ID: NO. 8) from Pseudomonas putida.

[0016] The formate dehydrogenase gene used in the present invention is derived from the formate dehydrogenase LrFdh of Leuconostoc rapi (UniProt ID: A0A3D9Z0Y5, Protein SEQ ID: NO.4, DNA SEQ ID: NO.9), and the D-mannitol dehydrogenase gene is derived from the mannitol dehydrogenase WkMdh of Weissella koreensis (UniProt ID: A0A7H1MNL6, Protein SEQ ID: NO.5, DNA SEQ ID: NO.10).

[0017] The substrate methanol used is one of methanol and deuterated methanol or a combination of the two; the substrate formaldehyde used is one of formaldehyde and deuterated formaldehyde or a combination of the two.

[0018] The product of the present invention is D-mannitol, and its detection method is as follows: 1) Centrifuge 1 mL of fermentation broth at 12,000 rpm for 10 minutes, collect the supernatant, and use it for HPLC analysis. 2) HPLC detection conditions: Shimadzu high-performance liquid chromatography (HPLC) system; 87 H column; RID differential detector; mobile phase: 5 mM H2SO4; flow rate: 0.6 mL / min; column temperature: 60°C; injection volume: 10 μL. Each sample was tested for 25 minutes.

[0019] Compared with existing technologies, the enzymatic synthesis method for D-mannitol using methanol or formaldehyde and fructose as co-substrates provided by the present invention offers the following advantages: Reduced NADH is generated by oxidation of inexpensive substrates such as one-carbon compounds, which can be coupled with D-mannitol dehydrogenase to achieve recycling of reducing power. Furthermore, the cofactor addition level is at the millimolar level, reducing production costs.

[0020] In summary, the present invention provides a method for enzymatically synthesizing D-mannitol using methanol or formaldehyde and fructose as co-substrates, which has the advantages of being green and efficient and provides a basis for industrial large-scale production. DETAILED DESCRIPTION

[0021] definition

[0022] Unless defined otherwise or clearly indicated by the context, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0023] Throughout this specification and the appended claims, the words "comprise" and "include" and variations thereof should be interpreted inclusively. That is, these words are intended to convey that other elements or integers not specifically listed may be included, where the context permits.

[0024] The articles "a / an" are used herein to refer to one / a or more than one / more than a (i.e., one / an or at least one / at least one) grammatical object of the article. For example, "an element / an element" can mean one element / an element or more than one element / more than one element. When nouns (e.g., compounds, additives, etc.) are referred to in the singular, the plural is intended to be included. Thus, when referring to a particular part (e.g., "a gene"), this means "at least one" of the gene, e.g., "at least one gene," unless otherwise specified.

[0025] Unless explicitly indicated otherwise, the various embodiments of the invention described herein may be cross-combined.

[0026] The term "carbon source" refers to a source of carbon, preferably a compound or molecule containing carbon. Preferably, the carbon source is a carbohydrate, an amino acid and its derivatives, etc. In this article, a carbon source is understood to be an organic compound composed of the elements carbon, oxygen and hydrogen.

[0027] The term "cell" refers to a eukaryotic or prokaryotic organism, preferably existing as a single cell. In the present invention, the cell can be a recombinant Escherichia coli. That is, the recombinant cell is selected from a cell population of the genus consisting of Escherichia coli.

[0028] As used herein, the term "recombination" / "engineered" (e.g., mentioning "recombinant E. coli," "recombinant cell," "recombinant microorganism," and / or "recombinant strain") can refer to cells, microorganisms, or strains containing nucleic acids that are the result of one or more genetic modifications. Briefly, cells, microorganisms, or strains contain different combinations of nucleic acids from one or more parents (any of which). In order to construct recombinant cells, microorganisms, or strains, one or more recombinant DNA techniques and / or one or more other mutagenesis techniques can be used. For example, recombinant E. coli and / or recombinant E. coli cells can comprise nucleic acids that are not present in corresponding wild-type E. coli and / or cells, recombinant DNA techniques have been used to introduce this nucleic acid into this E. coli or E. coli cells (i.e., transgenic E. coli and / or cells), or this nucleic acid that is not present in the wild-type E. coli and / or cells is the result of one or more mutations (e.g., using recombinant DNA techniques or another mutagenesis technique such as UV irradiation) in the nucleotide sequence (such as a gene encoding a wild-type polypeptide) present in the wild-type E. coli and / or E. coli cells. Furthermore, the term "recombinant" may suitably refer to a cell, microorganism or strain from which a nucleic acid sequence has been removed, for example using recombinant DNA techniques.

[0029] In this article, the recombinant E. coli comprising or having a certain activity is understood to mean that the recombinant E. coli may comprise one or more nucleic acid sequences encoding a protein having such activity, thereby allowing the recombinant E. coli to functionally express such a protein or enzyme.

[0030] The term "functionally expressed" means that there is functional transcription of the relevant nucleic acid sequence, allowing the nucleic acid sequence to actually be transcribed, for example resulting in the synthesis of a protein.

[0031] As used herein, the term "transgenic" (e.g., with reference to "transgenic E. coli" and / or "transgenic cells") refers to E. coli and / or cells, respectively, that contain a nucleic acid that is not naturally present in the E. coli and / or cells and that has been introduced into the E. coli and / or cells using, for example, recombinant DNA techniques, such as recombinant yeast and / or cells.

[0032] As used herein with respect to a protein or polypeptide, the term "mutation" means that at least one amino acid has been replaced, inserted into, or deleted from an amino acid sequence compared to a wild-type or naturally occurring protein or polypeptide sequence. Amino acid substitution, insertion, or deletion can be achieved, for example, via mutagenesis of nucleic acids encoding these amino acids. Mutagenesis is a method well known in the art and includes, for example, site-directed mutagenesis by means of PCR or via oligonucleotide-mediated mutagenesis, as described in Sambrook et al., Molecular Cloning-A Laboratory Manual, 2nd edition, Vols. 1-3 (1989), published by Cold Spring Harbor Publishing.

[0033] As used herein with respect to a gene, the term "mutation" means that at least one nucleotide in the nucleic acid sequence of a gene or its regulatory sequence has been replaced, inserted into, or deleted from a nucleic acid sequence by a different nucleotide compared to a wild-type or naturally occurring nucleic acid sequence. The replacement, insertion, or deletion of an amino acid can be achieved, for example, via mutagenesis, resulting in, for example, the transcription of a protein sequence having a qualitatively or quantitatively altered function or the knockout of the gene. In the context of the present invention, "altered gene" has the same meaning as a mutant gene.

[0034] As used herein, the term "gene" refers to a nucleic acid sequence that can be transcribed into mRNA and then translated into a protein. A gene encoding a protein refers to one or more nucleic acid sequences encoding the protein.

