RNF / CLR / Cas / crRNA compound as well as preparation method and application thereof
Through the design of RNF/CLR/Cas/crRNA complexes, the nuclease activity of RNA nanoflower and Cas13a proteins is used to achieve rapid and accurate detection of nucleic acid molecules and mutation recognition, solving the problems of complex operation and long time in the prior art, and improving detection efficiency and accuracy.
Patent Information
- Application Number
- CN202510596435.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-09
- Publication Date
- 2025-08-08
AI Technical Summary
The existing RNA detection methods have problems such as complex operation, long time, low sensitivity and insufficient specificity in cancer diagnosis, making it difficult to achieve fast and accurate nucleic acid molecule localization and mutation detection.
The RNF/CLR/Cas/crRNA complex was used to pair the base complementary pairing of RNA nanoflowers with circular fluorescent reporter molecules and Cas/crRNA complexes, and combine the nuclease activity of the Cas13a protein to achieve specific recognition and efficient cleavage of the target RNA to generate fluorescent signals.
It realizes high sensitivity, specific detection and rapid signal amplification of nucleic acid molecules, can accurately identify target RNA in a short time and distinguish mutant base sequences, simplifies the operation process and is suitable for nucleic acid analysis in tissues and cells.
Smart Images

Figure HDA0005394718210000011 
Figure HDA0005394718210000021 
Figure HDA0005394718210000031
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of pharmaceutical biotechnology, and specifically relates to an RNF / CLR / Cas / crRNA complex and a preparation method and application thereof. Background Art
[0002] RNA plays a key role in the transmission and expression of genetic information. Its abnormal expression is closely linked to cell proliferation, differentiation, and apoptosis. Accurately identifying site-specific mutations in nucleic acids has profound implications for understanding mRNA function and early cancer diagnosis. Therefore, the development of rapid, sensitive, and highly specific mRNA detection methods is urgently needed, crucial for deeper understanding of mRNA function, cancer diagnosis, and the development of mRNA-based therapies.
[0003] Although conventional techniques such as Northern blot hybridization, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and microarrays have significantly improved people's understanding of the role of RNA in cancer and demonstrated the potential utility of RNA in clinical diagnosis, these methods still have limitations such as loss of temporal and spatial information and ignore the problem of tumor heterogeneity. Therefore, precise positioning of RNA in intact cells or tissues is critical for understanding the complex relationship between RNA and cancer.
[0004] The classic fluorescence in situ hybridization (FISH) technique uses base-complementary probes to analyze the subcellular distribution of RNA molecules in fixed cells and tissues. In recent years, emerging FISH techniques have garnered widespread attention. For example, the π-FISH rainbow technique utilizes U-shaped probes labeled with multiple fluorescent dyes to quantify intracellular RNA molecules through multi-stage hybridization. Furthermore, branched DNA and signal amplification are used to visualize individual RNA molecules. Although these techniques offer single-molecule signal resolution, their complex procedures and numerous steps, such as elution and buffer exchange, result in long analysis times (>10 hours), hindering their clinical application. Furthermore, the localized accumulation of a large number of probes around the target RNA reduces the hybridization efficiency of the probes with the target RNA due to increased steric hindrance. Therefore, there is an urgent need to develop a method that is convenient, widely applicable, highly sensitive, and highly specific to enable rapid and precise localization of RNA in tissues.
[0005] Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) is an adaptive immune defense system formed by prokaryotes to resist the invasion of foreign genetic material (such as phages and plasmids). The Cas13a effector protein contains two eukaryotic and prokaryotic nucleotide binding (Higher eukaryotes and prokaryotes nuceotide-binding, HEPN) domains and has ribonuclease (RNase) activity. The guide RNA (CRISPR RNA, crRNA) guides the Cas13a nuclease to precisely target and bind to the target single-stranded RNA site, triggering the conformational change of the ribonucleoprotein (RNP) complex. The two HEPN domains approach to form a catalytic site to activate its nuclease activity, which not only specifically cuts the target single-stranded RNA in cis, but also non-specifically cuts any other single-stranded RNA in trans. Due to its precise RNA targeting ability and efficient RNA cleavage activity, as well as convenient operation and low cost, the CRISPR / Cas13 system has been widely used in nucleic acid molecule detection, RNA imaging, transcriptome regulation and other fields. Summary of the Invention
[0006] In view of the problems and deficiencies in the prior art, the present invention aims to provide an RNF / CLR / Cas / crRNA complex and its preparation method and application.
[0007] To achieve the purpose of the invention, the technical solution adopted by the present invention is as follows:
[0008] A RNF / CLR / Cas / crRNA complex, which consists of an RNA nanoflower (RNF), a cyclic fluorescent reporter (CLR) and a Cas / crRNA complex, wherein the cyclic fluorescent reporter and the Cas / crRNA complex are bound to the RNA nanoflower through base complementary pairing.
[0009] According to the above-mentioned RNF / CLR / Cas / crRNA complex, preferably, the RNA nanoflower is prepared by rolling circle transcription reaction of a circular DNA template. More preferably, the reaction system of the rolling circle transcription is: 50 μL 1 μM circular DNA template, 10 μL 10×Transcription buffer, 0.5 μL 100 μM NTP (NTP is a mixture of ATP, GTP, CTP, UTP), 10 μL RNA polymerase and 28 μL water; the reaction conditions of the rolling circle transcription are: incubating the reaction mixture at 37°C for 2 hours, and then denaturing at 90°C for 10 minutes.
[0010] According to the above-mentioned RNF / CLR / Cas / crRNA complex, preferably, the circular DNA template is prepared by circularizing a linear single-stranded DNA template with a 5'-phosphorylated end using T4 DNA ligase. More preferably, the reaction system for the circularization reaction is: 1 μL of 100 μM long single-stranded DNA template, 1.5 μL of 100 μM Primer, 10 μL of 10×T4 DNA ligase buffer, and 82.5 μL of DEPC water; the reaction conditions for the circularization reaction are: heating at 95°C for 5 minutes, slowly cooling to 16°C, incubating at 16°C for 20-30 minutes, and then adding T4 DNA ligase for circularization to obtain a circular DNA template.
[0011] According to the above-mentioned RNF / CLR / Cas / crRNA complex, preferably, the linear single-stranded DNA template contains a promoter sequence, a sequence complementary to the crRNA in the Cas / crRNA complex, and a sequence complementary to the cyclic fluorescent reporter molecule. More preferably, the DNA sequence complementary to the crRNA in the Cas / crRNA complex is: a DNA sequence complementary to the crRNA A backbone region in the Cas / crRNA protein nucleic acid complex. Most preferably, the nucleotide sequence of the crRNA backbone region is as shown in Sequence 1, and Sequence 1 is: 5'-GGUUCAGUUAGUUAAUUUUUGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC-3'; the promoter is a T7 promoter.
[0012] According to the above-mentioned RNF / CLR / Cas / crRNA complex, preferably, the nucleotide sequence of the linear single-stranded DNA template is as shown in Sequence 2, and Sequence 2 is:
[0013] 5'-ATAGTGAGTCGTATTAACGTACCAACAACCTATTGTATCCCGGACT GACTTGGGTTCAGTTAGTTAATTTAGAGGCATATCCCT-3'.
[0014] According to the above-mentioned RNF / CLR / Cas / crRNA complex, preferably, the Cas / crRNA complex is composed of Cas protein and crRNA. More preferably, the preparation method of the Cas / crRNA complex is: mixing the Cas protein and crRNA in a buffer (HOMOS Buffer 2), incubating at room temperature for 10-15 minutes, and obtaining the Cas / crRNA complex; most preferably, the molar ratio of the Cas protein to crRNA is 1: (1-1.5).
