Application of MdERF77 gene in plant resistance to saline-alkali stress

By overexpressing the MdERF77 gene in apple plants, the limitations of traditional improvement methods were overcome, enhancing the apple's tolerance to salt and alkali stress, achieving high antioxidant capacity and photosynthetic efficiency, and improving the fruit's growth adaptability and quality.

CN120442650BActive Publication Date: 2026-01-09QINGDAO AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510594732.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-09
Publication Date
2026-01-09
Estimated Expiration
2045-05-09

AI Technical Summary

Technical Problem

Existing technologies have limitations in improving plant responses to salt and alkali stress, such as high environmental dependence, potential toxicity, and short-lived effects. Furthermore, the response mechanisms of perennial woody plants such as apples to salt and alkali stress are unclear, and there is a lack of effective molecular targets and breeding basis.

Method used

By overexpressing the MdERF77 gene in apple plants, its regulatory network is utilized to enhance the plant's tolerance to salt and alkali stress. Transgenic technology is used to directly confer salt and alkali resistance to apple plants, thereby improving their growth adaptability in saline-alkali environments.

Benefits of technology

It significantly enhances the tolerance of apple plants to salt and alkali stress, improves photosynthetic efficiency and membrane system stability, reduces growth inhibition and yield loss, shortens the breeding cycle, and improves fruit development and quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442650B_ABST
    Figure CN120442650B_ABST
Patent Text Reader

Abstract

The application discloses application of MdERF77 gene in plant resistance to saline-alkali stress, and belongs to the technical field of biotechnology. The application overexpresses the MdERF77 gene in an apple plant through transgenic technology, significantly enhances the tolerance of the plant to saline-alkali stress, and has outstanding technical effects. The method can effectively improve the growth adaptability of the apple in a saline-alkali environment, so that the transgenic plant shows stronger antioxidant capacity, higher photosynthetic efficiency and more stable membrane system under the saline-alkali stress, thereby guaranteeing normal development and quality improvement of fruits, and reducing growth inhibition and yield loss caused by stress. The application provides a reference for improvement of stress resistance of fruit trees, and has a wide agricultural application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to the application of MdERF77 gene in plant resistance to salt-alkali stress. BACKGROUND

[0002] Soil salinization as an important environmental factor restricting plant growth and development, its combined stress effect is significantly stronger than single salt or alkali stress, which poses a serious challenge to agricultural production. Salt-alkali combined stress seriously inhibits plant growth through multiple mechanisms such as inducing active oxygen burst, damaging ion homeostasis, reducing photosynthetic efficiency and damaging cell membrane integrity. Traditional improvement methods such as soil conditioning and exogenous substance application have limitations such as strong environmental dependence, potential toxicity and short-term effect, while breeding salt-alkali tolerant varieties through molecular breeding shows better application prospect.

[0003] Plants have formed a multi-level salt-alkali stress adaptation mechanism in the long-term evolution process. At the physiological level, it cooperates to cope with stress through accumulating osmotic adjustment substances (proline, betaine, etc.), regulating ion transport system (AKT1, NHX, etc.), secreting organic acids to maintain pH homeostasis, and activating antioxidant enzyme system (SOD, CAT, POD) and other mechanisms. At the molecular level, various resistance genes and signal transduction pathways are activated, such as overexpression of apple MdZDS gene can significantly enhance salt-alkali tolerance. These findings provide important targets for crop improvement.

