Candida antarctica lipase B mutant and application thereof

By mutation of the amino acid sequence of Candida Antarctic lipase B, the CALB mutant with improved thermal stability and catalytic activity was formed, and the problem of poor thermal stability was solved, and the synthesis of ethyl hexanoate and chlorogenic acid derivatives was achieved efficiently, and its application in biodiesel and other fields was expanded.

CN120442595APending Publication Date: 2025-08-08EAST CHINA UNIV OF SCI & TECH
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
CN202510632017.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-16
Publication Date
2025-08-08

AI Technical Summary

Technical Problem

The existing Candida Antarctic lipase B has poor thermal stability and low catalytic activity, which limits its demand for industrial applications.

Method used

By rationally designing and directing evolution of Candida Antarctic lipase B, mutating its amino acid sequence, forming a CALB mutant with improved thermal stability, and expressing the mutant in E. coli and Pichia cerevisiae, an immobilized enzyme preparation was prepared.

Benefits of technology

The catalytic activity of the mutant was increased by 2.1 times, and the half-life was increased by 4 times at 50°C. It was used for the esterification reaction to produce ethyl hexanoate, and the conversion rate of chlorogenic acid derivatives reached 74%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442595A_ABST
    Figure CN120442595A_ABST
Patent Text Reader

Abstract

The invention relates to screening and application of a Candida antarctica lipase B mutant. Specifically, the Candida antarctica lipase B mutant provided by the invention is obtained by carrying out rational design and directed evolution combined strategy mutation on the basis of a wild Candida antarctica lipase B gene sequence, and the amino acid sequence of the mutant is shown as SEQ ID NO.3. The invention also relates to a preparation method of the Candida antarctica lipase B mutant. The mutant has higher enzyme activity and thermal stability, the hydrolytic catalytic activity of the mutant is improved to 2.1 times of the original hydrolytic catalytic activity, and the half-life period of the mutant enzyme at 50 DEG C is prolonged by 4 times. On the basis, pichia pastoris is used as a host to express the mutant, and a strain with hydrolytic activity improved by 52% is obtained through high resistance screening. The lipase is prepared into an immobilized enzyme to be used in a synthetic reaction of chlorogenic acid derivatives, the highest conversion rate of chlorogenic acid reaches 74% in 24 hours, and the immobilized enzyme has a good industrial application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering and relates to a Candida antarctica lipase B mutant and its application. Specifically, the present invention relates to a lipase mutant expressed by a host cell such as Escherichia coli or Pichia pastoris and the use of the mutant catalyst in an esterification reaction. Background Art

[0002] Lipases, also known as triacylglycerol hydrolases, are enzymes that catalyze the hydrolysis of glycerides into glycerol and free fatty acids. Lipases are highly effective biocatalysts for a variety of reactions, including alcoholysis, acidolysis, aminolysis, glycerolysis, esterification, and transesterification. Lipases also exhibit stereospecificity, regiospecificity, substrate selectivity, and site selectivity, as well as a mild catalytic process, low energy consumption, few byproducts, and environmental friendliness. Consequently, they are widely used in various fields, including food, biodiesel, and fine chemicals.

[0003] Ethyl hexanoate is an important fine chemical and a component of biodiesel. Due to its low boiling point and high volatility, it can be used in the production of fragrances and is widely used in the cosmetics industry.

[0004] Chlorogenic acid (CA) is a phenolic compound found in many natural plants and possesses antioxidant, anti-inflammatory, antibacterial, and anti-tumor activities. The hydrophilic functional groups of one carboxyl group and five hydroxyl groups in its structure make chlorogenic acid highly water-soluble. However, its miscibility with lipid preparations and limited skin permeability restrict its use in lipid-based pharmaceuticals, nutritional supplements, and cosmetics. Therefore, increasing the lipophilicity of chlorogenic acid through esterification is of great significance.

