Application of MdERF77 gene in saline-alkali stress resistance of plants

Abstract

The invention discloses application of an MdERF77 gene in saline-alkali stress resistance of plants, and belongs to the technical field of biology. According to the invention, the MdERF77 gene is over-expressed in an apple plant through a transgenic technology, so that the tolerance of the plant to saline-alkali stress is remarkably enhanced, and the technical effect is outstanding. According to the method, the growth adaptability of the apples in the saline-alkali environment can be effectively improved, so that transgenic plants show higher oxidation resistance, higher photosynthetic efficiency and a more stable membrane system under saline-alkali stress, normal development and quality improvement of fruits are guaranteed, and growth inhibition and yield loss caused by stress are reduced. Reference is provided for stress resistance improvement of fruit trees, and the method has wide agricultural application prospects.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to application of the MdERF77 gene in plant resistance to saline-alkali stress. Background Art

[0002] Soil salinization is a major environmental factor that restricts plant growth and development. Its combined stress effect is significantly stronger than that of single salt or alkali stress, posing a severe challenge to agricultural production. Combined salt-alkali stress severely inhibits plant growth through multiple mechanisms, including inducing reactive oxygen species bursts, disrupting ion homeostasis, reducing photosynthetic efficiency, and damaging cell membrane integrity. Traditional improvement methods, such as soil conditioning and the application of exogenous substances, have limitations such as high environmental dependence, potential toxicity, and short-lived effects. However, the development of salt- and alkali-tolerant varieties through molecular breeding to identify resistance genes offers greater potential for application.

[0003] Plants have developed a multi-layered adaptation mechanism to salt and alkali stress over the course of their long evolution. At the physiological level, they respond to stress through synergistic actions such as the accumulation of osmotic regulating substances (proline, betaine, etc.), regulation of ion transport systems (AKT1, NHX, etc.), secretion of organic acids to maintain pH homeostasis, and activation of antioxidant enzyme systems (SOD, CAT, POD). At the molecular level, multiple resistance genes and signal transduction pathways are activated. For example, overexpression of genes such as apple MdZDS can significantly enhance salt and alkali tolerance. These findings provide important targets for improving crop stress resistance.

[0004] Ethylene response factors (ERFs), as important members of the AP2 / ERF transcription factor family, play a central role in the plant stress resistance regulatory network. Several studies have shown that ERF family members, such as adzuki bean VaERF3, soybean GsERF71, and tomato SiERF5, positively regulate plant saline-alkali stress responses by regulating proline metabolism and proton pump activity. The VvERF1B-VvMYC2-VvPMA10 module found in grapes reveals an ERF-mediated alkaline stress adaptation mechanism. However, the functional mechanisms of ERFs in perennial woody plants, especially apple, in response to saline-alkali stress remain largely unknown and require further investigation. Elucidating the regulatory network of apple ERFs in saline-alkali stress will not only improve the theoretical system of plant stress resistance, but also provide new molecular targets and theoretical basis for apple stress resistance breeding. Summary of the Invention

[0005] The present invention aims to provide the application of the MdERF77 gene in plant resistance to saline-alkali stress, addressing the aforementioned problems with the prior art. The present invention overexpresses the MdERF77 gene in apple plants through transgenic technology, significantly enhancing the plants' tolerance to saline-alkali stress. This method demonstrates outstanding technical benefits, provides a reference for improving the stress resistance of fruit trees, and has broad prospects for agricultural application.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides the use of MdERF77 gene and related biological materials in improving the ability of plants to resist saline-alkali stress. The CDS sequence of the MdERF77 gene is shown in SEQ ID NO.3.

[0008] Furthermore, overexpressing the MdERF77 gene in the plant can improve the plant's ability to resist saline-alkali stress.

[0009] Optionally, the plant comprises apple.

[0010] Optionally, the relevant biological materials include a recombinant vector containing the MdERF77 gene and a recombinant microorganism.

[0011] The present invention also provides a method for improving the ability of plants to resist saline-alkali stress, comprising the step of overexpressing the MdERF77 gene in the plant, wherein the CDS sequence of the MdERF77 gene is shown in SEQ ID NO.3.

[0012] Optionally, the plant comprises apple.

[0013] The present invention also provides the use of the MdERF77 gene and related biological materials in cultivating plants with high resistance to salt and alkali stress. The CDS sequence of the MdERF77 gene is shown in SEQ ID NO.3.

[0014] Optionally, the plant comprises apple.

[0015] The present invention also provides a method for cultivating plants with high resistance to salt and alkali stress, comprising the steps of introducing the MdERF77 gene into the plant to obtain a plant stably overexpressing the MdERF77 gene; the CDS sequence of the MdERF77 gene is shown in SEQ ID NO.3.