[0015] According to the above-mentioned RNF / CLR / Cas / crRNA complex, preferably, the Cas protein is Cas12a protein or Cas13a protein; more preferably, the Cas protein is Cas13a protein.
[0016] According to the above-mentioned RNF / CLR / Cas / crRNA complex, preferably, the crRNA is a crRNA for specifically recognizing a nucleic acid molecule. More preferably, the nucleic acid molecule is a microRNA, a circRNA, or an mRNA. The nucleotide sequence of the crRNA is adjusted accordingly according to the sequence of the nucleic acid molecule to be recognized.
[0017] According to the aforementioned RNF / CLR / Cas / crRNA complex, preferably, the cyclic fluorescent reporter molecule is modified with a fluorescent group and a quencher group, and a spacer sequence is provided between the base modified with the fluorescent group and the base modified with the quencher group on the cyclic fluorescent reporter molecule. More preferably, the fluorescent group is Cy3 and the quencher is BHQ2.
[0018] According to the above-mentioned RNF / CLR / Cas / crRNA complex, preferably, the cyclic fluorescent reporter molecule is prepared by cyclizing a linear single-stranded fluorescent reporter molecule (SSR) with a 5'-end phosphorylated residue by T4 DNA ligase; more preferably, the nucleotide sequence of the linear single-stranded fluorescent reporter molecule is shown in Sequence 3, which is specifically:
[0019] 5'-CTCCCACTTGAGTTCCTGACTTTCCTATTGTATCCCCGGACTGTTTTAUUUUUTTATCATTTTCATCACGCG-3', and, starting from the 5' end, the 47th base of the linear single-stranded fluorescent reporter molecule nucleotide sequence is modified with a fluorescent group, and the 55th base is modified with a quenching group (i.e., the nucleotide sequence of the linear single-stranded fluorescent reporter molecule is:
[0020] 5'-CTCCCACTTGAGTTCCTGACTTTCCTATTGTATCCCCGGACTGTTT / iC y3dT / A / rU / / rU / / rU / / rU / / rU / T / iBHQ2dT / ATCATTTTCATCACGCG-3', iCy3dT indicates Cy3 modification on thymine T, iBHQ2dT indicates BHQ2 modification on thymine T, and rU indicates ribouridine that can be cleaved by Cas protein); further, the reaction system of the cyclization reaction is: 10 μL 100 μM ssR, 15 μL 100 μM CLR-Primer, 10 μL 10×T4 DNA ligase buffer and 82.5 μL DEPC water; the reaction conditions of the cyclization reaction are: heating at 95°C for 5 minutes, slowly cooling to 16°C, incubating at 16°C for 20-30 minutes, and then adding T4 DNA ligase and incubate at 16 °C overnight.
[0021] The second aspect of the present invention provides a method for preparing the RNF / CLR / Cas / crRNA complex described in the first aspect, comprising the following steps:
[0022] S1, compounding the RNA nanoflower with a cyclic fluorescent reporter molecule to obtain an RNA nanoflower-cyclic fluorescent reporter molecule complex;
[0023] S2. Compounding the RNA nanoflower-annular fluorescent reporter molecule complex with the Cas / crRNA complex to obtain the RNF / CLR / Cas / crRNA complex.
[0024] According to the above preparation method, preferably, the specific operation of step S1 is: mixing the RNA nanoflower and the cyclic fluorescent reporter molecule in water, incubating at 36-38°C for 30-60 minutes, and then centrifuging to remove the free cyclic fluorescent reporter molecule to obtain the RNA nanoflower-cyclic fluorescent reporter molecule complex. More preferably, the molar ratio of the RNA nanoflower to the cyclic fluorescent reporter molecule is 1:(10-15).
[0025] According to the above preparation method, preferably, the specific operation of step S2 is: mixing the RNA nanoflower-annular fluorescent reporter molecule complex with the Cas / crRNA complex, and incubating at 36-38°C for 30-60 minutes to obtain the RNF / CLR / Cas / crRNA complex. More preferably, the molar ratio of the RNA nanoflower-annular fluorescent reporter molecule complex to the Cas / crRNA complex is 1:1.
[0026] The third aspect of the present invention provides an application of the RNF / CLR / Cas / crRNA complex described in the first aspect in any of the following:
[0027] (A1) Application in the preparation of a product for specific detection of nucleic acid molecules in a sample;
[0028] (A2) Application in the preparation of a product for detecting base mutations in nucleic acid molecules in a sample;
[0029] (A3) Application in the preparation of products for fluorescence in situ hybridization tissue imaging;
[0030] (A4) Use in the preparation of products for tumor diagnosis.
[0031] According to the above application, preferably, the sample includes tissues, cells and tissue sections.
[0032] According to the above application, preferably, the nucleic acid molecule is microRNA, circRNA or mRNA.
[0033] According to the above application, preferably, the product is a preparation or a kit.
[0034] A third aspect of the present invention provides a method for detecting nucleic acid molecules in tissue sections, comprising the following steps:
[0035] (1) Paraffin-embedded tissue sections are dried, dewaxed, and digested in sequence;
[0036] (2) adding a blocking solution to the tissue of the tissue section treated in step (1), incubating at 35-39° C., removing the blocking solution after the incubation, and dropping the RNF / CLR / Cas / crRNA complex described in the first aspect above onto the tissue of the tissue section, and incubating at 35-39° C.;
[0037] (3) Washing the tissue slices processed in step (2), then dripping anti-fluorescence quenching sealing liquid onto the tissue slices to seal the slices, and performing fluorescence signal detection on the sealed tissue slices.
[0038] According to the above-mentioned tissue section nucleic acid molecule detection method, preferably, the blocking solution in step (2) is HOMOS Buffer; more preferably, the blocking solution is 1×HOMOS Buffer 2.
[0039] According to the above-mentioned method for detecting nucleic acid molecules in tissue sections, preferably, the cell nucleus dye in step (3) is DAPI (4',6-diamidino-2-phenylindole).
[0040] According to the above-mentioned tissue section nucleic acid molecule detection method, preferably, the anti-fluorescence quenching sealing liquid in step (4) is an anti-fluorescence quenching sealing liquid containing a nuclear dye; more preferably, the nuclear dye is DAPI (4',6-diamidino-2-phenylindole).
[0041] According to the above-mentioned tissue section nucleic acid molecule detection method, preferably, the specific operation of the digestion treatment in step (1) is: adding proteinase K (20ug / ml) to the tissue section and digesting at 40°C for 20min.
[0042] The principle of the RNF / CLR / Cas / crRNA complex of the present invention for specific detection of nucleic acid molecules in cells or tissue sections (such as Figure 1 shown) is:
[0043] The linear DNA template of the RNA nanoflower in the RNF / CLR / Cas / crRNA complex of the present invention contains a promoter (T7 promoter as an example), a region that binds to crRNA, and a base composition of a region that binds to a cyclic fluorescent reporter molecule. The phosphorylated 5' end of the linear DNA template is connected to the hydroxylated 3' end by T4 DNA ligase to cyclize the linear DNA template to form a circular DNA template, which is then rolled and transcribed into an RNA nanoflower under the action of T7 polymerase; the RNA nanoflower is combined with the cyclic fluorescent reporter molecule and the Cas protein (Cas13a as an example) to form a cyclic fluorescent reporter molecule. The Cas / crRNA complex was incubated at 37°C for 30 minutes and loaded with a cyclic fluorescent reporter molecule. The cyclic fluorescent reporter molecule has a sequence that is complementary to the RNA nanoflower and a fluorescent group and a quenching group connected by five base Us, so that the two are close to each other, causing the fluorescence of the fluorescent group to be quenched; after the RNF / CLR / Cas / crRNA complex recognizes the target RNA target, it stimulates the trans-cleavage activity of Cas13a to cut the five base Us on the cyclic fluorescent reporter molecule, separates the fluorescent group and the quenching group, thereby generating a fluorescent signal, thereby realizing the detection of targets in cells or tissue sections.