[0004] Ethylene response factor (ERF) as an important member of AP2 / ERF transcription factor family plays a core role in plant stress regulation network. Many studies have shown that ERF family members such as red bean VaERF3, soybean GsERF71 and tomato SiERF5 positively regulate plant salt-alkali stress response by regulating proline metabolism and proton pump activity. The VvERF1B-VvMYC2-VvPMA10 module found in grape reveals the ERF-mediated alkali stress adaptation mechanism. However, the functional mechanism of ERF in response to salt-alkali stress in perennial woody plants, especially in apple, is still blank and needs further research. Analyzing the regulatory network of apple ERF in salt-alkali stress not only can perfect the plant stress resistance theory system, but also provides new molecular targets and theoretical basis for apple stress resistance breeding. SUMMARY

[0005] The purpose of the present application is to provide the application of MdERF77 gene in plant resistance to salt-alkali stress to solve the problems existing in the prior art. The present application overexpresses MdERF77 gene in apple plants through transgenic technology, significantly enhances the tolerance of plants to salt-alkali stress, has outstanding technical effect, provides reference for improvement of stress resistance of fruit trees, and has broad agricultural application prospect.

[0006] To achieve the above object, the application provides the following scheme.

[0007] The application provides application of the MdERF77 gene and related biological materials in improving the salt and alkali stress resistance of plants.

[0008] Further, overexpression of the MdERF77 gene in the plants can improve the salt and alkali stress resistance of the plants.

[0009] Optionally, the plants include apples.

[0010] Optionally, the related biological materials include a recombinant vector and a recombinant microorganism containing the MdERF77 gene.

[0011] The application further provides a method for improving the salt and alkali stress resistance of plants, which comprises the step of overexpressing the MdERF77 gene in the plants.

[0012] Optionally, the plants include apples.

[0013] The application further provides application of the MdERF77 gene and related biological materials in cultivating plants with high salt and alkali stress resistance.

[0014] Optionally, the plants include apples.

[0015] The application further provides a method for cultivating plants with high salt and alkali stress resistance, which comprises the steps of introducing the MdERF77 gene into the plants and obtaining plants stably overexpressing the MdERF77 gene.

[0016] Optionally, the plants include apples.

[0017] The application discloses the following technical effects:

[0018] The application has outstanding technical effects by overexpressing MdERF77 gene in apple plants through transgenic technology, significantly enhancing the tolerance of plants to salt and alkali stress. The method can effectively improve the growth adaptability of apples in a saline-alkaline environment, so that the transgenic plants exhibit stronger antioxidant capacity, higher photosynthetic efficiency and more stable membrane system under salt and alkali stress, thereby ensuring the normal development and quality improvement of fruits and reducing growth inhibition and yield loss caused by stress. Compared with the traditional breeding method which needs to spend years to breed resistant varieties, the application directly endows the apple plants with salt and alkali resistance through genetic engineering means, greatly shortens the breeding period and improves the improvement efficiency.

[0019] The action mechanism of the MdERF77 gene of the application involves plant stress response regulation, which is not only suitable for apples, but also can provide a reference for the stress resistance improvement of other fruit trees, and has a broad agricultural application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed to be used in the embodiments will be briefly introduced below. Obviously, the drawings in the following description only constitute some embodiments of the application, and other drawings can also be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0021] Figure 1 Fig. 1 is a phenotype diagram of wild-type apple plants and MdERF77 gene overexpression apple plants before and after salt stress treatment;

[0022] Figure 2 Fig. 2 is a statistical diagram of wilting rate (A), fresh weight (B) and dry weight (C) of wild-type apple plants and MdERF77 gene overexpression apple plants before and after salt stress treatment;

[0023] Figure 3 Fig. 3 is a statistical diagram of chlorophyll content (A) and photosynthetic rate (B) of wild-type apple plants and MdERF77 gene overexpression apple plants before and after salt stress treatment;

[0024] Figure 4 Fig. 4 is a statistical diagram of peroxidase activity (A), superoxide dismutase activity (B) and catalase activity (C) of wild-type apple plants and MdERF77 gene overexpression apple plants before and after salt stress treatment. DETAILED DESCRIPTION

[0025] The various exemplary embodiments of the application will now be described in detail, which should not be considered as limiting the application, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the application.

[0026] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. In addition, where particular ranges of values are given, understand that each intervening value, to the upper or lower limit of the ranges is also specifically included. The upper and lower limits of these intervening values are also specifically included within the scope of the present application. These smaller ranges are not expressly delineated or otherwise presented within the application.