[0016] Optionally, the plant comprises apple.

[0017] The present invention discloses the following technical effects:

[0018] The present invention uses transgenic technology to overexpress the MdERF77 gene in apple plants, significantly enhancing the plants' tolerance to saline-alkali stress, and has outstanding technical effects. This method can effectively improve the growth adaptability of apples in saline-alkali environments, enabling transgenic plants to exhibit stronger antioxidant capacity, higher photosynthetic efficiency, and a more stable membrane system under saline-alkali stress, thereby ensuring the normal development and quality improvement of the fruit and reducing growth inhibition and yield losses caused by stress. Compared to traditional breeding methods that require many years to breed resistant varieties, the present invention directly imparts salt-alkali resistance to apple plants through genetic engineering, significantly shortening the breeding cycle and improving improvement efficiency.

[0019] The action mechanism of the MdERF77 gene of the present invention involves the regulation of plant stress response, which is not only applicable to apples, but also can provide a reference for improving the stress resistance of other fruit trees, and has broad agricultural application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0021] Figure 1 Figure 2 shows the phenotypes of wild-type apple plants and MdERF77 gene overexpressing apple plants before and after salt stress treatment.

[0022] Figure 2 Statistical graphs of wilting rate (A), fresh weight (B), and dry weight (C) of wild-type apple plants and MdERF77 gene overexpressing apple plants before and after salt stress treatment;

[0023] Figure 3 Statistical graphs of chlorophyll content (A) and photosynthetic rate (B) of wild-type apple plants and MdERF77 gene overexpressing apple plants before and after salt stress treatment;

[0024] Figure 4 Statistical graphs of peroxidase activity (A), superoxide dismutase activity (B), and catalase activity (C) in wild-type apple plants and MdERF77 gene overexpressing apple plants before and after salt stress treatment. DETAILED DESCRIPTION

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0027] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0028] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0029] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0030] Example 1 Monoclonal amplification of the MdERF77 gene

[0031] 1. Amplification of the MdERF77 gene

[0032] Apple genomic RNA was extracted and reverse transcribed using a reverse transcription kit to obtain cDNA. The apple MdERF77 gene was amplified using upstream primer F and downstream primer R. The specific primer sequences are as follows:

[0033] Upstream primer F: ATGCCCTTCCATGCGAATAGGA (SEQ ID NO. 1);

[0034] Downstream primer R: GTTCATGGACAACCATGCCATT (SEQ ID NO. 2).

[0035] The amplification system is shown in Table 1, and the amplification procedure is shown in Table 2.

[0036] Table 1 PCR amplification system

[0037]

[0038]

[0039] Table 2 PCR amplification program

[0040]

[0041] The amplified CDS sequence of the MdERF77 gene is shown in SEQ ID NO.3.

[0042] SEQ ID NO.3:

[0043] ATGCCCTTCCATGCGAATAGGATACAGAAGGAGCAGGAGCACTGCATCATGGTCTCCGCCCTCAAGCACGTAATCTCCGGTGGGAGCATCAGCGGGCCCACCCCTCAGCACCCGCAGCCAATGCCTGCCGTCTACAATGCCATGTCATCCGTCTCGACGAGCGGCACCCAGTCGGCGGCGGGCCAACCAGCACAACAGGACCAGGGCAGGCTGGCCTTCTTACTAGACGGGGACACGTGTCGGGTGTGCGGGATACCAGGGTGTCTGGGGTGCAACTACTTCCCGCCATCGTTGCCGAATCAAAACAGGAACCAGCAACTGAGCTTGGGAACCGGGTTTGTCGGGATGAATGCGCCAACTACGAGGAAGAGCAAGAACAAGTACAGGGGCGTCAGGCAGAGGCCGTGGGGGAAATGGGCGGCGGAGATTCGAGACCCACGACGGGCGAAGAGGATGTGGCTAGGGACGTTCGAGACGGGGGAGGACGCGGCCAGGGCTTACGACAAGGCCGCCGTCGAGTTCCACGGAAATAAGGCAAAGCTCAATTTCCCATCGGACCCGGGAGGTCACATTGTCACGACTAACGACAGTTCTAGTAGTGGAACTAGTGCTAATGCCAGTATTAATCCAGGATTAATTAATAAGCAAAAGCAAAAGAATATTAGCGAAATTGAGGTCATGGAGAATGAGGAGGAGAAGGTTGATCAGGTCAAACTCAACCAGGCGACTCAGCCGGAGAATATGGAACTGGTGGCGGTGGCGACGGCGAAGAGCAGCGTTGGTCATGAGGAGGATGACCAGTTCTTGTTGTGGGACAATGGCTTGCTCCGAGATGGTGAAGATGATGACTTAATGGCATGGTTGTCCATGAACTAG。

[0044] 2. Ligation of the amplification product to the vector

[0045] The MdERF77 gene fragment obtained by PCR amplification was ligated to the PMD-19-T vector using the ligation system shown in Table 3 below, and the ligation was carried out at 30° C. for 10 minutes overnight to obtain a ligation product.