[0005] Among the many microbial lipases, CALB (Candida antarctic lipase B) is the most widely used, exhibiting strong catalytic activity towards both water-insoluble and water-soluble substances. However, existing CALB lipases suffer from poor thermal stability and low catalytic activity, limiting their industrial application. Obtaining lipases with high catalytic activity and enhanced thermal stability is crucial for industrial applications. Summary of the Invention

[0006] To overcome the poor thermal stability and low catalytic activity of the prior art lipase CALB, the present invention provides a CALB lipase mutant and its application. Specifically, the present invention relates to a CALB lipase mutant, a nucleic acid encoding the CALB mutant, a recombinant expression vector containing the nucleic acid, a recombinant expression transformant containing the recombinant expression vector, the preparation of a CALB mutant catalyst, and the application of the CALB mutant in an esterification reaction.

[0007] The present invention provides a CALB mutant having high catalytic activity and significantly improved thermal stability through protein engineering, random mutation and rational design methods, a nucleic acid encoding the CALB, a recombinant expression vector containing the nucleic acid, a recombinant expression transformant containing the recombinant expression vector, the preparation of the CALB mutant catalyst, and the use of the CALB mutant or the CALB mutant catalyst in an esterification reaction.

[0008] Based on the scheme of the present invention, a CALB mutant is used as a catalyst to efficiently catalyze hexanoic acid and realize the enzymatic synthesis of ethyl hexanoate.

[0009] Based on the scheme of the present invention, the screened immobilized enzyme preparation can be used to catalyze chlorogenic acid and realize the enzymatic synthesis of chlorogenic acid derivatives.

[0010] The present invention provides a CALB mutant with improved thermal stability by rationally designing the protein structure, thereby improving its thermal stability and making it more effectively utilized in industry, thereby expanding its practical application value in fields such as biodiesel. The objectives of the present invention can be achieved through the following technical solutions.

[0011] One of the technical solutions of the present invention is to provide a CALB mutant with improved activity and thermal stability.

[0012] The CALB mutant is based on wild-type CALB and is obtained by modifying the thermal stability of CALB using a combination of computer-aided rational design and directed evolution. It is a derivative protein with improved thermal stability formed by replacing several amino acids in the amino acid sequence shown in SEQ ID No. 2.

[0013] In one embodiment of the present invention, the CALB mutant is obtained by replacing the alanine at position 146 of the amino acid sequence shown in SEQ ID No. 2 with glycine, the glycine at position 207 with alanine, the aspartic acid at position 223 with glycine, and the leucine at position 278 with methionine.

[0014] Technical solution 2 of the present invention: provides an isolated nucleic acid encoding the CALB mutant.

[0015] Technical solution three of the present invention: provides a recombinant expression vector comprising a nucleic acid encoding the CALB mutant.

[0016] The recombinant expression vector is obtained by cloning the CALB mutant nucleic acid into various expression vectors using conventional methods in the art. The expression vectors include various conventional vectors in the art, such as commercially available plasmids, phage, or viral vectors, preferably plasmids pET-22b(+) and pPIC9K.

[0017] Technical solution 4 of the present invention: provides a recombinant expression transformant comprising the CALB mutant nucleic acid or the recombinant expression vector.

[0018] The recombinant expression transformant can be prepared by transforming the above-mentioned recombinant expression vector into a host cell. The host cell is any conventional host cell in the art, as long as the recombinant expression vector can stably replicate on its own and the gene of the CALB mutant of the present invention carried by the host cell can be effectively expressed. The prokaryotic host cell is preferably Escherichia coli, and the eukaryotic host cell is preferably Pichia pastoris, and more preferably Escherichia coli. E. coli Rosetta (DE3) and Pichia pastoris GS115. The recombinant expression vector was transformed into Escherichia coli E. coli Rosetta (DE3) and Pichia pastoris GS115, the preferred recombinant expression transformants of the present invention can be obtained. The transformation methods described are conventional methods in the art, such as heat shock method, electroporation method, etc.

[0019] Technical solution five of the present invention: provides a method for preparing a CALB mutant enzyme solution.

[0020] The preferred method for preparing the CALB mutant of the present invention is: culturing the recombinant expression transformant as described above, and isolating and obtaining the recombinantly expressed CALB enzyme mutant.

[0021] The specific operations for culturing the recombinant expression transformant can be performed according to routine operations in the art.