[0027] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict, the present specification will control.

[0028] Various modifications and changes can be made to the specific embodiments described herein without departing from the scope or spirit of the application. Other embodiments will be apparent to those of ordinary skill in the art from the description and examples provided herein. The description and examples are illustrative only.

[0029] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean including, but not limited to.

[0030] Example 1 Monoclonal amplification of MdERF77 gene

[0031] 1. Amplification of MdERF77 gene

[0032] Genomic RNA of apple was extracted, and cDNA was obtained by reverse transcription kit. The apple MdERF77 gene was amplified by using the upstream primer F and the downstream primer R. The specific primer sequences are as follows:

[0033] Upstream primer F: ATGCCCTTCCATGCGAATAGGA (SEQ ID NO. 1);

[0034] Downstream primer R: GTTCATGGACAACCATGCCATT (SEQ ID NO. 2).

[0035] The amplification system is shown in Table 1, and the amplification program is shown in Table 2.

[0036] Table 1 PCR amplification system

[0037]

[0038]

[0039] Table 2 PCR amplification procedure

[0040]

[0041] The CDS sequence of the MdERF77 gene obtained by amplification is shown as SEQ ID NO. 3.

[0042] SEQ ID NO. 3:

[0043] ATGCCCTTCCATGCGAATAGGATACAGAAGGAGCAGGAGCACTGCATCATGGTCTCCGCCCTCAAGCACGTAATCTCCGGTGGGAGCATCAGCGGGCCCACCCCTCAGCACCCGCAGCCAATGCCTGCCGTCTACAATGCCATGTCATCCGTCTCGACGAGCGGCACCCAGTCGGCGGCGGGCCAACCAGCACAACAGGACCAGGGCAGGCTGGCCTTCTTACTAGACGGGGACACGTGTCGGGTGTGCGGGATACCAGGGTGTCTGGGGTGCAACTACTTCCCGCCATCGTTGCCGAATCAAAACAGGAACCAGCAACTGAGCTTGGGAACCGGGTTTGTCGGGATGAATGCGCCAACTACGAGGAAGAGCAAGAACAAGTACAGGGGCGTCAGGCAGAGGCCGTGGGGGAAATGGGCGGCGGAGATTCGAGACCCACGACGGGCGAAGAGGATGTGGCTAGGGACGTTCGAGACGGGGGAGGACGCGGCCAGGGCTTACGACAAGGCCGCCGTCGAGTTCCACGGAAATAAGGCAAAGCTCAATTTCCCATCGGACCCGGGAGGTCACATTGTCACGACTAACGACAGTTCTAGTAGTGGAACTAGTGCTAATGCCAGTATTAATCCAGGATTAATTAATAAGCAAAAGCAAAAGAATATTAGCGAAATTGAGGTCATGGAGAATGAGGAGGAGAAGGTTGATCAGGTCAAACTCAACCAGGCGACTCAGCCGGAGAATATGGAACTGGTGGCGGTGGCGACGGCGAAGAGCAGCGTTGGTCATGAGGAGGATGACCAGTTCTTGTTGTGGGACAATGGCTTGCTCCGAGATGGTGAAGATGATGACTTAATGGCATGGTTGTCCATGAACTAG.

[0044] 2. Ligation of the amplified product to the vector

[0045] The PCR amplified MdERF77 gene fragment was ligated to PMD-19-T vector using the ligation system shown in Table 3, and the ligation was performed at 30°C overnight for 10 min to obtain a ligation product.