[0035] As used herein, the term "nucleic acid" or "nucleotide" refers to a monomeric unit in a deoxyribonucleotide or ribonucleotide polymer (i.e., a polynucleotide) in a single-stranded or double-stranded form, and unless otherwise limited, encompasses known analogs with the essential properties of natural nucleotides because they hybridize with single-stranded nucleic acids (e.g., peptide nucleic acids) in a manner similar to naturally occurring nucleotides. For example, an enzyme defined by a nucleotide sequence encoding an enzyme includes (unless otherwise limited) a nucleotide sequence that hybridizes with a reference nucleotide sequence encoding the enzyme. A polynucleotide can be the full length or subsequence of a natural or heterologous structure or regulatory gene. Unless otherwise indicated, the term includes reference to a specified sequence and its complementary sequence. Therefore, a DNA or RNA with a modified backbone for stability or other reasons is a term "polynucleotide" as intended herein. In addition, a DNA or RNA comprising rare bases (such as inosine) or modified bases (such as tritylated bases) (to give only two examples) is a term polynucleotide as used herein. It will be understood that a variety of modifications have been made to DNA and RNA for many useful purposes known to those skilled in the art. The term polynucleotide as used herein includes such chemically, enzymatically, or metabolically modified forms of the polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells (especially including simple and complex cells).

[0036] The terms "nucleotide sequence" and "nucleic acid sequence" are used interchangeably herein. An example of a nucleic acid sequence is a DNA sequence.

[0037] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues, such as those exhibited by an amino acid sequence. These terms apply to amino acid polymers in which one or more amino acid residues is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. An essential property of such analogues of naturally occurring amino acids is that, when incorporated into a protein, the protein is specifically reactive with antibodies elicited against a protein composed entirely of the same naturally occurring amino acids. The terms "polypeptide," "peptide," and "protein" also include modifications including, but not limited to, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation, and ADP-ribosylation.

[0038] The term "enzyme" refers to a protein with catalytic function in this article. In the case of a certain biological reaction of protein catalysis, the terms "protein" and "enzyme" can be used interchangeably in this article. When enzymes are mentioned with reference to enzymes (EC), enzymes are such classifications, wherein enzymes are classified or can be classified according to the enzyme nomenclature provided by the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (NC-IUBMB), which can be found at http: / / www.chem.qmul.ac.uk / iubmb / enzyme / . It is intended to include other suitable enzymes that have not yet (yet) been classified in a given category but can be so classified.

[0039] If a protein or nucleic acid sequence (such as a gene) is referred to herein by reference to an accession number, unless otherwise specified, that number is specifically used to refer to the protein or nucleic acid sequence (gene) having the sequence that can be found via www.ncbi.nlm.nih.gov / (available as of October 1, 2020).

[0040] Each nucleic acid sequence encoding a polypeptide herein also includes any conservatively modified variants thereof. By reference to the genetic code, this includes, it describes every possible silent variation of nucleic acid. The term "conservatively modified variant" is applicable to both amino acid and nucleic acid sequences. With regard to a specific nucleic acid sequence, conservatively modified variants refer to those nucleic acids encoding identical amino acid sequences or conservatively modified amino acid sequence variants due to the degeneracy of the genetic code. The term "degeneracy of the genetic code" refers to the fact that a large number of functionally identical nucleic acids encode any given protein. For example, the codons GCA, GCC, GCG, and GCU all encode the amino acid alanine. Therefore, at each position where a codon specifies alanine, the codon can be changed to any described corresponding codon without changing the encoded polypeptide. This type of nucleic acid variation is a "silent variation" and represents a conservatively modified variation.

[0041] As used herein, the term "functional homolog" (or simply "homolog") of a polypeptide and / or amino acid sequence or a gene having a specific sequence (e.g., "SEQ ID NO: X") refers to a polypeptide and / or amino acid sequence comprising the specific sequence, or refers to a nucleic acid sequence comprising a polypeptide and / or amino acid sequence encoding the specific sequence, provided that one or more amino acids are mutated, substituted, deleted, added and / or inserted, and the polypeptide has (qualitatively) the same enzymatic function for substrate conversion.

[0042] As used herein, the term "functional homolog" (or simply "homolog") of a polynucleotide and / or nucleic acid sequence having a specific sequence (e.g., "SEQ ID NO: X") refers to a polynucleotide and / or nucleic acid sequence comprising the specific sequence, provided that one or more nucleic acids are mutated, substituted, deleted, added, and / or inserted, and that the polynucleotide encodes a polypeptide sequence having (qualitatively) the same enzymatic function for substrate conversion. With respect to nucleic acid sequences, the term functional homolog is intended to include nucleic acid sequences that differ from another nucleic acid sequence due to the degeneracy of the genetic code and that encode the same polypeptide sequence.

[0043] Sequence identity is defined herein as the relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. Typically, sequence identity or similarity is compared over the entire length of the compared sequences. In the art, "identity" also means the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences.

[0044] When an amino acid or nucleotide sequence exhibits a certain level of similarity, it is said to be homologous. Two sequences being homologous indicate a common evolutionary origin. Whether two homologous sequences are closely related or more distantly related is indicated by a "percent identity" or "percent similarity," which is high or low, respectively. Although controversial, "level of homology" or "percent homology" are often used interchangeably to indicate "percent identity" or "percent similarity." Comparison of sequences and determination of the percent identity between two sequences can be accomplished using mathematical algorithms. The skilled artisan will be aware of the fact that several different computer programs are available for aligning two sequences and determining homology between them (Kruskal et al., "An overview of sequence comparison: Time warps, string edits, and macromolecules", (1983), Society for Industrial and Applied Mathematics (SIAM), Vol. 25, No. 2, pp. 201-237, and in the handbook edited by D. Sankoff and J.B. Kruskal (eds.), "Time warps, string edits and macromolecules: the theory and practice of sequence comparison", (1983), pp. 1-44, published by Addison-Wesley Publishing Company, Massachusetts USA).

[0045] The percent identity between two amino acid sequences can be determined by aligning two sequences using the Needleman and Wunsch algorithm (Needleman et al. "A General Method Applicable to the Search for Similarities in the Amino Acid Sequence of Two Proteins" (1970) J. Mol. Biol. 48, 443-453). This algorithm aligns amino acid sequences as well as nucleotide sequences. The Needleman-Wunsch algorithm has been implemented in the computer program NEEDLE. For the purposes of the present invention, the NEEDLE program from the EMBOSS package (version 2.8.0 or higher, see Rice et al., "EMBOSS: The European Molecular Biology Open Software Suite", (2000), Trends in Genetics, Vol. 16, (6) pp. 276-277, http: / / emboss.bioinformatics.nl / ) is used. For protein sequences, EBLOSUM62 is used as the substitution matrix. For nucleotide sequences, EDNAFULL is used. Other matrices may be specified. Optional parameters for amino acid sequence alignments are a gap opening penalty of 10 and a gap extension penalty of 0.5. The skilled person will appreciate that all of these different parameters will produce slightly different results, but the overall percent identity of the two sequences does not change significantly when different algorithms are used.