[0046] Table 3 Vector ligation system

[0047] Components Addition amount (μL) PMD-19-T(Simple) 1 Solution 1 5 Recovered product (MdERF77) 4 Total 10

[0048] 3. Transformation of ligation products into competent cells

[0049] Place the E. coli competent DH5α on ice to melt, aspirate 50 μL of the melted competent cell into a sterilized 1.5 mL centrifuge tube, add 10 μL of the ligation product, mix gently, and place in an ice bath for 30 minutes; heat shock in a 42°C water bath for 90 seconds, then quickly transfer the tube to an ice bath for 2 minutes, add 200 μL of LB liquid culture medium (without antibiotics) to the centrifuge tube, pipette to mix, and place in a shaker at 37°C, 180 rpm for 1.5 hours. After the end, aspirate 150 μL in a clean bench and apply it to LB solid culture medium (containing antibiotic Amp) until dry. Then seal the plate and place it upside down in a constant temperature incubator at 37°C for 12-15 hours.

[0050] 4. Picking spots and shaking fungi

[0051] In a clean bench, pipette 300 μL of LB liquid culture medium (containing antibiotic Amp) into a 2 mL sterilized centrifuge tube. Pick 8-10 plaques of similar size and regular shape from the solid LB culture medium where plaques have grown, place them into the liquid culture medium, pipet and mix thoroughly, mark them, place them in a shaker at 37°C, and culture at 180 rpm for 6-8 h.

[0052] 5. PCR identification of bacterial liquid

[0053] After shaking the culture, the system in Table 4 was used to identify the bacterial solution. The cultured bacterial solution was used as a template, the vector upstream primer and the gene downstream primer were selected as identification primers, and water was used as a negative control to identify the positive rate of the bacterial solution.

[0054] Table 4 Bacterial liquid PCR identification system

[0055] Components Addition amount (μL) 2×SuperTaqPCRStarMix 5 Vector upstream primer F 0.5 Gene downstream primer R 0.5 bacterial liquid 1 <![CDATA[H2O]]> 3 Total 10

[0056] Vector upstream primer F: GTAAAACGACGGCCAGT (SEQ ID NO. 4);

[0057] Gene downstream primer R: GTTCATGGACAACCATGCCATT (SEQ ID NO. 2).

[0058] The positive bacterial liquid that was successfully identified was selected for shake culture and expansion, and the plasmid MdERF77-PMD-19-T was extracted.

[0059] Example 2 Construction of plant overexpression vector MdERF77-pBI121

[0060] 1. Preparation of linearized vector

[0061] XbaI and SmalI on the pBI121 empty vector were selected as cloning sites, and restriction endonucleases were selected to digest the pBI121 empty vector to obtain a linearized vector. The digestion conditions were 37°C for 1 h. The digestion system is shown in Table 5.

[0062] Table 5 Vector linearization enzyme digestion system

[0063] Components Addition amount <![CDATA[10×CutOne TM Buffer]]> 2μL <![CDATA[LightNing TM XbaI]]> 1 μL <![CDATA[LightNing TM Small]]> 1 μL pBI121 plasmid 1 μg <![CDATA[ddH2O]]> Up to 20 μL

[0064] 2. Amplify the MdERF77 gene with homology arms

[0065] Redesign upstream and downstream primers with homology arms, use the MdERF77-PMD-19-T plasmid as a template, and amplify using the system in Table 1. The sequences of upstream and downstream primers with homology arms are as follows:

[0066] Upstream primer: gagaacacgggggactctagaATGCCCTTCCATGCGAATAG (SEQ ID NO. 5);

[0067] Downstream primer: ataagggactgaccacccgggGTTCATGGACAACCATGCCAT (SEQ ID NO. 6).

[0068] 3. Homologous recombination ligation

[0069] The amplified MdERF77 gene and the double-enzyme-digested pBI121 linearized vector were subjected to electrophoresis, and the target band was cut out and recovered from the gel.