[0044] Compared with the prior art, the technical effects achieved by the present invention are:
[0045] (1) The RNF / CLR / Cas / crRNA complex of the present invention relies on the complementary pairing of RNA nanoflowers and Cas / crRNA complexes, so that the RNA nanoflowers carry Cas proteins to recognize targets and activate trans-cleavage activity, and then activate the circular reporter molecules also carried by the RNA nanoflowers, thereby generating in situ fluorescent signals and realizing specific detection of nucleic acid molecules.
[0046] (2) The RNF / CLR / Cas / crRNA complex of the present invention relies on the ability of Cas13a protein to recognize targets and its trans-cleavage activity, has high sensitivity and specificity, and can achieve high-gain signal amplification, can detect extremely trace nucleic acid molecules, and can also accurately identify low-abundance nucleic acid molecules.
[0047] (3) The RNA nanoflowers in the RNF / CLR / Cas / crRNA complex of the present invention bind to the cyclic fluorescent reporter molecules through base complementary pairing. Therefore, the RNA nanoflowers aggregate the cyclic fluorescent reporter molecules, which can increase the local concentration of the reporter molecules, thereby generating a fluorescent signal that can be captured by a laser confocal microscope.
[0048] (4) The RNF / CLR / Cas / crRNA complex of the present invention can be used to detect nucleic acid molecules (including miRNA, circRNA, mRNA, etc.) in tissues and cells. At the same time, it can also accurately distinguish the mutant base sequences in nucleic acid molecules, specifically detect the mutation sites in nucleic acid molecules, and rapidly activate the Cas protein to generate a specific signal when a mutation is detected, thereby improving the accuracy and reliability of detection.
[0049] (5) The recognition region of crRNA varies with the target, but its backbone remains unchanged. In the present invention, RNF is bound to the crRNA backbone region through base complementary pairing. Therefore, the sequence of RNF does not need to be uniquely designed according to the different recognition targets and is universal.
[0050] (6) Traditional tissue nucleic acid molecular detection methods are cumbersome and time-consuming, and it may take several hours or even days from sample processing to results. When the RNF / CLR / Cas / crRNA complex of the present invention is used for nucleic acid analysis and detection in tissue samples, it is only necessary to drop the RNF / CLR / Cas / crRNA complex onto the tissue sample. The RNF / CLR / Cas / crRNA complex can quickly bind to the target RNA and initiate the reaction, generating a detectable signal in a short time (incubation at 37°C for 30 minutes), and laser confocal microscopy imaging can be performed. There is no need for complicated elution and multiple rounds of hybridization processes. The operation method is simple, the detection time is short, and the detection efficiency is high. It can meet the clinical and scientific research needs for rapid results, and has obvious advantages in scenarios such as emergency diagnosis and rapid epidemic screening.
[0051] (7) The tissue section nucleic acid molecule detection method of the present invention only requires that the paraffin-embedded tissue sections be dried, dewaxed, digested, and sealed in sequence, and then the RNF / CLR / Cas / crRNA complex of the present invention be added to the tissue sections for incubation. After the incubation is completed, the tissue sections can be washed, nuclear stained, and sealed with an anti-fluorescence quenching sealing agent before laser confocal microscopy imaging. The operation is simple, and the integrated design simplifies the experimental process, reduces human operation errors, and reduces the professional skill requirements of the operator, making it easy to promote in different laboratories and clinical environments.
[0052] (8) This method uses HOMOS Buffer as a blocking solution for tissue section nucleic acid molecule detection. It has good compatibility with tissue sections and can perform efficient hybridization detection in a variety of tissue types. It can better preserve tissue morphology and RNA integrity, avoid detection deviations caused by improper tissue processing, and is suitable for research and diagnosis of various tissue samples. BRIEF DESCRIPTION OF THE DRAWINGS
[0053] Figure 1 Schematic diagram of the principle of detecting nucleic acid information in tissue sections using the CRISPR system nucleic acid probe provided by the present invention;
[0054] Figure 2 Figures 2 and 3 are the characterization results of the InCasRD complex of the present invention; Figure a is a 3% agarose gel electrophoresis band detection result of the InCasRD complex, Figures b and c are the results of measuring the Zeta potential and particle size of the InCasRD complex using a Zetasizer (Malvern); Figures d and e are the results of transmission electron microscopy (TEM) detection of the morphology of RNA nanoflowers and InCasRD complexes;
[0055] Figure 3 Figures 1 and 2 show the experimental results of the InCasRD complex of the present invention detecting SURVIVIN mRNA levels of different abundance in different cells: Figure a shows an in vitro fluorescence shearing experiment of InCasRD detecting SURVIVIN mRNA in vitro (T represents InCasRD); Figure b shows the experimental results of InCasRD imaging of SURVIVIN mRNA of different abundance in MCF-7 cells and MCF-10A cells; Figure c is a schematic diagram of a mixed culture of MCF-7 and MCF-10A at a ratio of 5:1; Figure d is an imaging result of a mixed culture of MCF-7 and MCF-10A; Figure E shows the results of InCasRD detecting MCF-7 tumor tissue and a comparison chart of HE results;
[0056] Figure 4Figure 1 shows the universality validation experimental results of the InCasRD complex of the present invention for detecting different types of RNA in cells and tissue sections. Figure a shows the results of InCasRD imaging of miRNA-21 at different abundances in KYSE30 cells and 293T cells; Figure b shows the results of InCasRD imaging of circRNA-1785 at different abundances in MCF-7 cells and MCF-10A cells; Figure c shows the results of InCasRD detection of KYSE30 tumor tissues compared with HE results.
[0057] Figure 5 The experimental results of the ability of the InCasRD complex of the present invention to detect single nucleotide mutations; wherein, Figure a is a schematic diagram of the crRNA designed for the L858R mutation site (L858R-3 is the crRNA designed in Example 4, L858R-6 is the crRNA designed in Example 5, L858R-9 is the crRNA designed in Example 6, L858R-12 is the crRNA designed in Example 7, and L858R-15 is the crRNA designed in Example 8); Figure b is the in vitro fluorescence shearing results and difference coefficients of differently modified crRNAs for L858R mutant and L858R wild type (WT represents wild type, MT represents mutant, L858R-3, L858R-6, L858R-9, L858R-12, and L858R-15 represent implementation examples, respectively). Example 4, Example 5, Example 6, Example 7, and InCasRD complex prepared in Example 8); Figure c is the first-generation sequencing result of the mutation status of the L858R mutation site of the EGFR gene in MCF-7 cells (L858R-WT) and H1975 cells (L858R-MT); Figure d is the laser confocal imaging result of the mixed culture of H1975 and MCF-7 cells (wherein, NC indicates that InCasRD targets RNA that is not contained in both H1975 and MCF-7 cells, and L858R-3, L858R-6, L858R-9, L858R-12, and L858R-15 represent the InCasRD complex prepared in Example 4, Example 5, Example 6, Example 7, and Example 8, respectively); Figure e is the fluorescence quantification result for H1975 and MCF-7 cells. DETAILED DESCRIPTION
[0058] Below in conjunction with specific embodiment, technical scheme of the present invention is clearly and completely described, and following embodiment is convenient for better understanding of the present invention, but does not limit the present invention.The experimental method in following embodiment, unless otherwise specified, is conventional method.The test material used in following embodiment, unless otherwise specified, is purchased from conventional biochemical reagent store.The quantitative test in following embodiment, all sets three replicates, and the result is averaged.