[0046] Homology or identity is the percentage of identical matches between two complete sequences over the total aligned area including any gaps or extensions. Homology or identity between two aligned sequences is calculated as follows: the number of corresponding positions in the alignment showing identical amino acids in the two sequences divided by the total length of the alignment including gaps. Identity as defined herein can be obtained from NEEDLE and is labeled "IDENTITY" in the program's output.

[0047] The homology or identity between two aligned sequences is calculated as follows: the number of corresponding positions in the alignment showing the identical amino acid in the two sequences divided by the total length of the alignment after subtracting the total number of gaps in the alignment. Identity as defined herein can be obtained from NEEDLE using the NOBRIEF option and is labeled "longest-identity" in the program's output.

[0048] Variants of the nucleotide or amino acid sequences disclosed herein may also be defined as nucleotide or amino acid sequences having one or more mutations, substitutions, insertions and / or deletions compared to the nucleotide or amino acid sequences specifically disclosed herein (e.g., in the sequence listing).

[0049] Optionally, when determining the degree of amino acid similarity, the skilled person may also consider so-called "conservative" amino acid substitutions, which will be clear to the skilled person. Conservative amino acid substitutions refer to the interchangeability of residues with similar side chains. For example, a group of amino acids with aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids with aliphatic-hydroxy side chains is serine and threonine; a group of amino acids with amide-containing side chains is asparagine and glutamine; a group of amino acids with aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids with basic side chains is lysine, arginine, and histidine; and a group of amino acids with sulfur-containing side chains is cysteine and methionine. In one embodiment, a conservative amino acid substitution group is: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Substitution variants of the amino acid sequences disclosed herein are variants in which at least one residue in the disclosed sequence has been removed and a different residue has been inserted in its place. Preferably, the amino acid changes are conservative. In one embodiment, conservative substitutions for each naturally occurring amino acid are as follows: Ala to Ser; Arg to Lys; Asn to Gln or His; Asp to Glu; Cys to Ser or Ala; Gln to Asn; Glu to Asp; Gly to Pro; His to Asn or Gln; Ile to Leu or Val; Leu to Ile or Val; Lys to Arg; Gln or Glu; Met to Leu or Ile; Phe to Met, Leu or Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp or Phe; and Val to Ile or Leu.

[0050] The nucleotide sequences of the present invention can also be defined by their ability to hybridize to portions of the specific nucleotide sequences disclosed herein, respectively, under moderate hybridization conditions or, preferably, under stringent hybridization conditions. Stringent hybridization conditions are defined herein as conditions that allow a nucleic acid sequence of at least about 25 nucleotides, preferably about 50, 75, or 100 nucleotides, most preferably about 200 or more nucleotides to hybridize at a temperature of about 65° C. in a solution comprising about 1M salt (preferably 6xSSC or any other solution with comparable ionic strength), and washed at 65° C. in a solution comprising about 0.1M or less salt (preferably 0.2x SSC or any other solution with comparable ionic strength). Preferably, hybridization is performed overnight, i.e., for at least 10 hours; and preferably, washing is performed for at least one hour, with the washing solution being changed at least twice. These conditions will typically allow specific hybridization of sequences with about 90% or higher sequence identity. Moderate conditions are defined herein as conditions that allow a nucleic acid sequence of at least 50 nucleotides, preferably about 200 or more nucleotides, to hybridize at a temperature of about 45° C. in a solution comprising about 1M salt (preferably 6x SSC or any other solution with a comparable ionic strength) and washed at room temperature in a solution comprising about 1M salt (preferably 6x SSC or any other solution with a comparable ionic strength). Preferably, hybridization is performed overnight, i.e., for at least 10 hours; and preferably, washing is performed for at least one hour, with the washing solution being changed at least twice. These conditions will typically allow specific hybridization of sequences with up to 50% sequence identity. One skilled in the art will be able to modify these hybridization conditions to specifically identify sequences with identities varying between 50% and 90%.

[0051] "Expression" refers to the transcription of a gene into structural RNA (rRNA, tRNA) or messenger RNA (mRNA), followed by translation into protein.

[0052] "Overexpression" refers to the expression of a gene (corresponding to a nucleic acid sequence) by a recombinant cell in excess of its expression in a corresponding wild-type cell. Such overexpression can be achieved, for example, by increasing the frequency of transcription of one or more nucleic acid sequences, for example by operably linking the nucleic acid sequence to a promoter functional in the recombinant cell; and / or by increasing the copy number of a nucleic acid sequence.

[0053] The term "upregulation" and its variants refer to a process by which a cell increases the amount of a cellular component (such as RNA or protein). Such upregulation can be in response to or caused by a genetic modification.

[0054] The term "pathway" or "metabolic pathway" is understood herein as a series of chemical reactions that build and break down molecules in a cell.

[0055] The nucleic acid sequence (ie, polynucleotide) or protein (ie, polypeptide) may be native or heterologous to the genome of the host cell.

[0056] "Native," "homologous," or "endogenous" with respect to a host cell means that the nucleic acid sequence does exist naturally in the genome of the host cell, or that the protein is naturally produced by the cell. The terms "native," "homologous," and "endogenous" are used interchangeably herein.

[0057] As used herein, "heterologous" or "exogenous" can refer to nucleic acid sequences or proteins. For example, with respect to host cells, "heterologous" can refer to polynucleotides that are not naturally present in the genome of the host cell in this way, or polypeptides or proteins that are not naturally produced by the cell in this way. A heterologous nucleic acid sequence is a nucleic acid derived from an alien species, or if from the same species, it is substantially modified in composition and / or genomic locus relative to its native form by deliberate human intervention. For example, a promoter operably linked to a natural structural gene is from a species different from the species from which the structural gene was derived, or if from the same species, one or both are substantially modified relative to their original form. A heterologous protein can be derived from an alien species, or if from the same species, it is substantially modified relative to its original form by deliberate human intervention. In other words, heterologous protein expression relates to the expression of a protein that is not naturally expressed in this way in a host cell. The term "heterologous expression" refers to the expression of heterologous nucleic acids in a host cell. The expression of heterologous proteins in eukaryotic host cell systems (such as Escherichia coli) is well known to those skilled in the art. Polynucleotides containing nucleic acid sequences encoding genes for proteins or enzymes having specific activities can be expressed in such eukaryotic systems. In some embodiments, transformed / transfected cells can be used as expression systems for expressing enzymes. The expression of heterologous proteins in E. coli is well known. Published by Cold Spring Harbor Laboratory, is a recognized work describing various methods for expressing proteins in E. coli.