[0070] Prepare the reaction system shown in Table 6 on ice and perform homologous recombination ligation between the amplified MdERF77 gene and the linearized vector. Incubate at 37°C for 30 minutes. After completion, cool on ice until ready to use. The optimal amount of linearized vector used in a 10 μL reaction is 0.03 pmol, with a molar ratio of insert to linearized vector of 2:1.

[0071] Table 6 Homologous recombination ligation system

[0072] Components Addition amount (μl) 2 × SparkHiFiSingleSeamlessCloningMix 5 MdERF77 gene (70 ng / μl) 1 pBI121 empty vector (25 ng / μl) 4 <![CDATA[ddH2O]]> Upto10

[0073] The ligated product was transformed into competent E. coli, and after spot-picking and bacterial liquid PCR identification, the positive bacterial liquid was screened and sent to a third-party company for sequencing. After sequencing verification, the plasmid MdERF77-pBI121 was extracted.

[0074] 4. Transformation of Agrobacterium with MdERF77-pBI121

[0075] Place the Agrobacterium competent state EH105 on ice to melt, draw 50 μL of the melted competent state into a sterilized 1.5 mL centrifuge tube, add 10 μL of MdERF77-pBI121 plasmid, mix gently, and place in an ice bath for 30 minutes. After the end, quick-freeze in liquid nitrogen for 5 minutes and then place in a water bath at 37°C for 5 minutes. Then quickly transfer the tube to an ice bath for 5 minutes, add 500 μL YEP liquid culture medium to the centrifuge tube, mix by pipetting, and place in a shaker at 28°C, 180 rpm for 4-6 hours, centrifuge at 5000 rpm for 1 minute to collect the bacteria. After the end, leave 100 μL of liquid in the clean bench to resuspend the bacteria, apply it on the YEP solid culture medium, and apply it until dry. Then seal the plate and place it upside down in a constant temperature incubator at 28°C for 48-72 hours to obtain Agrobacterium transformed with MdERF77-pBI121.

[0076] Example 3 Acquisition of transgenic lines

[0077] 1. Pre-cultivation

[0078] In a clean bench, use scissors to cut about 1.5 cm in size from apple Gala-3 (provided by Qingdao Agricultural University) leaves. Use a clean blade to make two horizontal cuts on the main vein of the leaf (use tweezers to gently press and fix the leaf, and do not cut the leaf twice). Place the leaf with the back facing down on a pre-culture plate and keep it in the dark for 2 to 3 days.

[0079] 2. Co-cultivation

[0080] The obtained Agrobacterium containing the MdERF77-pBI121 expression vector was cultured in YEP liquid medium at 28°C and 170 rpm on a shaker with small shaking (50 μL bacterial solution + 700 μL YEP), medium shaking (small shaking bacterial solution + 5 mL YEP), and large shaking (medium shaking bacterial solution + 50 mL YEP). The OD value of the Agrobacterium solution after large shaking was measured with a spectrophotometer and zeroed with YEP to OD 600 =0.4-0.6, centrifuge at 5000rpm for 5min to collect the cells, and resuspend them with equal amounts of resuspension solution (add AS to the resuspension solution in advance, 400μL / L, at which time OD 600=0.5) and allowed to stand in the dark for 1 hour. All leaves were placed in the resuspended bacterial solution and shaken continuously for a total of 8 minutes. The treated leaves were dried with filter paper and spread flat on a co-culture plate with filter paper with the back of the leaves facing down and incubated in the dark for 3 days.

[0081] 3. Delayed training

[0082] After co-cultivation, all leaves were placed in water containing antibiotics (250 mg / L Cef and 250 mg / L Tim), shaken and washed three times, dried with filter paper, and then spread flat on a delayed culture plate with the back of the leaves facing down and cultured in the dark for 2-3 days.

[0083] 4. Screening and cultivation

[0084] After the postponement of the selection culture, the leaf pieces were transferred to a solid regeneration medium containing 250 mg / L Cef + 250 mg / L Tim for selection culture (with the leaf back facing up). The initial selection culture was still carried out in the dark, and fresh culture medium was replaced every 2 weeks. Callus and adventitious buds appeared after 3 weeks of selection culture, and then the plants were transferred to culture under the light. When the green resistant buds grew new, they were transferred to a solid proliferation medium [MS + 1.0 mg / L 6-BA + 0.2 mg / L NAA + 0.5 mg / L GA3 (pH = 5.4-5.6)] containing 5 mg / L Kan + 250 mg / L Cef + 250 mg / L Tim and cultured, gradually increasing the Kan concentration. Before rooting, only 25 mg / L Kan was added to the culture medium.