[0059] Example 1:
[0060] A RNF / CLR / Cas / crRNA complex, comprising an RNA nanoflower (RNF), a cyclic fluorescent reporter (CLR), and a Cas / crRNA complex; wherein the cyclic fluorescent reporter and the Cas / crRNA complex are bound to the RNA nanoflower through complementary base pairing.
[0061] The RNA nanoflower is prepared by a rolling circle transcription reaction of a circular DNA template; the circular DNA template is prepared by a circularization reaction of a linear single-stranded DNA template with a 5' end phosphorylated by T4 DNA ligase; the linear single-stranded DNA template contains a T7 promoter sequence (the nucleotide sequence of the T7 promoter is: 5'-TAATACGACTCACTATAGGG-3'), a sequence complementary to the crRNA backbone region in the Cas / crRNA complex, and a sequence complementary to the cyclic fluorescent reporter molecule. Further, the nucleotide sequence of the crRNA backbone region is shown in Sequence 1, and Sequence 1 is: 5'-GGUUCAGUUAGUUAAUUUUUGAUUUAGACUACCCCAAAAACGAAGGGGACUAA AAC-3'; the nucleotide sequence of the linear single-stranded DNA template is shown in Sequence 2, and Sequence 2 is:
[0062] 5'-ATAGTGAGTCGTATTAACGTACCAACAACCTATTGTATCCCGGACT GACTTGGGTTCAGTTAGTTAATTTAGAGGCATATCCCT-3'.
[0063] When the circular DNA template is subjected to a rolling circle transcription reaction to prepare RNA nanoflowers, the reaction system of the rolling circle transcription is: 50 μL 1 μM circular DNA template, 10 μL 10×Transcription buffer, 0.5 μL 100 μM NTP (NTP is a mixture of ATP, GTP, CTP, and UTP), 10 μL T7 RNA polymerase, and 28 μL DEPC water; the reaction conditions of the rolling circle transcription are: incubating the reaction mixture at 37°C for 2 hours, then denaturing at 90°C for 10 minutes, collecting the synthesized RNA nanoflowers by centrifugation (12000 rpm, 20 min), resuspending them in DEPC water, and storing them at 4°C for later use.
[0064] When a linear single-stranded DNA template is subjected to a circularization reaction using T4 DNA ligase to prepare a circular DNA template, the reaction system for the circularization reaction is: 1 μL of a 100 μM long single-stranded DNA template, 1.5 μL of a 100 μM Primer (the nucleotide sequence of the Primer is 5'-TAATACGACTCACTATAGGGAT-3'), 10 μL of 10×T4 DNA ligase buffer, and 82.5 μL of DEPC water; the reaction conditions for the circularization reaction are: heating at 95° C. for 5 minutes, slowly cooling to 16° C., incubating at 16° C. for 20-30 minutes, and then adding T4 DNA ligase for circularization to obtain a circular DNA template. The synthesized circular DNA template is collected by centrifugation (12,000 rpm, 20 min), resuspended in DEPC water, and stored at 4° C. for later use.
[0065] The cyclic fluorescent reporter molecule is modified with a fluorescent group and a quencher group, and a spacer sequence is provided between the base of the modified fluorescent group and the base of the modified quencher group. The fluorescent group is Cy3, and the quencher is BHQ2. The cyclic fluorescent reporter molecule is prepared by cyclizing a linear single-stranded fluorescent reporter molecule (SSR) with a phosphorylated 5' end using T4 DNA ligase. The reaction system for the cyclization reaction is: 10 μL of 100 μM SSR, 15 μL of 100 μM CLR-Primer (the nucleotide sequence of CLR-Primer is: 5'-TCAAGTGGGAGCGCGTGATGAA-3'), 10 μL of 10×T4 DNA ligase buffer, and 82.5 μL of DEPC water. The reaction conditions for the cyclization reaction are: heating at 95°C for 5 minutes, slowly cooling to 16°C, incubating at 16°C for 20-30 minutes, adding T4 DNA ligase, and incubating at 16°C overnight to obtain the cyclic fluorescent reporter molecule. Furthermore, the nucleotide sequence of the linear single-stranded fluorescent reporter molecule is shown in Sequence 3, which is specifically: 5'-CTCCCACTTGAGTTCCTGACTTTCCTATTGTATCCCCGGACTGTTTTAUUU UUTTATCATTTTCATCACGCG-3'. Moreover, starting from the 5' end, the 47th base of the nucleotide sequence of the linear single-stranded fluorescent reporter molecule is modified with a fluorescent group, and the 55th base is modified with a quenching group (i.e., the nucleotide sequence of the linear single-stranded fluorescent reporter molecule is:
[0066] 5'-CTCCCACTTGAGTTCCTGACTTTCCTATTGTATCCCCGGACTGTTT / iC y3dT / A / rU / / rU / / rU / / rU / / rU / T / iBHQ2dT / ATCATTTTCATCACGCG-3', iCy3dT indicates Cy3 modification on thymine T, iBHQ2dT indicates BHQ2 modification on thymine T, and rU indicates ribouridine that can be cleaved by Cas13a).
[0067] The Cas / crRNA complex is composed of Cas13a protein and crRNA. The preparation method of the Cas / crRNA complex is as follows: Cas protein and crRNA are mixed in HOMOS Buffer 2 at a molar ratio of 1:1.25, and incubated at room temperature for 10 minutes to obtain a Cas / crRNA complex. Wherein, the crRNA is a crRNA that recognizes the SURVIVIN mRNA site, and the nucleotide sequence of the crRNA is shown in Sequence 4, which is: 5'-GGUUCAGUUAGUUAAUUUUUGAUUUAGACUACCCCAAAAACGAAGGG GACUAAAACAAGCAGAAGAAACACUGGGCCAAGUCUG-3'. The nucleotide sequence of SURVIVIN mRNA is shown in Sequence 5, which is: 5'-CAGACUUGGCCCAGUGUUUCUUCUGCUU-3'.
[0068] The preparation method of the above-mentioned RNF / CLR / Cas / crRNA complex comprises the following specific steps:
[0069] S1. Dissolve RNA nanoflowers in DEPC water to prepare a 500 nM RNA nanoflower stock solution, dissolve the cyclic fluorescent reporter molecule in DEPC water to prepare a 10 μM cyclic fluorescent reporter molecule stock solution, mix the RNA nanoflower stock solution and the cyclic fluorescent reporter molecule stock solution in a molar ratio of 1:15, incubate at 37°C for 30 minutes, and after the incubation, centrifuge at 12000 rpm for 20 minutes to remove the free cyclic fluorescent reporter molecules to obtain the RNA nanoflower-cyclic fluorescent reporter molecule complex;
[0070] S2. Mix the RNA nanoflower-annular fluorescent reporter molecule complex with the Cas / crRNA complex in a molar ratio of 1:1, and incubate at 37° C. for 30 minutes to obtain the RNF / CLR / Cas / crRNA complex.