[0058] As used herein, a "promoter" is a DNA sequence that directs the transcription of a (structural) gene or other (partial) nucleic acid sequence. Suitably, the promoter is located in the 5' region of the gene, near the transcription start site of the (structural) gene. The promoter sequence can be constitutive, inducible or repressible. In one embodiment, no (external) inducer is required.

[0059] As used herein, the term "vector" includes reference to autosomal expression vectors and integration vectors for integration into a chromosome.

[0060] The term "expression vector" refers to a linear or circular DNA molecule comprising a segment encoding a polypeptide of interest, which segment is under the control of (i.e., operably linked to) another nucleic acid segment that provides for its transcription. Such additional segments may include promoter and terminator sequences, and may optionally include one or more origins of replication, one or more selectable markers, enhancers, polyadenylation signals, and the like. Expression vectors are typically derived from plasmid or viral DNA, or may contain elements of both.

[0061] "Plasmid" refers to autonomously replicating extrachromosomal DNA that is not integrated into the genome of a microorganism and is typically circular in nature.

[0062] "Host cell" is understood herein to be a cell (such as an E. coli cell) that is transformed with one or more nucleic acid sequences encoding one or more heterologous proteins to create a transformed cell (also referred to as a recombinant cell). For example, a transformed cell can contain a vector and can support replication and / or expression of the vector.

[0063] As used herein, "conversion" refers to that exogenous polynucleotides are inserted into a host cell, without considering the method for insertion, such as direct uptake, transduction, f-engagement or electroporation. Exogenous polynucleotides can be maintained as a non-integrated vector (e.g., plasmid), or alternatively can be integrated into the host cell genome. As used herein, "conversion" refers to that exogenous polynucleotides (i.e., exogenous nucleic acid sequence) are inserted into a host cell, without considering the method for insertion, such as direct uptake, transduction, f-engagement or electroporation. Exogenous polynucleotides can be maintained as a non-integrated vector (e.g., plasmid), or alternatively can be integrated into the host cell genome.

[0064] The present disclosure is further described in detail below in conjunction with specific embodiments. The examples provided are intended only to illustrate the present disclosure and are not intended to limit the scope of the present disclosure. The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0065] In the following examples, Escherichia coli BW25113 (Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 2000; 97(12):6640-6645.) is a non-pathogenic bacterium with a clear genetic background, a short generation time, easy cultivation, and low-cost culture medium raw materials.

[0066] It will be understood by those skilled in the art that the genes disclosed herein or their functional homologs comprise nucleic acid sequences having at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity to the exemplified sequences, or amino acid sequences having one or more mutations, substitutions, insertions and / or deletions when compared to the amino acid sequences encoded thereby.

[0067] Preferably, the amino acid sequence encoded by any functional homolog of a gene has no more than 300, no more than 250, no more than 200, no more than 150, no more than 100, no more than 75, no more than 50, no more than 40, no more than 30, no more than 20, no more than 10 or no more than 5 amino acid mutations, substitutions, insertions and / or deletions compared to the amino acid sequence encoded by a gene.

[0068] By way of example and not limitation, the functional homolog of the BmMedh2 gene shown in SEQ ID NO.6 comprises a nucleic acid sequence having at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with any of those nucleic acid sequences, or a functional homolog thereof comprises a nucleic acid sequence having one or more mutations, substitutions, insertions and / or deletions when compared to any of those nucleic acid sequences; preferably, the nucleic acid sequence of any such functional homolog has no more than 300, no more than 250, no more than 200, no more than 150, no more than 100, no more than 75, no more than 50, no more than 40, no more than 30, no more than 20, no more than 10 or no more than 5 nucleic acid mutations, substitutions, insertions and / or deletions compared to such nucleic acid sequences. More preferably, the functional homolog of the BmMedh2 gene comprises an amino acid sequence having at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with the polypeptide represented by SEQ ID NO.1.

[0069] Those skilled in the art will appreciate that other sequences include the above situations.

[0070] Unless otherwise specified herein, the nouns and terms used herein should be understood in accordance with the common knowledge and usage of persons of ordinary skill in the art. Unless otherwise noted, the specific operating methods employed in this application (including preparation processes, experimental procedures, detection methods, etc.) employ conventional biochemical experiments, cell biology experiments, molecular biology experiments, gene editing (e.g., recombinant DNA technology), zoology experiments, and related techniques in the art. These techniques are well described in the existing literature, see Sam Brook et al., Molecular Cloning: a Laboratory Manual, 4th edition, Cold Spring Harbor Laboratory Press, 2012; Ausubel et al., Current Protocols in Molecular Biology, Wiley Online Publishing, updated from time to time; Kursad Turksen et al., Embryonic Stem Cell Protocols, 3rd edition, Springer, 2016; P. Nagarajan et al., Essentials of Laboratory Animal Science: Principles and Practices, Springer, 2021; and Jann Hau et al., Handbook of Laboratory Animal Science: Essential Principles and Practices, 4th edition, CRC Press, 2021.

[0071] The plasmids, endonucleases, PCR enzymes, column-based DNA extraction kits, DNA gel recovery kits, Gibson ligation kits, and other commercial products used in the following examples were performed according to the kit instructions. Colony PCR, agarose gel electrophoresis, heat shock transformation, electroporation, competent cell preparation, and bacterial genome extraction and storage were performed according to the Molecular Cloning: A Laboratory Manual. Sequencing of plasmids and DNA products was performed by Qingke Biotechnology (Tianjin). The pBAD / HisB vector used in the following examples is a product of Invitrogen, catalog number V430-01; Escherichia coli DH5α was purchased from Beijing Qingke Biotechnology Co., Ltd., catalog number TSC01; and Escherichia coli BW25113 is a product of the NBRP E. coli strain (https: / / shigen.nig.ac.jp / ecoli / strain / resource / strainGeneMutant / list), catalog number ME9062.

[0072] 1. The culture medium of the present invention is as follows:

[0073] LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride.

[0074] LB solid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, and 15 g / L agar powder.

[0075] 2. Plasmids and strains

[0076] The expression vector plasmid was constructed using the Gibson assembly kit.