[0085] 5. Identification of transgenic lines

[0086] When the resistant plants grow to 4-5 cm, DNA and RNA are extracted from the leaves of the resistant plants and tested by conventional PCR and RT-qPCR, respectively. The transgenic lines identified at the DNA level with target bands and high differential expression multiples are defined as transgenic lines, and each transgenic line is subcultured and rooted.

[0087] Example 4 Functional verification of transgenic lines

[0088] 1. Plant material

[0089] Wild type (WT): Gala-3 seedlings;

[0090] Transgenic line (OE): Gala-3 seedlings overexpressing MdERF77 (obtained in Example 3).

[0091] 2. Salt-alkali stress treatment

[0092] Transgenic lines and wild-type Gala-3 seedlings were simultaneously subjected to rooting and acclimation. After acclimation, each line was transplanted into a pot containing nutrient soil. One week after transplanting, each line was subjected to saline-alkali stress. The function of the MdERF77 gene was verified by observing phenotypes and measuring relevant physiological data. The specific steps are as follows:

[0093] Wild-type and transgenic seedlings with uniform growth and moderate size were selected and randomly divided into two groups (treatment group and control group), with 10 plants in each group.

[0094] Treatment group: watered with nutrient solution containing 100 mM NaHCO 3 :NaCl=1:1 (pH=8.3).

[0095] Control group: watered with the same amount of water.

[0096] The control group and the treatment group were irrigated once every 3 days for 2 weeks. The phenotypes were observed and the biomass was measured after the phenotypes appeared. The chlorophyll content of the seedlings, the photosynthetic rate of the leaves, and the activities of SOD, CAT, and POD were measured and statistically analyzed. The experiment was repeated three times.

[0097] 3. Results Analysis

[0098] After saline-alkali treatment, the phenotypes of wild-type plants and overexpressing MdERF77 plants were observed. It was found that the wild-type plants wilted, while the overexpressing plants grew well, indicating that the overexpressing MdERF77 plants have obvious resistance to saline-alkali stress ( Figure 1 ).

[0099] The wilting rate, dry weight and fresh weight of the two groups of plants were measured. The wilting rate of the transgenic plants overexpressing MdERF77 was significantly lower than that of the control group, and the dry and fresh weight were significantly higher than that of the control group ( Figure 2 Phenotypic data showed that transgenic plants overexpressing MdERF77 had stronger salt-alkali resistance.

[0100] Comparison of the chlorophyll content and photosynthetic rate of the two groups of plants revealed that the chlorophyll content and photosynthetic rate of the plants overexpressing MdERF77 were significantly higher than those of the wild type ( Figure 3 The activities of SOD, CAT, and POD in the two groups of plants were measured and it was found that the activities of CAT and POD in the transgenic plants were significantly higher than those in the wild type, while the activity of SOD was significantly lower than that in the wild type ( Figure 4 ), indicating that under saline-alkali stress, the degree of oxidative damage in MdERF77 transgenic Gala-3 seedlings was significantly lower than that in the control Gala-3 plants. The above experiments show that MdERF77 transgenic plants can significantly remove reactive oxygen species caused by saline-alkali stress.

[0101] In summary, MdERF77 transgenic Gala-3 plants greatly improved their ability to resist saline-alkali stress.

[0102] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Application of the MdERF77 gene and related biological materials in improving the ability of plants to resist saline-alkali stress, characterized in that: The CDS sequence of the MdERF77 gene is shown in SEQ ID NO.

3.

2. The use according to claim 1, characterized in that Overexpression of the MdERF77 gene in the plant can improve the plant's ability to resist saline-alkali stress.

3. The use according to claim 1, characterized in that The plants include apples.

4. The use according to claim 1, characterized in that The related biological materials include a recombinant vector containing the MdERF77 gene and a recombinant microorganism.

5. A method for improving the ability of plants to resist saline-alkali stress, characterized in that: The method comprises the step of overexpressing the MdERF77 gene in the plant, wherein the CDS sequence of the MdERF77 gene is shown as SEQ ID NO.

3.

6. The method according to claim 5, characterized in that The plants include apples.

7. The use of MdERF77 gene and related biological materials in cultivating plants with high resistance to salt and alkali stress, characterized in that: The CDS sequence of the MdERF77 gene is shown in SEQ ID NO.

3.

8. The use according to claim 7, characterized in that The plants include apples.

9. A method for cultivating plants with high resistance to salt and alkali stress, characterized in that: The method comprises the steps of introducing the MdERF77 gene into the plant to obtain the plant stably over-expressing the MdERF77 gene; the CDS sequence of the MdERF77 gene is shown as SEQ ID NO.

3.

10. The method according to claim 9, characterized in that The plants include apples.

Images