[0022] The prokaryotic host cell is preferably the recombinant Escherichia coli described in the present invention, which is inoculated into LB medium containing ampicillin and chloramphenicol and cultured at 37°C. 600When the p-value reaches 0.5-1.0, induction is performed by adding β-D-isopropyl-thiogalactopyranoside (IPTG) to a final concentration of 0.1-0.5 mmol / L. Culture is continued at 20°C for 20 hours to efficiently express the CALB mutant of the present invention. After the culture is completed, the precipitated bacterial cells are collected by centrifugation to obtain the resting cells of the recombinant expression transformant. The resulting cells are suspended in Tris buffer (Tris-HCl, 20 mmol / L, pH 8.0), disrupted by ultrasonication, and the supernatant is collected to obtain the crude enzyme solution of the CALB mutant.

[0023] The eukaryotic host cells, preferably Pichia pastoris cells described herein, are inoculated into YPD medium and cultured overnight at 30°C. After 12 hours of culture, a 1% inoculation is made into BMGY medium. After 16-17 hours of culture at 30°C, the inoculation is carried out into BMMY fermentation medium. This allows for efficient expression of the CALB mutant described herein. After 4 days of culture, the supernatant is collected and concentrated to obtain a crude enzyme solution of the CALB mutant enzyme.

[0024] The present invention provides an enzyme specific activity assay: CALB activity is measured using a UV-visible spectrophotometer and calculated by detecting the change in the absorbance of p-nitrophenol at a wavelength of 405 nm. The activity assay system is 1 mL, including 970 μL of Tris-HCl buffer (50 mM, pH 8.0), 10 μL of the substrate p-nitrophenol octanoate (20 mM), and 10 μL of enzyme solution (diluted to an appropriate concentration). All substances in the system are added to a cuvette in sequence, mixed evenly, and placed in a UV spectrophotometer, and the change in absorbance is measured at 40°C. The unit of enzyme activity is defined as the amount of enzyme required to hydrolyze 1 μmol of p-nitrophenol per minute.

[0025] Technical Solution 7 adopted by the present invention: using the above-mentioned CALB mutant or the CALB mutant catalyst in an esterification reaction.

[0026] The esterification reaction can be carried out under conventional conditions for such reactions in the art. The application comprises the following steps: adding lyophilized CALB (or a CALB mutant or a CALB mutant catalyst) to n-heptane, adding hexanoic acid and ethanol, and reacting at 40°C. The concentration of hexanoic acid and ethanol is 0.6 M, and the reaction temperature is 40°C. The reaction is preferably carried out under stirring. After the reaction, the product content is determined by gas chromatography, and the reaction conversion is analyzed based on the hexanoic acid content.

[0027] After the reaction is completed, the reaction solution is extracted with n-heptane and filtered through an aqueous membrane.

[0028] Among them, the synthesis of ethyl hexanoate from hexanoic acid is a model reaction of esterification.

[0029] Compared to the prior art, the mutant enzymes of the present invention exhibited a 2.1-fold increase in hydrolytic activity and a 4-fold increase in half-life at 50°C. At 40°C, the optimal mutant achieved a 99% hexanoate conversion rate within 3 hours, compared to the wild-type.

[0030] The present invention adopts the eighth technical solution: using the CALB mutant described above to express in Pichia pastoris GS115. M3 The plasmid was electroporated into the GS115 strain, and after resistance screening on YPD plates containing 1 mg / mL, 2 mg / mL, 4 mg / mL, and 6 mg / mL Geneticin G418, a highly resistant strain was obtained.

[0031] Technical Solution 9 of the present invention employs the highly resistant strain described above, using diatomaceous earth and glutaraldehyde cross-linking to create an immobilized enzyme preparation. This preparation was used to prepare chlorogenic acid derivatives. After optimizing the reaction temperature, substrate molar ratio, and immobilized enzyme loading, the conversion rate of chlorogenic acid reached 74% within 24 hours. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the following will briefly introduce the drawings required for the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present application. For those of ordinary skill in the art, other drawings can also be obtained based on these drawings without inventive work. In all drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, the elements or parts are not necessarily drawn according to the actual scale.