[0077] Table 1 Strains and plasmids involved in the following examples

[0078] Strain name genotype source BW25113 M00 BW25113,pBAD / HisB-WkMdh This application M01 BW25113,pBAD / HisB-BmMedh2-WkMdh This application M02 BW25113,pBAD / HisB-BmMedh2D41G-WkMdh This application M03 BW25113,pBAD / HisB-BmMedh2S97G-WkMdh This application M04 BW25113,pBAD / HisB-LsMedh-WkMdh This application M05 BW25113,pBAD / HisB-LsMedhT141S-WkMdh This application M06 BW25113,pBAD / HisB-LsMedhA164F-WkMdh This application M07 BW25113,pBAD / HisB-PpFadh This application M09 BW25113,pBAD / HisB-LrFdh-WkMdh This application M10 BW25113,pBAD / HisB-BmMedh2-PpFadh-LrFdh-WkMdh This application

[0079] 3. Primers

[0080] Table 2 Primers required in the following examples

[0081] Validation primers Sequence (5'-3') pYB1S-F gaattcggtgagctcggtctgcagctgg pYB1S-R ctcgaggctgccgcgcggcaccaggc pYB1S-BmMedh2-F cgcggcagcctcgagatgaaaaatacacaatcagctttttatatgccg WkMDH-BmMedh2-R catggtatatctccttttacatagcgttcttgataatttgaataacctc BmMedH2-WkMdh-F taaaaggagatataccatggaagctctggtcttgac pYB1S-WkMdh-R gagctcaccgaattcttaagcttcctcaccaccgattttaac pYB1S-LsMedh2-F cgcggcagcctcgagatgtcagatgttctaaaacaatttgtaatg WkMDH-LsMedh2-R catggtatatctccttttaggacagtgcaacagcttccag LsMedH2-WkMdh-F taaaaggagatataccatggaagctctggtcttgac pYB1S-WkMdh-R gagctcaccgaattcttaagcttcctcaccaccgattttaac pYB1S-PpFadh-F ccgcgcggcagcctcgagatgtctggtaaccgtggtgttgtttac pYB1S-PpFadh-R ctcaccgaattcaccactagtttaagccgcagagaagtcttgtg pYB1S-WkMdh-F cgcggcagcctcgagatggagctctggtcttgactggcctt pYB1S-WkMdh-R gagctcaccgaattctccagggtaagttcatgggacatcagc pYB1S-WkMdh-F cgcggcagcctcgagatggaagctctggtcttgactggcc pYB1S-LrFdh-R caccgaattcttacttcgcaacggagtagcttgc pYB1S-PpFadh-F <![CDATA[ ccgcgcggcagcctcgagatgtctggtaatcgtggtgtcg ]]> BmMedh2-PpFadh-R ggttaattcctccttcaggccgcgctgaaggtcttg PpFadh-BmMedh2-F aggaggattaccatgaaaaatacacaatcagctttttatatgccg LrFdH-BmMedh2-R atatctccttgaattcaccttacatagcgttcttgataatttgaataacctc BmMedh2-LrFdh-F taaggtgaattcaaggagatataccatggctaaaatatttgtgtactatatgatgacccgg WkMDH-LrFdh-R catagctactccgttgcgaagtaaagggatataccatgg LrFdH-WkMdh-F taaaggagatataccatggaagctctggtcttgac pYB1S-WkMdh-R gagctcaccgaattcttaagcttcctcaccaccgattttaac pYB1S-VF aagattagcggatcctacctg pYB1S-VR tggcagttccctactctc

[0082] Example 1. Construction and application of engineered bacteria co-expressing methanol dehydrogenase and mannitol dehydrogenase

[0083] 1. Construction of recombinant strains M00 and M01

[0084] (1) Construction of M00: Construction of the recombinant plasmid pBAD / HisB-WkMdh and its mutants: The pBAD / HisB vector was amplified by PCR and the vector fragment was recovered. The artificially synthesized Mdh gene fragment was amplified using primers pYB1S-WkMdh-F and pYB1S-WkMdh-R (synthesized by Qingke Biotechnology) and then ligated with the recovered vector fragment using the Gibson method (Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, 3rd, Smith HO: Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 2009, 6:343-345.) to obtain a ligation product. The ligation product was transformed into DH5α competent cells and coated on LB solid plates containing streptomycin. The cells were grown at 37°C overnight, and single clones were picked to extract plasmids. The plasmids were sequenced and verified using primers pYBS-VF and pYBS-VR. The vector with the correct sequence was named pBAD / HisB-WkMdh.

[0085] Among them, Mdh is derived from WkMdh of Weissella koreensi (UniProt ID: A0A7H1MNL6, ProteinSEQ ID: NO.5, DNA SEQ ID: NO.10).

[0086] The primers used for sequencing verification were pYB1S-VF and pYB1S-VR, and the sequence verified by sequencing included Mdh.

[0087] The correctly sequenced vector pBAD / HisB-WkMdH was transformed into Escherichia coli BW25113 by chemical transformation to obtain the recombinant engineered bacteria M00.

[0088] (2) Construction of M01: Construction of the recombinant plasmid pBAD / HisB-BmMedh2-WkMdh and its mutants: The pBAD / HisB vector was amplified by PCR using primers pYB1S-F and pYB1S-R, and the vector fragment was recovered; the artificially synthesized Medh gene fragment and Mdh gene fragment were amplified using primers pYB1S-BmMedh2-F, WkMdh-BmMedh2-R and BmMedh2-WkMdh-F, pYB1S-WkMdh-R and then recovered (synthesized by Qingke Biotechnology).

[0089] The target gene fragment and the recovered vector fragment were ligated using the Gibson method (Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, 3rd, Smith HO: Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 2009, 6:343-345.) to obtain a ligation product. The ligation product was transformed into DH5α competent cells and plated on a solid LB plate containing streptomycin. Incubate overnight at 37°C. Single colonies were selected to extract plasmids and verified by sequencing using primers pYB1S-VF and pYB1S-VR. The vector containing the correct sequence was named pBAD / HisB-BmMedh2-WkMdh.

[0090] Among them, Medh is derived from the methanol dehydrogenase BmMedh2 (UniProt ID: P31005, Protein SEQ ID: NO.1, DNA SEQ ID: NO.6) of Bacillus methanolicus; Mdh is derived from WkMDH of Weissella koreensi (UniProt ID: A0A7H1MNL6, Protein SEQ ID: NO.5, DNA SEQ ID: NO.10).

[0091] The primers used for sequencing verification were pYB1S-VF and pYB1S-VR, and the sequence verified by sequencing included Medh-Mdh.

[0092] The correctly sequenced vector pBAD / HisB-BmMedh2-WkMdh was transformed into Escherichia coli BW25113 by chemical transformation to obtain the recombinant engineered bacteria M01.

[0093] M01 can express methanol dehydrogenase and D-mannitol dehydrogenase. The methanol dehydrogenase sequence is described as (UniProt ID: P31005, Protein SEQ ID: NO.1, DNA SEQ ID: NO.6); the D-mannitol dehydrogenase sequence is described as (UniProt ID: A0A7H1MNL6, Protein SEQ ID: NO.5, DNA SEQ ID: NO.10).