[0071] Example 2:
[0072] The content of Example 2 is basically the same as that of Example 1, except that:
[0073] The crRNA in the Cas / crRNA complex is a crRNA that recognizes the miRNA-21 site. The nucleotide sequence of the crRNA is shown in SEQ ID NO: 6, which is: 5'-GGUUCAGUUAGUUAAUUUUUGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUCAACAUCAGUCUGAUAAGCUA-3'. The nucleotide sequence of miRNA-21 is shown in SEQ ID NO: 7, which is: 5'-UAGCUUAUCAGACUGAUGUUGA-3'.
[0074] The preparation method of the above RNF / CLR / Cas / crRNA complex is the same as that in Example 1.
[0075] Example 3:
[0076] The content of Example 3 is basically the same as that of Example 1, except that:
[0077] The crRNA in the Cas / crRNA complex is a crRNA that recognizes the circRNA-1785 site. The nucleotide sequence of the crRNA is shown in SEQ ID NO: 8, which is: 5'-GGUUCAGUUAGUUAAUUUUUGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGCGACACUAUAGUCCCUAUAAGGUUACG-3'. The nucleotide sequence of circRNA-1785 is shown in SEQ ID NO: 9, which is: 5'-CGUAACCUUAUAGGGACUAUAGUGUCGC-3'.
[0078] The preparation method of the above RNF / CLR / Cas / crRNA complex is the same as that in Example 1.
[0079] Example 4:
[0080] The content of Example 4 is basically the same as that of Example 1, except that:
[0081] The crRNA in the Cas / crRNA complex is designed to recognize the L858R mutation site (L858R MT) of the EGFR gene. The nucleotide sequence of the crRNA is shown in Sequence 10, which is: 5'-GGUUCAGUUAGUUAAUUUUUGAUUUAGACUACCCCAAAAACGAA GGGGACUAAAACCCCGCCCAAAAUCUGUGAUCUUGACAUG-3' (the crRNA places the EGFR L858R mutation site at the 3rd position of the crRNA recognition region); the nucleotide sequence of the EGFR L858R mRNA is shown in Sequence 11, which is: 5'-CAUGUCAAGAUCACAGA UUUUGGGCGGGCCAAACUGCUGG-3'. The L858R mutation of the EGFR gene is a specific point mutation in the EGFR gene, specifically occurring at nucleotide 2573 of exon 21, where thymine (T) is mutated to guanine (G). This mutation causes the amino acid at position 858 of the encoded protein to change from leucine (L) to arginine (R), and is therefore called the L858R mutation.
[0082] The preparation method of the above RNF / CLR / Cas / crRNA complex is the same as that in Example 1.
[0083] Example 5:
[0084] The content of Example 5 is basically the same as that of Example 1, except that:
[0085] The crRNA in the Cas / crRNA complex is a crRNA designed to recognize the L858R mutation site (L858R MT) of the EGFR gene. The nucleotide sequence of the crRNA is shown in Sequence 12, which is: 5'-GGUUCAGUUAGUUAAUUUUUGAUUUAGACUACCCCAAAAACGAA GGGGACUAAAACUGGCCCGCCCAAAAUCUGUGAUCUUGAC-3' (the crRNA places the EGFR L858R mutation site at the 6th position of the crRNA recognition region); the nucleotide sequence of EGFR L858R mRNA is shown in Sequence 11, which is: 5'-CAUGUCAAGAUCACAGA UUUUGGGCGGGCCAAACUGCUGG-3'.
[0086] The preparation method of the above RNF / CLR / Cas / crRNA complex is the same as that in Example 1.
[0087] Example 6:
[0088] The content of Example 6 is basically the same as that of Example 1, except that:
[0089] The crRNA in the Cas / crRNA complex is a crRNA designed to recognize the L858R mutation site (L858R MT) of the EGFR gene. The nucleotide sequence of the crRNA is shown in Sequence 13, which is: 5'-GGUUCAGUUAGUUAAUUUUUGAUUUAGACUACCCCAAAAACGAA GGGGACUAAAACGUUUGGCCCGCCCAAAAUCUGUGAUCUU-3' (the crRNA places the EGFR L858R mutation site at position 9 of the crRNA recognition region); the nucleotide sequence of EGFR L858R mRNA is shown in Sequence 11, which is: 5'-CAUGUCAAGAUCACAGA UUUUGGGCGGGCCAAACUGCUGG-3'.
[0090] The preparation method of the above RNF / CLR / Cas / crRNA complex is the same as that in Example 1.
[0091] Example 7:
[0092] The content of Example 7 is basically the same as that of Example 1, except that:
[0093] The crRNA in the Cas / crRNA complex is a crRNA designed to recognize the L858R mutation site (L858R MT) of the EGFR gene. The nucleotide sequence of the crRNA is shown in Sequence 14, which is: 5'-GGUUCAGUUAGUUAAUUUUUGAUUUAGACUACCCCAAAAACGAA GGGGACUAAAACGCAGUUUGGCCCGCCCAAAAUCUGUGAU-3' (the crRNA places the EGFR L858R mutation site at the 12th position of the crRNA recognition region); the nucleotide sequence of EGFR L858R mRNA is shown in Sequence 11, which is: 5'-CAUGUCAAGAUCACAG AUUUUGGGCGGGCCAAACUGCUGG-3'.
[0094] The preparation method of the above RNF / CLR / Cas / crRNA complex is the same as that in Example 1.
[0095] Example 8:
[0096] The content of Example 8 is basically the same as that of Example 1, except that:
[0097] The crRNA in the Cas / crRNA complex is a crRNA designed to recognize the L858R mutation site (L858R MT) of the EGFR gene, and the nucleotide sequence of the crRNA is shown in Sequence 15, which is: 5'-GGUUCAGUUAGUUAAUUUUUGAUUUAGACUACCCCAAAAACGAA GGGGACUAAAACCCAGCAGUUUGGCCCGCCCAAAAUCUGU-3' (the crRNA places the EGFR L858R mutation site at the 15th position of the crRNA recognition region); the nucleotide sequence of EGFR L858R mRNA is shown in Sequence 11, which is: 5'-CAUGUCAAGAUCACAG AUUUUGGGCGGGCCAAACUGCUGG-3'.
[0098] The preparation method of the above RNF / CLR / Cas / crRNA complex is the same as that in Example 1.
[0099] Example 9:
[0100] The content of Example 9 is basically the same as that of Example 1, except that the Cas protein is Cas12a protein.
[0101] Characterization and functional analysis of the RNF / CLR / Cas / crRNA complex prepared by the present invention (hereinafter referred to as InCasRD for ease of description):
[0102] 1. Synthesis, identification and morphology characterization of InCasRD of the present invention:
[0103] Taking the InCasRD prepared in Example 1 as an example, the InCasRD complex of the present invention was characterized and functionally analyzed.
[0104] The InCasRD complex prepared in Example 1 of the present invention was electrophoretically detected using 1% agarose gel electrophoresis. Figure 2 As shown in a. Figure 2 As shown in Figure a, RNA nanoflowers were successfully synthesized.
[0105] Zeta potential and particle size of the InCasRD complex prepared in Example 1 of the present invention were tested using a Zetasizer (Malvern). The test results are as follows: Figure 2 As shown in b and c. Figure 2 As can be seen from b and c, the Zeta potential of the InCasRD complex is about -22 mV and the particle size is about 980 nm.
[0106] The InCasRD complex and RNF prepared in Example 1 of the present invention were subjected to transmission electron microscopy (TEM) detection, and the detection results are as follows: Figure 2 As shown in d and e. Figure 2 As can be seen from Figures d and e, the synthesized InCasRD presents a dense and uniformly dispersed condensed nanocarrier.