[0033] Figure 1 is the force diagram of the interaction between CALB mutant and substrate;

[0034] Figure 2 is the SDS-PAGE image of the recombinant E. coli CALB mutant;

[0035] Figure 3 Recombinant plasmid pPIC9K-CALB M3 Linearized electropherogram;

[0036] Figure 4 Recombinant plasmid pPIC9K-CALB M3 Colony PCR electrophoresis diagram;

[0037] Figure 5 For pPIC9K-CALB M3High resistance screening of high-yield strains;

[0038] Figure 6 CALB lipase pPIC9K-CALB M3 -1 shake flask fermentation curve;

[0039] Figure 7 To optimize the reaction temperature in the synthesis of chlorogenic acid derivatives;

[0040] Figure 8 To optimize the molar ratio of substrate chlorogenic acid to octanol in the synthesis of chlorogenic acid derivatives;

[0041] Figure 9 To optimize the loading capacity of immobilized enzyme in the synthesis of chlorogenic acid derivatives. Specific implementation plan

[0042] The present invention is described in detail below with reference to specific embodiments.

[0043] Unless otherwise stated, the specific experiments in the following examples were performed according to conventional methods and conditions in the art, or in accordance with commercial instructions.

[0044] The sources of materials in the following examples are: recombinant wild-type CALB plasmid synthesized by GenScript; Escherichia coli E. coli Rosetta (DE3) competent cells and 2× Prime Star were purchased from Beijing Tiangen Biochemical Technology Co., Ltd.; Pichia pastoris GS115 was preserved in the laboratory.

[0045] Example 1 Construction of Antarctic Candida lipase B and its mutant plasmids Using the mutant A146G / L278M reported by Yu Xiaowei's team as the starting parent, a directed evolution approach was used to establish a 10,000-strain mutant library. Rescreening revealed sites D223G, N259D, and P280S. Pure enzyme verification yielded the mutant A146G / L278M / D223G. Based on this, a rational design approach, using PROSS and Fireprot, ultimately yielded the optimal mutant M3 (A146G / L278M / D223G / G207A). Upstream and downstream primers were designed for the proposed mutation sites.

[0046] The primers used are: A146G mutation (alanine at position 146 replaced by glycine): Upstream primer (SEQ ID No. 3): 5' CTGGTCCACTTGACGCGCCTGGCGGTATCCGC 3' Downstream primer (SEQ ID No.4): 5' GCGGATACCGCCAGGCCGTCAAGTGGACCAG 3' G207A mutation (glycine at position 207 replaced by alanine): Upstream primer (SEQ ID No.5): 5' CAGCTACCTGTTCAACGCGAAGAACGTTCA 3' Downstream primer (SEQ ID No.6): 5' TGAACGTTCTTCGCGTTGAACAGGTAGCTG 3' D223G mutation (aspartic acid at position 223 replaced by glycine): Upstream primer (SEQ ID No.7): 5' TCCGCTGTTCGTGATTGGCCACGCAGGTAG 3' Downstream primer (SEQ ID No.8): 5' CTACCTGCGTGGCCAATCACGAACAGCGGA 3' L278M mutation (leucine at position 278 replaced by methionine): Upstream primer (SEQ ID No.9): 5' GCTGCTGCGGCACTGATGGCACCGGCCGCA 3' Downstream primer (SEQ ID No.10): 5' TCGGCCGGTGCCATCAGTGCCGCAGCAGC 3' The gene sequence of wild-type Candida antarctica lipase CALB is shown in SEQ ID No. 1.

[0047] The PCR system consisted of 10 μL of PrimeSTAR (HS), 6 μL of ddH2O, 1 μL of DMSO, 1 μL each of the upstream and downstream primers, and 1 μL of the template plasmid. The PCR amplification program was as follows: 98°C pre-denaturation for 3 min, followed by 30 cycles of denaturation at 98°C for 10 s, annealing at 55°C for 15 s, extension at 72°C for 7 min, and finally incubation at 72°C for 10 min. PCR product digestion: After PCR amplification, 2 μL of DPn I and 2 μL of Cutsmart were placed in a 37°C incubator for 2-3 h to obtain the mutant plasmid.