[0094] 2. Inducible expression

[0095] The induction expression process of different strains is exactly the same. The following takes M01 as an example;

[0096] (1) Streak the recombinant strain M01 onto an LB plate containing 1.5 g / 100 mL agar (containing 50 μg / mL streptomycin) and culture at 37°C for 12 h. Pick a single colony and inoculate it into liquid LB medium containing 50 μg / mL streptomycin. Culture it at 37°C with shaking at 220 rpm for 10 h.

[0097] (2) The culture was inoculated into 500 mL of LB medium at a volume percentage of 1%, and cultured at 37°C with shaking for 3 h. Arabinose with a final concentration of 2 g / L was added to induce expression, and cultured at 30°C with shaking for 12 h.

[0098] 3. After induced expression, the engineered bacteria are used to produce D-mannitol

[0099] The process of producing D-mannitol after induced expression in different strains is exactly the same. The following takes M01 as an example;

[0100] After induced expression, the engineered bacteria M01 is used to produce D-mannitol, comprising the following steps:

[0101] (1) Substrate D-fructose and methanol in a ratio of 1:1, 500 mM or 1 M, sodium phosphate solution 0.05 mol / L, NAD + The cofactor was added at a concentration of 1 mM. The engineered bacteria M01 was centrifuged and washed, then added at a concentration of 30 OD / ml. The pH of the reaction system was adjusted to 5.0-8.0, and the temperature of the reaction system was controlled at 37-42°C. The reaction was completed after 24 hours.

[0102] (2) The fermentation broth from step (1) was tested as follows: 1) 1 mL of fermentation broth was centrifuged at 12,000 rpm for 10 min, and the supernatant was collected for HPLC analysis. 2) HPLC analysis conditions: Shimadzu high-performance liquid chromatography (HPLC) system; column: 87 H column; detector: RID differential detector; mobile phase: 5 mM H2SO4; flow rate: 0.6 mL / min; column temperature: 60°C; injection volume: 10 μL. Each sample was tested for 25 min.

[0103] The operation was the same as that in the above embodiment. The constructed methanol dehydrogenase mutant plasmids pBAD / HisB-BmMedH2D41G-WkMdH and pBAD / HisB-BmMedH2S97G-WkMdH derived from Bacillus methanolicu were transformed into BW25113 to obtain engineered bacteria M02-M03.

[0104] The operation is the same as that in the above embodiment, and the constructed methanol dehydrogenase mutant of sphaericus Lysinibacillus and its plasmid mutant plasmids pBAD / HisB-LsMedH-WkMdH, pBAD / HisB-LsMedHT141S-WkMdH and pBAD / HisB-LsMedA164F-WkMdH are transferred into BW25113 to obtain engineered bacteria M04-M06.

[0105] 4. The engineered bacteria M00-06 was applied according to the above method, and the results are as follows:

[0106] Table 3 D-mannitol yield under different reaction conditions

[0107]

[0108] Example 2: Construction of plasmids expressing formaldehyde dehydrogenase and mannitol dehydrogenase and characterization of mixed bacteria

[0109] 1. Strain Construction

[0110] (1) Construction of recombinant plasmid pBAD / HisB-PpFadh: The pBAD / HisB vector was amplified by PCR using primers pYB1S-F and pYB1S-R, and the vector fragment was recovered. The artificially synthesized FadH gene fragment was amplified using primers pYB1S-PpFadh-F and pYB1S-PpFadh-R (synthesized by Qingke Biotechnology) and ligated with the recovered vector fragment using the Gibson method (Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, 3rd, Smith HO: Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 2009, 6:343-345.) to obtain a ligation product. The ligation product was transformed into DH5α competent cells and coated on LB solid plates containing streptomycin. The cells were incubated at 37°C overnight, and single clones were picked to extract plasmids. The plasmids were sequenced and verified using primers pYB1S-VF and pYB1S-VR. The vector with the correct sequence was named pBAD / HisB-PpFadh.

[0111] Among them, Fadh is derived from the formaldehyde dehydrogenase PpFadh (UniProt ID: P46154, Protein SEQ ID: NO.3, DNA SEQ ID: NO.8) of Pseudomonas putida.

[0112] The primers used for sequencing verification were pYB1S-VF and pYB1S-VR, and the sequence verified by sequencing included Fadh.

[0113] (3) The correctly sequenced vector pBAD / HisB-PpFadh was transformed into Escherichia coli BW25113 by chemical transformation to obtain the recombinant engineered bacteria M07.

[0114] (4) M07 can express formaldehyde dehydrogenase, wherein the formaldehyde dehydrogenase sequence is as described (UniProt ID: P46154, ProteinSEQ ID: NO.3, DNA SEQ ID: NO.8).

[0115] 2. Inducible expression

[0116] (1) Streak the recombinant bacteria M07 and M00 obtained in Example 1 onto LB plates containing 1.5 g / 100 mL agar (containing 50 μg / mL streptomycin) and culture at 37°C for 12 h. Pick a single colony and inoculate it into liquid LB medium containing 50 μg / mL streptomycin. Culture it at 37°C with shaking at 220 rpm for 10 h.

[0117] (2) The culture was inoculated into 500 mL of LB medium at a volume percentage of 1%, and cultured at 37°C with shaking for 3 h. Arabinose with a final concentration of 2 g / L was added to induce expression, and cultured at 30°C with shaking for 12 h.

[0118] 3. After induced expression, engineered bacteria M07 and M00 were used to produce D-mannitol

[0119] After induced expression, the engineered bacteria M07 and M00 are used to produce D-mannitol, comprising the following steps:

[0120] (1) Substrate D-fructose and formaldehyde in a ratio of 1:1, 100 mM-500 mM, sodium phosphate solution 0.05 mol / L, NAD + The cofactor addition amount was 1 mM, and the engineered bacteria M07 and M00 were added in a 1:1 ratio, each at 30 OD / ml. The pH of the reaction system was adjusted to 5.0-8.0, and the temperature of the reaction system was controlled at 37°C. The reaction was completed after 24 hours.

[0121] (2) The fermentation broth from step (1) was tested as follows: 1) 1 mL of fermentation broth was centrifuged at 12,000 rpm for 10 min, and the supernatant was collected for HPLC analysis. 2) HPLC analysis conditions: Shimadzu high-performance liquid chromatography (HPLC) system; column: 87 H column; detector: RID differential detector; mobile phase: 5 mM H2SO4; flow rate: 0.6 mL / min; column temperature: 60°C; injection volume: 10 μL. Each sample was tested for 25 min.