[0107] 2. Study on the ability of the InCasRD of the present invention to detect SURVIVIN mRNA levels of varying abundance in different cells:
[0108] Taking the InCasRD prepared in Example 1 as an example, the ability of the InCasRD complex of the present invention to detect SURVIVIN mRNA levels of different abundances in different cells was analyzed.
[0109] (1) Study on the ability of InCasRD complex to detect target RNA in vitro:
[0110] The InCasRD complex of Example 1 of the present invention was used to detect SURVIVIN mRNA in vitro. The specific experimental method was as follows: 1 μL 500 nM InCasRD complex prepared in Example 1 of the present invention, 2 μL 1 μM Target RNA (Target RNA is SURVIVIN mRNA), 2 μL 10×HOMOS Buffer 2 and 15 μL DEPC-treated water were mixed, incubated at 37°C for 30 minutes, and then fluorescence detection was performed using a microplate reader (λex: 550 nm; λem: 570 nm).
[0111] At the same time, for comparison, RNF / CLR complex and RNF / CLR / Cas / NT-crRNA complex were used to detect SURVIVIN mRNA in vitro, and the detection method was the same as above. The RNF / CLR complex (for ease of description, denoted as NC) consists of RNA nanoflowers (RNF) and cyclic fluorescent reporter molecules (CLR), which are bound to RNA nanoflowers (RNF) through base complementary pairing. Both RNA nanoflowers (RNF) and cyclic fluorescent reporter molecules (CLR) are the same as in Example 1. The RNF / CLR / Cas / NT-crRNA complex (for ease of description, denoted as NT) is composed of an RNA nanoflower (RNF), a cyclic fluorescent reporter (CLR) and a Cas / NT-crRNA complex. The cyclic fluorescent reporter (CLR) and the Cas / NT-crRNA complex are bound to the RNA nanoflower through base complementary pairing. The RNA nanoflower (RNF) and the cyclic fluorescent reporter (CLR) are the same as those in Example 1. The Cas / NT-crRNA complex is composed of Cas13a protein and NT-crRNA. NT-crRNA is an RNA sequence of a target that does not exist in humans or mice.
[0112] Test results such as Figure 3 As shown in a. Figure 3 As shown in Figure a, only when the InCasRD prepared in Example 1 of the present invention is used for detection, InCasRD can activate the trans-cleavage activity of Cas13a after detecting the target SURVIVIN mRNA, thereby separating the fluorescent group and the quenching group of the circular reporter molecule, and generating a strong fluorescent signal.
[0113] (2) Study on the ability of the InCasRD complex to detect target RNA at the cellular level:
[0114] The specific experimental method is as follows: MCF-7 cells and MCF-10A cells were cultured at 1×10 4 Cells were seeded on an iBiDi 8-well plate and cultured for 24 hours. The cells were washed with PBS, fixed with a methanol-acetic acid (1:1) fixative, washed with PBS, permeabilized with 0.5% Triton, and then blocked with 1× HOMOS Buffer 2. The InCasRD complex prepared in Experimental Example 1 of the present invention was added to the well plate and incubated for 30 minutes. An anti-fluorescence quencher containing DAPI was added, and laser confocal microscopy imaging was performed.
[0115] The results of laser confocal microscopy imaging are as follows Figure 3 As shown in b. Figure 3As shown in Figure b, InCasRD can detect SURVIVIN mRNA with different abundances in imaged MCF-7 cells and MCF-10A cells and present different numbers of fluorescence signals.
[0116] (3) Study on the ability of InCasRD complex to detect target RNA at the cellular level:
[0117] The target RNA (SURVIVIN mRNA) in the cell was detected using the InCasRD complex of Example 1 of the present invention. The specific experimental method was as follows: MCF-10A cells were stained with Mito-Tracker Green, and MCF-7 cells and MCF-10A cells stained with Mito-Tracker Green were mixed at a ratio of 1:5 (as shown in FIG. Figure 3 c) and then inoculated on an iBiDi 8-well plate and cultured for 24 hours. After fixation with methanol and acetic acid, the cells still had a green fluorescence signal. After washing with PBS, the cells were permeabilized with 0.5% Triton and blocked with 1× HOMOS Buffer 2. Then, the InCasRD prepared in Experimental Example 1 of the present invention was added to the well plate and incubated for 30 minutes. After that, an anti-fluorescence quencher containing DAPI was added, and laser confocal microscopy imaging was performed.
[0118] At the same time, for comparison, RNF / CLR complex and RNF / CLR / Cas / NT-crRNA complex were used to detect SURVIVIN mRNA in cells, respectively, using the same detection method. The RNF / CLR complex (for ease of description, denoted as NC) consists of RNA nanoflowers (RNF) and cyclic fluorescent reporter molecules (CLR), which are bound to RNA nanoflowers (RNF) through base complementary pairing. Both RNA nanoflowers (RNF) and cyclic fluorescent reporter molecules (CLR) are the same as in Example 1. The RNF / CLR / Cas / NT-crRNA complex (for ease of description, denoted as NT) is composed of an RNA nanoflower (RNF), a cyclic fluorescent reporter (CLR) and a Cas / NT-crRNA complex. The cyclic fluorescent reporter (CLR) and the Cas / NT-crRNA complex are bound to the RNA nanoflower through base complementary pairing. The RNA nanoflower (RNF) and the cyclic fluorescent reporter (CLR) are the same as those in Example 1. The Cas / NT-crRNA complex is composed of Cas13a protein and NT-crRNA. NT-crRNA is an RNA sequence of a target that does not exist in humans or mice.
[0119] The results of laser confocal microscopy imaging are as follows Figure 3 As shown in d. Figure 3As shown in Figure d, only when the InCasRD prepared in Example 1 of the present invention is used to detect SURVIVIN mRNA in cells can the Cas protein be activated, thereby separating the fluorescent group and quenching group of the circular reporter molecule, generating a strong fluorescent signal. This shows that InCasRD can specifically detect the target SURVIVIN mRNA at the cellular level.
[0120] (4) Study on the ability of InCasRD complex to detect target RNA at the tissue level:
[0121] The specific experimental method is as follows: the paraffin-embedded MCF-7 tissue sections were thoroughly dewaxed with a dewaxing transparent liquid, treated with 0.5% Triton at room temperature for 20 minutes, and blocked with 1×HOLMES Buffer 2 for 60 minutes. Then, the InCasRD complex (80 μL) prepared in Example 1 of the present invention was hybridized with the treated MCF-7 tissue sections and incubated at 37°C for 30 minutes. Then, anti-fluorescence quenching sealing liquid (anti-fluorescence quenching sealing liquid (containing DAPI) with the product number P0131-25ml produced by Biyuntian) was added to the tissue of the tissue sections for sealing. The sealed tissue sections were imaged with a laser confocal microscope for fluorescence signal detection, and the nucleic acid information of the tissue sections was detected and analyzed.
[0122] The results of laser confocal microscopy imaging are as follows Figure 3 As shown in e. Figure 3 As shown in Figure 5, after detecting the target, InCasRD can release and capture the target signal in situ. However, SURVIVIN mRNA is less abundant in normal tissue. The signal generated by InCasRD is highly consistent with the HE results, clearly distinguishing tumor tissue from normal tissue. This demonstrates that InCasRD can specifically detect the target SURVIVIN mRNA at the tissue section level.