[0048] Example 2 Preparation of recombinant Escherichia coli CALB and its mutants The mutant plasmid amplified in Example 1 was transformed into Escherichia coli E. coli Rosetta (DE3), pick the positive clones to obtain the recombinant expression transformant pET22b-M3 / E. coli Rosetta (DE3). The recombinant expression transformant was inoculated into an LB tube containing ampicillin and chloramphenicol at a final concentration of 50 μg / mL and cultured in a shaking incubator at 37°C for 8-12 h. The bacterial solution was then added to TB medium containing ampicillin and chloramphenicol at a final concentration of 50 μg / mL at a 1% (v / v) inoculum and cultured in a shaking incubator at 37°C for about 3 h until the OD value of the bacterial solution reached 0. 600 The pH value reached 0.6-0.8. IPTG (final concentration 0.1 mM) was then added and cultured in a shaker at 20°C for 20 h. After the culture, the cells were harvested by centrifugation at 8000 rpm for 10 min at 4°C. Resting cells were washed with saline and resuspended in 10 mL of Tris-HCl buffer (50 mM, pH 8.0) to obtain mutant wet cells.

[0049] The cell suspension was sonicated at 300 W for 4 s on, 6 s off, for a total of 15 min. The cell suspension was centrifuged (4°C, 12,000 rpm, 30 min), and the supernatant, which was the crude enzyme solution, was purified using a nickel column to obtain a pure mutant enzyme solution.

[0050] Example 3 Determination of the half-life of recombinant Candida antarctica lipase B and its mutants The pure enzyme solution obtained in Example 2 was kept warm in a 50°C water bath using Tris-HCl buffer (50 mM, pH 8.0). A certain amount of enzyme solution was taken out intermittently and placed on ice for 5 min before measuring its activity. The half-life was calculated using the first-order inactivation equation. V / V 0) = - k D t, half-life ( t 1 / 2 ) = 0.693 / k D . k D is the inactivation rate constant; V For residual vitality, V 0 is the initial vitality.

[0051] Table 1. Enzyme activity and thermal stability characterization of CALB mutants strains mutation site Specific enzyme activity (U / mg) 50℃ half-life (min) Half-life increase fold (Fold) WT - 22 8 1 M3 A146G / G207A / D223G / L278M 46 40.2 5

[0052] The crude enzyme solution obtained in Example 2 was lyophilized to produce lyophilized enzyme powder. Because n-heptane readily evaporates above 45°C, a 1 mL reaction was performed in a thermostatic reactor at 40°C. The reaction mixture contained 0.6 M hexanoic acid and ethanol, 5 mg of CALB lyophilized enzyme powder, and n-heptane as the reaction solvent. After 3 hours of reaction, the hexanoic acid conversion was calculated by gas chromatography.

[0053] Gas Chromatography: GC analysis using a CP column was performed as follows: 100°C for 3 min, then heated at 7°C / min to 130°C, then heated at 12°C / min to 180°C, where it was held for 1 min. Split ratio: 20:1, split injection; purge: 3.0 mL / min; column flow rate: 1.00 mL / min (carrier gas: helium); makeup gas: 30 mL / min; H2 flow rate: 30 mL / min; and air flow rate: 350 mL / min.

[0054] Under the above conditions, the conversion rate of the parent WT to ethyl hexanoate was 72%, while the mutant M3 had a reaction conversion rate of 99% due to its higher esterification activity.