[0122] 4. The engineered bacteria M07 and M00 were applied according to the above method, and the results are as follows:

[0123] Table 4 D-mannitol yield under different reaction conditions

[0124]

[0125] Example 3. Construction and application of formaldehyde dehydrogenase-expressing strains and formate dehydrogenase and mannitol dehydrogenase co-expressing engineered bacteria

[0126] 1. Strain Construction

[0127] (1) Construction of recombinant plasmid pBAD / HisB-LrFdh-WkMdh and its mutants: The pBAD / HisB vector was amplified by PCR using primers pYB1S-F and pYB1S-R, and the vector fragment was recovered. The artificially synthesized Fdh gene fragment and Mdh gene fragment (synthesized by Qingke Bio) were amplified using primers pYB1S-WkMdh-F and pYB1S-LrFdh-R, and then ligated with the recovered vector fragment using the Gibson method (Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, 3rd, Smith HO: Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 2009, 6:343-345.) to obtain a ligation product. The ligation product was transformed into DH5α competent cells and coated on LB solid plates containing streptomycin. The cells were incubated at 37°C overnight, and single clones were picked to extract plasmids. The plasmids were sequenced and verified using primers pYB1S-VF and pYB1S-VR. The vector with the correct sequence was named pBAD / HisB-LrFdh-WkMdh.

[0128] (2) The recombinant plasmid pBAD / HisB-PpFadh is the engineered bacteria M07 in Example 2.

[0129] Among them, Fadh is derived from the formaldehyde dehydrogenase PpFadh (UniProt ID: P46154, Protein SEQ ID: NO.3, DNA SEQ ID: NO.8) of Pseudomonas putida; Fdh is derived from the formate dehydrogenase LrFdh (UniProt ID: A0A3D9Z0Y5, Protein SEQ ID: NO.4, DNA SEQ ID: NO.9) of Leuconostoc rapi; Mdh is derived from WkMdh of Weissella koreensi (UniProt ID: A0A7H1MNL6, Protein SEQ ID: NO.5, DNA SEQ ID: NO.10).

[0130] The primers used for sequencing verification were pYB1S-VF and pYB1S-VR, and the sequences verified by sequencing included Fadh or Fdh-Mdh.

[0131] (3) The correctly sequenced vector pBAD / HisB-LrFdh-WkMdh was transformed into Escherichia coli BW25113 by chemical transformation to obtain the recombinant engineered bacteria M09.

[0132] (4) M07 can express formaldehyde dehydrogenase, and M09 can express formate dehydrogenase and D-mannitol dehydrogenase. The sequence of formaldehyde dehydrogenase is as described in (UniProt ID: P46154, Protein SEQ ID: NO.3, DNA SEQ ID: NO.8); the sequence of formate dehydrogenase is as described in (UniProt ID: A0A3D9Z0Y5, Protein SEQ ID: NO.4, DNA SEQ ID: NO.9); and the sequence of D-mannitol dehydrogenase is as described in (UniProt ID: A0A7H1MNL6, Protein SEQ ID: NO.5, DNA SEQ ID: NO.10).

[0133] 2. Inducible expression

[0134] (1) Streak the recombinant strains M07 and M09 onto LB plates containing 1.5 g / 100 mL agar (containing 50 μg / mL streptomycin) and incubate at 37°C for 12 h. Pick a single colony and inoculate it into liquid LB medium containing 50 μg / mL streptomycin. Incubate at 37°C with shaking at 220 rpm for 10 h.

[0135] (2) The culture was inoculated into 500 mL of LB medium at a volume percentage of 1%, and cultured at 37°C with shaking for 3 h. Arabinose with a final concentration of 2 g / L was added to induce expression, and cultured at 30°C with shaking for 12 h.

[0136] 3. After induced expression, engineered bacteria M07 and M09 were used to produce D-mannitol

[0137] After induced expression, the engineered bacteria M07 and M09 were used to co-produce D-mannitol, comprising the following steps:

[0138] (1) The substrates D-fructose and formaldehyde were added in a ratio of 1:1, 50 mM or 500 mM, sodium phosphate solution was 0.05 mol / L, the cofactor addition amount was 1 mM, the engineered bacteria M07 and M09 were added in a ratio of 1:1, each at 30 OD / ml, the pH of the reaction system was adjusted to 5.0-8.0, and the temperature of the reaction system was controlled at 37 °C; the reaction was completed after 24 h.

[0139] (2) The fermentation broth from step (1) was tested as follows: 1) 1 mL of fermentation broth was centrifuged at 12,000 rpm for 10 min, and the supernatant was collected for HPLC analysis. 2) HPLC analysis conditions: Shimadzu high-performance liquid chromatography (HPLC) system; column: 87 H column; detector: RID differential detector; mobile phase: 5 mM H2SO4; flow rate: 0.6 mL / min; column temperature: 60°C; injection volume: 10 μL. Each sample was tested for 25 min.

[0140] 4. The engineered bacteria M07 and M09 were applied according to the above method, and the results are as follows:

[0141] Table 5 D-mannitol yield under different reaction conditions

[0142]

[0143] Example 4. Construction and application of engineered bacteria co-expressing methanol dehydrogenase, formaldehyde dehydrogenase, formate dehydrogenase, and mannitol dehydrogenase

[0144] 1. Strain Construction

[0145] (1) Construction of recombinant plasmid pBAD / HisB-PpFadh-BmMedh2-LrFdh-WkMdh and its mutants: pBAD / HisB vector was amplified by PCR using primers pYB1S-F and pYB1S-R, and the vector fragment was recovered. Artificially synthesized Fadh gene fragment, Medh gene fragment, Fdh gene fragment and Mdh gene fragment were amplified using primers pYB1S-PpFadh-F and BmMedh2-PpFadh-R, PpFadh-BmMedh2-F and LrFdH-BmMedh2-R, BmMedh2-LrFdh-F and WkMdh-LrFdh-R, LrFdh-WkMdh-F and pYB1S-WkMdh-R (synthesized by Qingke Biotechnology) and the recovered vector fragment was cloned and purified by Gibson method (Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, 3rd, Smith HO: Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 2009, 6:343-345.) to obtain a ligation product. The ligation product was transformed into DH5α competent cells and plated on a streptomycin-containing LB plate. Incubate overnight at 37°C. A single clone was selected to extract the plasmid and sequenced using primers pYB1S-VF and pYB1S-VR. The vector that was correctly sequenced was named pBAD / HisB-PpFadh-BmMedh2-LrFdh-WkMdh.

[0146] Among them, Medh is derived from the methanol dehydrogenase BmMedh2 (UniProt ID: P31005, Protein SEQ ID: NO.1, DNA SEQ ID: NO.6) of Bacillus methanolicus; Fadh is derived from the formaldehyde dehydrogenase PpFadh (UniProt ID: P46154, Protein SEQ ID: NO.3, DNA SEQ ID: NO.8) of Pseudomonas putida, and Fdh is derived from the formate dehydrogenase LrFdh (UniProt ID: A0A3D9Z0Y5, Protein SEQ ID: NO.4, DNA SEQ ID: NO.9) of Leuconostoc rapi; Mdh is derived from WkMdh of Weissellakoreensi (UniProt ID: A0A7H1MNL6, Protein SEQ ID: NO.5, DNA SEQ ID: NO.10).