[0123] The above experimental results show that the InCasRD complex can specifically detect target RNA in tissues and activate the trans-cleavage activity of Cas13a to cleave circular reporter molecules and generate fluorescent signals, and can image different fluorescent signal intensities according to the abundance of the target.
[0124] 3. Study on the ability of InCasRD complex to detect different types of RNA in cells
[0125] (1) Study on the ability of InCasRD complex to detect microRNA in cells
[0126] The InCasRD complex prepared in Example 2 of the present invention was used to detect miRNA-21 in KYSE30 cells and 293T cells.
[0127] The specific experimental method is as follows: KYSE30 cells and 293T cells were cultured at 1×10 4 The cells were seeded on an iBiDi 8-well plate and cultured for 24 hours. The cells were washed with PBS, fixed with a methanol-acetic acid (1:1) fixative, washed with PBS, permeabilized with 0.5% Triton, and then blocked with 1× HOMOS Buffer 2. The InCasRD complex prepared in Experimental Example 2 of the present invention was added to the well plate and incubated for 30 minutes. An anti-fluorescence quencher containing DAPI was added, and laser confocal microscopy imaging was performed.
[0128] The results of laser confocal microscopy imaging are as follows Figure 4 As shown in a. Figure 4 As shown in Figure a, InCasRD can detect miRNA-21 with different abundances in imaged KYSE30 cells and 293T cells, and present different numbers of fluorescent signals.
[0129] (2) Study on the ability of InCasRD complex to detect circRNA in cells
[0130] The InCasRD complex prepared in Example 3 of the present invention was used to detect circRNA-1785 in MCF-7 cells and MCF-10A cells.
[0131] The specific experimental method is as follows: MCF-7 cells and MCF-10A cells were cultured at 1×10 4 The cells were seeded on an iBiDi 8-well plate and cultured for 24 hours. The cells were washed with PBS, fixed with a methanol-acetic acid (1:1) fixative, washed with PBS, permeabilized with 0.5% Triton, and then blocked with 1× HOMOS Buffer 2. The InCasRD complex prepared in Experimental Example 3 of the present invention was added to the well plate and incubated for 30 minutes. An anti-fluorescence quencher containing DAPI was added, and laser confocal microscopy imaging was performed.
[0132] The results of laser confocal microscopy imaging are as follows Figure 4 As shown in b. Figure 4 As shown in Figure b, InCasRD can detect circRNA-1785 with different abundances in imaged MCF-7 cells and MCF-10A cells and present different numbers of fluorescence signals.
[0133] (3) Study on the ability of InCasRD complex to detect microRNA in tissue sections
[0134] The InCasRD complex prepared in Example 2 of the present invention was used to detect miRNA-21 in KYSE30 tumor tissue sections.
[0135] The specific experimental method is as follows: the paraffin-embedded KYSE30 tumor tissue sections were thoroughly dewaxed with a dewaxing transparent liquid, treated with 0.5% Triton at room temperature for 20 minutes, and blocked with 1×HOLMES Buffer 2 for 60 minutes. Then, the InCasRD complex (80 μL) prepared in Example 2 of the present invention was hybridized with the treated MCF-7 tissue sections and incubated at 37°C for 30 minutes. Then, anti-fluorescence quenching sealing liquid (anti-fluorescence quenching sealing liquid (containing DAPI) with the product number P0131-25ml produced by Biyuntian) was added to the tissue sections for sealing. The sealed tissue sections were imaged with a laser confocal microscope for fluorescence signal detection, and the nucleic acid information of the tissue sections was detected and analyzed.
[0136] HE staining involves thorough dewaxing with a dewaxing and clearing solution followed by rehydration with graded alcohol to restore tissue viability. Cell nuclei are then stained with alkaline hematoxylin solution, followed by differentiation with acidic alcohol and a weakly alkaline solution to enhance nuclear staining by blueing. The cytoplasm and collagen components are then stained with acidic eosin solution. Finally, the slides are dehydrated again with alcohol, cleared with xylene, and mounted with neutral gum for storage. Scanning under a white light microscope is then performed. This can be used to assess tumor type, degree of differentiation, invasion, and metastasis.
[0137] The results of laser confocal microscopy imaging are as follows Figure 4 As shown in c. Figure 4 As shown in Figure c, after detecting the target, InCasRD can release the signal in situ and capture it, while miR21 is less abundant in normal tissue. The signal generated by InCasRD is highly consistent with the HE results, clearly distinguishing tumor tissue from normal tissue.
[0138] The above experimental results show that the InCasRD complex of the present invention can detect different types of RNA in cells and tissue sections and has universal applicability.
[0139] 4. Study on the ability of InCasRD complex to detect single nucleotide variants
[0140] In order to investigate the ability of InCasRD to detect single nucleotide variations, the InCasRD complexes prepared in Examples 4 to 8 of the present invention were used to detect the mutation site L858R in the EGFR gene.
[0141] (1) Study on the ability of InCasRD complex to detect single nucleotide variants in vitro:
[0142] The specific experimental method is as follows: 1 μL of 500nM InCasRD complex prepared in Examples 4 to 8 of the present invention was mixed with 2 μL of 1 μM target RNA (target RNA is L858R MT), 2 μL of 10×HOMOS Buffer 2 and 15 μL DEPC-treated water, incubated at 37°C for 30 minutes, and then fluorescence was detected using a microplate reader (λex: 550nm; λem: 570nm). The detection results are shown in Figure 2. Figure 5 As shown in b.
[0143] Depend on Figure 5 As shown in Figure b, when the mutation site is placed in the third position of the crRNA recognition region, the signal-to-noise ratio is the largest, and the wild type and mutant types can be significantly distinguished.
[0144] (2) Study on the ability of InCasRD complex to detect single nucleotide variants in cells:
[0145] MCF-7 cells and H1975 cells were used as cell samples to study the ability of the InCasRD complex cells of the present invention to detect the EGFR gene L858R mutation site in cells.
[0146] First, the mutation of the EGFR gene L858R mutation site in MCF-7 cells and H1975 cells was verified. The specific experimental method is: MCF-7 cells (L858R wild type, i.e. L858R-WT) and H1975 cells (L858R mutant, i.e. L858R-MT) were sequenced to verify the mutation of the EGFR gene L858R mutation site in MCF-7 cells and H1975 cells. The test results are as follows: Figure 5 As shown in c.
[0147] Depend on Figure 5 As shown in Figure c, MCF-7 cells do not contain the L858R mutation, while H1975 cells do.
[0148] The specific experimental method for the ability of the InCasRD complex of the present invention to detect the L858R mutation site of the EGFR gene in cells is as follows: MCF-7 cells (L858R wild type, i.e., L858R-WT) were stained with Mito-Tracker Green, H1975 cells and MCF-7 cells stained with Mito-Tracker Green were mixed at a ratio of 1:5 and inoculated on an iBiDi 8-well plate for 24 hours. After the MCF-7 cells were fixed with methanol and acetic acid, they still had a green fluorescence signal. After washing the cells with PBS, the cells were permeabilized with 0.5% Triton and blocked with 1×HOMOS Buffer 2. The InCasRD prepared in Experimental Example 1 of the present invention was then added to the well plate and incubated for 30 minutes. After that, an anti-fluorescence quencher containing DAPI was added, and laser confocal microscopy imaging was performed. At the same time, for comparison, the RNF / CLR complex was used to detect the L858R mutation site of the EGFR gene in cells, and the specific detection method was the same as above. The RNF / CLR complex (denoted as NC for ease of description) is composed of RNA nanoflower (RNF) and cyclic fluorescent reporter (CLR). The cyclic fluorescent reporter (CLR) is bound to the RNA nanoflower (RNF) through base complementary pairing. The RNA nanoflower (RNF) and cyclic fluorescent reporter (CLR) are the same as those in Example 1. The experimental results are shown in Figure 2. Figure 5 As shown in d.