[0055] Table 2. Results of ethyl hexanoate reaction catalyzed by CALB and its mutants strain number Conversion rate (%) WT 72 M3 99

[0056] The E. coli glycerol bacteria obtained in Example 2 were inoculated into LB test tubes and cultured overnight at 37°C. The plasmid was extracted and used Sac After linearization, the gel was cut and recovered. The plasmid recovered from the gel was electroporated with GS115 competent cells and then spread on MD plates containing 0.5 mg / ml G418 geneticin. Inverted in a 30°C incubator and cultured for 2 days. The transformants on the plate were gradually screened for resistance on YPD plates containing 1 mg / mL, 2 mg / mL, 4 mg / mL, and 6 mg / mL of G418. After high resistance screening, more than 30 recombinants were obtained. 10 clones were selected from the plate after high resistance screening containing 6 mg / mL G418 for PCR verification, of which 1 was a false positive. The remaining 9 strains of pPIC9K-CALB M3 After cultivation, a strain with the highest hydrolysis activity was obtained and named pPIC9K-CALB M3 -1, with a hydrolytic activity of 80 U / mL. After optimization of shake flask culture, the hydrolytic activity increased by 52% to 122 U / mL after 96 h of induction culture at 30°C, 220 rpm and the addition of 2% methanol.

[0057] Example 6 Synthesis of chlorogenic acid derivatives The pPIC9K-CALB obtained in Example 5 was M3The enzyme solution produced after expression and fermentation of the strain C. spp.-1 was freeze-dried to produce enzyme powder. Modified diatomaceous earth was added at a carrier-to-enzyme powder ratio of 20:1 and mixed thoroughly. The mixture was shaken at 16°C and 220 rpm for 6 hours. The mixture was then cross-linked with glutaraldehyde at a final concentration of 1% (v / v) for 3 hours. After immobilization, the precipitate was collected by centrifugation and freeze-dried to obtain the immobilized enzyme.

[0058] Immobilized enzymes were used to synthesize chlorogenic acid derivatives. First, the reaction temperature was optimized and set at 30°C, 40°C, 50°C, and 60°C, respectively. In a 1 mL system, the immobilized enzyme loading was 30 mg / mL, the molar ratio of chlorogenic acid to octanol was 1:300, and the reaction was carried out at 200 rpm. After 24 h of reaction, the highest conversion rate of chlorogenic acid (CA) was 31% at 50°C. Figure 7 As shown in Figure 2, after optimizing the molar ratio, the conversion rate of chlorogenic acid to chlorogenic acid esters reached 58% within 24 h. Figure 8 As shown in the results, after optimizing the loading amount of immobilized enzyme, under the optimal conditions of 50 °C, chlorogenic acid to octanol molar ratio of 1:500, and immobilized enzyme loading amount of 50 mg / mL, the maximum conversion rate of chlorogenic acid reached 74% in 24 h, which has the value of industrial application.

[0059] The above description of the embodiments is intended to facilitate understanding and use of the invention by those skilled in the art. It will be apparent that those skilled in the art can readily make various modifications to these embodiments and apply the general principles described herein to other embodiments without requiring inventive effort. Therefore, the present invention is not limited to the above-described embodiments. Improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A Candida antarctica lipase B mutant, characterized in that: In the amino acid sequence shown in SEQ ID No. 2, the alanine at position 146 was replaced by glycine, the glycine at position 207 was replaced by alanine, the aspartic acid at position 223 was replaced by glycine, and the leucine at position 278 was replaced by methionine.

2. A nucleic acid molecule, characterized in that The nucleic acid molecule contains the coding sequence of the Candida antarctica lipase B mutant according to claim 1.

3. A recombinant vector, characterized in that The recombinant vector contains the coding sequence of the Candida antarctica lipase B mutant according to claim 1.

4. A recombinant genetically engineered bacterium, characterized in that: The recombinant genetically engineered bacteria contains the recombinant vector according to claim 3, and the host cell includes a prokaryotic cell or a eukaryotic cell.

5. The host cell according to claim 4, wherein Escherichia coli cells and Pichia pastoris cells are preferred.

6. The method according to claim 5, wherein the hydrolase activity of the enzyme is increased by 52% in a Pichia pastoris host strain through G418 geneticin resistance screening.

7. Use of the Candida antarctica lipase B mutant according to claim 1 in the synthesis of ethyl hexanoate fragrance.

8. Use of the screened Candida antarctica lipase B mutant according to claim 6 in the synthesis of chlorogenic acid derivatives.

Citation Information

Cited By

  • Candida antarctica lipase B mutant and application thereof

    CN122012457A

  • Candida antarctica lipase b mutants and uses thereof

    CN122012457B