[0147] The primers used for sequencing verification were pYB1S-VF and pYB1S-VR, and the sequence verified by sequencing included Fadh-Medh-Fdh-Mdh.

[0148] (2) The correctly sequenced vector pBAD / HisB-PpFadh-BmMedh2-LrFdhWkMdh was transformed into Escherichia coli BW25113 by chemical transformation to obtain the recombinant engineered bacteria M10.

[0149] (3) M10 can express methanol dehydrogenase, formaldehyde dehydrogenase, formate dehydrogenase and D-mannitol dehydrogenase, among which the sequence of methanol dehydrogenase is as described in (UniProt ID: P31005, Protein SEQ ID: NO.1, DNA SEQ ID: NO.6); the sequence of formaldehyde dehydrogenase is as described in (UniProt ID: P46154, Protein SEQ ID: NO.3, DNA SEQ ID: NO.8); the sequence of formate dehydrogenase is as described in (UniProt ID: A0A3D9Z0Y5, Protein SEQ ID: NO.4, DNA SEQ ID: NO.9); and the sequence of D-mannitol dehydrogenase is as described in (UniProt ID: A0A7H1MNL6, Protein SEQ ID: NO.5, DNA SEQ ID: NO.10).

[0150] 2. Inducible expression

[0151] (1) Streak the recombinant strain M10 onto an LB plate containing 1.5 g / 100 mL agar (containing 50 μg / mL streptomycin) and culture at 37°C for 12 h. Pick a single colony and inoculate it into liquid LB medium containing 50 μg / mL streptomycin. Culture it at 37°C with shaking at 220 rpm for 10 h.

[0152] (2) The culture was inoculated into 500 mL of LB medium at a volume percentage of 1%, and cultured at 37°C with shaking for 3 h. Arabinose with a final concentration of 2 g / L was added to induce expression, and cultured at 30°C with shaking for 12 h.

[0153] 3. After induced expression, engineered bacteria M10 is used to produce D-mannitol

[0154] After induction expression, the engineered bacteria M10 is used to co-produce D-mannitol, comprising the following steps:

[0155] (1) Substrate D-fructose and methanol in a ratio of 1:1, 50 mM-1 M, sodium phosphate solution 0.05 mol / L, NAD + The amount of cofactor added was 1 mM, the amount of engineered bacteria M10 added was 30 OD / ml, the pH of the reaction system was adjusted to 5.0-8.0, and the temperature of the reaction system was controlled at 37°C; the reaction was completed after 24 hours.

[0156] (2) The fermentation broth from step (1) was tested as follows: 1) 1 mL of fermentation broth was centrifuged at 12,000 rpm for 10 min, and the supernatant was collected for HPLC analysis. 2) HPLC analysis conditions: Shimadzu high-performance liquid chromatography (HPLC) system; column: 87 H column; detector: RID differential detector; mobile phase: 5 mM H2SO4; flow rate: 0.6 mL / min; column temperature: 60°C; injection volume: 10 μL. Each sample was tested for 25 min.

[0157] 4. The engineered bacteria M10 was applied according to the above method, and the results are as follows:

[0158] Table 6 D-mannitol yield under different reaction conditions

[0159]

[0160] In summary, the method for synthesizing D-mannitol based on one-carbon compounds provided by the present invention provides guidance for the multi-enzyme coupling production of other high value-added compounds.

[0161] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A genetically modified Escherichia coli for producing D-mannitol, wherein: The method overexpresses or enhances the expression of (1) methanol dehydrogenase Medh and / or formaldehyde dehydrogenase Fadh, (2) formate dehydrogenase Fdh and (3) mannitol dehydrogenase Mdh in the Escherichia coli, and the Escherichia coli produces D-mannitol enzymatically using (a) methanol and / or formaldehyde and (b) fructose as co-substrates.

2. The Escherichia coli according to claim 1, wherein The methanol dehydrogenase Medh is BmMedh2 or a mutant thereof derived from Bacillus methanolicus, or LsMedh2 or a mutant thereof derived from Lysinibacillus sphaericus; preferably, the gene encoding the methanol dehydrogenase BmMedh2 is shown in SEQ ID NO: 6, and the gene encoding the methanol dehydrogenase LsMedh2 is shown in SEQ ID NO:

7.

3. The Escherichia coli according to claim 1, wherein The formaldehyde dehydrogenase Fadh is PpFadh derived from Pseudomonas putida or a mutant thereof. Preferably, the gene encoding the formaldehyde dehydrogenase PpFadh is shown in SEQ ID NO:

8.

4. The Escherichia coli according to claim 1, wherein The formate dehydrogenase Fdh is LrFdh derived from Leuconostoc rapi or a mutant thereof. Preferably, the gene encoding the formate dehydrogenase Fdh is shown in SEQ ID NO:

9.

5. The Escherichia coli according to claim 1, wherein The mannitol dehydrogenase Mdh is WkMdh derived from Weissella koreensis or a mutant thereof. Preferably, the gene encoding the mannitol dehydrogenase Mdh is shown in SEQ ID NO:

10.

6. The Escherichia coli according to claim 1, wherein The Escherichia coli can use methanol and / or formaldehyde as a reducing agent and utilize methanol dehydrogenase and / or formaldehyde dehydrogenase as a catalyst. While the methanol dehydrogenase and / or formaldehyde dehydrogenase oxidizes methanol and / or formaldehyde, it provides reduced NADH and converts D-fructose into D-mannitol by coupling with mannitol dehydrogenase.

7. A method for producing D-mannitol, wherein: D-mannitol is produced enzymatically using the Escherichia coli according to any one of claims 1 to 6, methanol and / or formaldehyde as a reducing agent, and D-fructose as a substrate.

8. The method according to claim 7, wherein: When producing D-mannitol, one of the following two methods is used: (1) the bacteria induced to express overnight are crushed and resuspended in the reaction system; (2) the centrifuged bacteria are directly collected and added to the reaction system; wherein, the amount of each recombinant enzyme in the reaction system is converted according to the OD10-30 / mL of the bacteria expressing the enzyme protein, or replaced with an equal amount of lysis buffer, and the conversion time is 24h.

9. The method according to claim 6 or 7, wherein: In the buffer system used in the enzymatic catalysis process, the final concentration of the methanol compound is 50 mM-1 M and / or the final concentration of the formaldehyde compound is 50 mM-1 M, NAD + The final concentration of is 1 mM, the final concentration of fructose is 50 mM-1 M, the buffer system is a phosphate buffer, the buffer system has a pH value of 5-8, and the reaction temperature is 37-42 ° C.

10. Use of the Escherichia coli according to any one of claims 1 to 6 in producing D-mannitol.

Images