[0149] Depend on Figure 5 As shown in Figure d, placing the mutation site at the third position of crRNA can accurately detect the L858R mutation in H1975, while placing the mutation site at other positions indiscriminately produces fluorescent signals in both H1975 and MCF-7.
[0150] After observing the cells by laser confocal microscopy, the fluorescence intensity of different cells was quantified and normalized using ImageJ. The results are as follows: Figure 5 As shown in e. Figure 5 As shown in Figure 5, the horizontal axis represents the fluorescence intensity of Mito-Tracker Green treatment, and the vertical axis represents the signal intensity released by InCasRD. According to the statistical results, we can know that when the mutation site is placed at the sixth position of crRNA, Cas13a cannot be activated due to sequence specificity. When the mutation site is placed at the ninth, twelfth, and fifteenth positions of crRNA, MCF-7 can also activate Cas13a to varying degrees to generate signals. Only when the mutation site is placed at the third position of crRNA can the L858R mutation in H1975 be accurately detected. Among the 50 quantified cells, only one cell showed no signal, with an accuracy rate of up to 98%.
[0151] The above experimental results show that the InCasRD complex constructed by the present invention uses nucleic acid complementary pairing to efficiently load CRISPR / Cas13a and cyclic fluorescent reporter molecules for detection. It uses CRISPR / Cas13a to recognize the target RNA target and activate the trans-cleavage function, cutting the closed fluorescent reporter molecule (cyclic fluorescent reporter molecule CLR), and quickly and easily detecting nucleic acid information on tissue sections. This invention realizes the accurate identification of tumors with cellular resolution and develops a sensitive detection system for early warning of tumor metastasis, which has great application prospects.
[0152] The above embodiments are specific implementation methods of the present invention, but the implementation methods of the present invention are not limited to the above embodiments. Any other combination, change, modification, substitution, and simplification that does not exceed the design concept of the present invention shall fall within the scope of protection of the present invention.
Claims
1. A RNF / CLR / Cas / crRNA complex, characterized in that The RNF / CLR / Cas / crRNA complex consists of an RNA nanoflower, a cyclic fluorescent reporter molecule and a Cas / crRNA complex, wherein the cyclic fluorescent reporter molecule and the Cas / crRNA complex are bound to the RNA nanoflower through base complementary pairing.
2. The RNF / CLR / Cas / crRNA complex according to claim 1, characterized in that The RNA nanoflower is prepared by a rolling circle transcription reaction using a circular DNA template, wherein the circular DNA template is prepared by circularizing a linear single-stranded DNA template with a 5' end phosphorylated thereon using T4 DNA ligase.
3. The RNF / CLR / Cas / crRNA complex according to claim 2, characterized in that The linear single-stranded DNA template contains a promoter sequence, a sequence complementary to the crRNA in the Cas / crRNA complex, and a sequence complementary to the cyclic fluorescent reporter molecule.
4. The RNF / CLR / Cas / crRNA complex according to claim 3, characterized in that The DNA sequence that is complementary to the crRNA in the Cas / crRNA complex is: a DNA sequence that is complementary to the crRNA backbone region in the Cas / crRNA protein nucleic acid complex.
5. The RNF / CLR / Cas / crRNA complex according to claim 4, characterized in that The nucleotide sequence of the crRNA backbone region is shown in Sequence 1, which is: 5'-GGUUCAGUUAGUUAAUUUUUGAUUUAGACUACCCCAAAAACGAAGGG GACUAAAAC-3'; the promoter is a T7 promoter.
6. The RNF / CLR / Cas / crRNA complex according to claim 5, characterized in that The nucleotide sequence of the linear single-stranded DNA template is shown in Sequence 2, which is: 5'-ATAGTGAGTCGTATTAACGTACCAACAACCTATTGTATCCCGGACTGAC TTGGGTTCAGTTAGTTAATTTAGAGGCATATCCCT-3'.
7. The RNF / CLR / Cas / crRNA complex according to any one of claims 1 to 6, characterized in that The Cas / crRNA complex consists of a Cas protein and crRNA; the crRNA is a crRNA used to specifically recognize nucleic acid molecules.
8. The RNF / CLR / Cas / crRNA complex according to claim 7, characterized in that The Cas protein is Cas12a protein or Cas13a protein; the nucleic acid molecule is microRNA, circRNA or mRNA; the cyclic fluorescent reporter molecule is modified with a fluorescent group and a quenching group, and a spacer sequence is provided between the base modified with the fluorescent group and the base modified with the quenching group on the cyclic fluorescent reporter molecule.
9. The method for preparing the RNF / CLR / Cas / crRNA complex according to any one of claims 1 to 8, characterized in that: The following steps are involved: S1, compounding the RNA nanoflower with a cyclic fluorescent reporter molecule to obtain an RNA nanoflower-cyclic fluorescent reporter molecule complex; S2. Compounding the RNA nanoflower-annular fluorescent reporter molecule complex with the Cas / crRNA complex to obtain the RNF / CLR / Cas / crRNA complex.
10. The preparation method according to claim 9, characterized in that The specific operation of step S1 is: add the RNA nanoflower and cyclic fluorescent reporter to water, mix well, incubate at 36-38°C, and after the incubation, centrifuge to remove the free cyclic fluorescent reporter molecules to obtain the RNA nanoflower-cyclic fluorescent reporter molecule complex.
11. The preparation method according to claim 9 or 10, characterized in that: The specific operation of step S2 is: mixing the RNA nanoflower-annular fluorescent reporter molecule complex with the Cas / crRNA complex, incubating at 36-38°C, and obtaining the RNF / CLR / Cas / crRNA complex after the incubation is completed.
12. Use of the RNF / CLR / Cas / crRNA complex according to any one of claims 1 to 8 in any of the following: (A1) preparation of a product for specific detection of nucleic acid molecules in a sample; (A2) Application in the preparation of a product for detecting base mutations in nucleic acid molecules in a sample; (A3) Application in the preparation of products for fluorescence in situ hybridization tissue imaging; (A4) Use in the preparation of products for tumor diagnosis.
13. The use according to claim 12, characterized in that The samples include tissues, cells and tissue sections; the nucleic acid molecules are microRNA, circRNA or mRNA; and the products are preparations or kits.
14. A method for detecting nucleic acid molecules in tissue sections, characterized in that: The following steps are involved: (1) Paraffin-embedded tissue sections are dried, dewaxed, and digested in sequence; (2) adding a blocking solution to the tissue of the tissue section treated in step (1), incubating at 35-39° C., removing the blocking solution after the incubation, and adding the RNF / CLR / Cas / crRNA complex described in any one of claims 1-8 to the tissue of the tissue section, and incubating at 35-39° C.; (3) Washing the tissue slices treated in step (2), then dripping anti-fluorescence quenching sealing liquid onto the tissue slices to seal the slices, and detecting the fluorescence signal of the sealed tissue slices.
15. The method for detecting nucleic acid molecules in tissue sections according to claim 14, wherein: The blocking solution in step (2) is HOMOS Buffer; the anti-fluorescence quenching sealing solution in step (3) is an anti-fluorescence quenching sealing solution containing a cell nucleus dye.
Citation Information
Cited By
Integrated CRISPR-DNA nano device and in-vivo imaging method for mitochondrial DNA single base mutation
CN116555396A