[0046] Table 3 Ligation system of vector

[0047] Component Addition amount (μL) PMD-19-T (Simple) 1 Solution 1 5 Recovered product (MdERF77) 4 Total 10

[0048] 3. Transformation of competent cells with the ligation product

[0049] The competent E. coli DH5α was thawed on ice, 50 μL of the thawed competent cells were taken into a sterilized 1.5 mL centrifuge tube, 10 μL of the ligation product was added, and the mixture was gently mixed and placed in an ice bath for 30 min; the tube was quickly transferred to an ice bath for 2 min after being heated at 42°C for 90 s, 200 μL of LB liquid medium (without antibiotics) was added to the centrifuge tube, and the mixture was mixed by blowing and then placed in a shaker at 37°C and 180 rpm for 1.5 h; 150 μL of the mixture was taken in a super-clean workbench and spread on LB solid medium (containing antibiotic Amp) until dry, and then the plate was sealed and inverted in a constant-temperature incubator at 37°C for 12-15 h.

[0050] 4. Selection of colonies and shaking culture

[0051] In a super-clean workbench, 300 μL of LB liquid medium (containing antibiotic Amp) was taken into a 2 mL sterilized centrifuge tube, and 8-10 colonies with similar size and regular shape were picked from the solid LB medium with colonies and mixed by blowing, and the mixture was labeled and placed in a shaker at 37°C and 180 rpm for 6-8 h.

[0052] 5. PCR identification of bacterial solution

[0053] After the shaking culture, the bacterial solution was identified using the system in Table 4, the cultured bacterial solution was used as a template, the upstream primer of the vector and the downstream primer of the gene were used as identification primers, and water was used as a negative control to identify the positive rate of the bacterial solution.

[0054] Table 4 PCR identification system of bacterial solution

[0055] Component Addition amount (μL) 2x Super Taq PCR Star Mix 5 Vector upstream primer F 0.5 Gene downstream primer R 0.5 Bacterial solution 1 H2O 3 Total 10

[0056] The upstream primer F of the vector is GTAAAACGACGGCCAGT (SEQ ID NO. 4);

[0057] The downstream primer R of the gene is GTTCATGGACAACCATGCCATT (SEQ ID NO. 2).

[0058] The positive bacteria liquid with successful identification was selected for shaking culture, and the plasmid MdERF77-PMD-19-T was extracted.

[0059] Example 2: Construction of plant overexpression vector MdERF77-pBI121

[0060] 1. Preparation of linearized vector

[0061] XbaI and SmalI on the pBI121 empty vector were selected as cloning sites, and the pBI121 empty vector was subjected to enzyme digestion to obtain a linearized vector, and the enzyme digestion conditions were 37°C, 1h, and the enzyme digestion system was as shown in Table 5.

[0062] Table 5: Enzyme digestion system for linearization of vector

[0063] Component Addition amount 10x CutOne TM Buffer 2 μL LightNing TM XbaI 1 μL LightNing TM SmalI]]> 1 μL pBI121 plasmid 1 μg ddH2O Upto 20 μL

[0064] 2. Amplification of MdERF77 gene with homologous arms

[0065] The upstream and downstream primers with homologous arms were redesigned, and the plasmid MdERF77-PMD-19-T was used as a template for amplification using the system in Table 1. The sequences of the upstream and downstream primers with homologous arms are as follows:

[0066] Upstream primer: gagaacacgggggactctagaATGCCCTTCCATGCGAATAG (SEQ ID NO. 5);

[0067] Downstream primer: at aagggactgaccacccgggGTTCATGGACAACCATGCCAT (SEQ ID NO. 6).

[0068] 3. Homologous recombination

[0069] The amplified MdERF77 gene was subjected to electrophoresis with the double-digested pBI121 linearized vector, and the target band was cut and recovered.

[0070] The reaction system in Table 6 was prepared on ice, and the amplified MdERF77 gene was subjected to homologous recombination with the linearized vector, and the reaction was carried out at 37°C for 30min, and then the reaction was cooled on ice for standby. In 10μL reaction system, the optimal amount of linearized vector was 0.03pmol, and the molar ratio of inserted fragment to linearized vector was 2:1.

[0071] Table 6: Homologous recombination system

[0072] Component Addition amount (μl) 2x Spark HiFi Single Seamless Cloning Mix 5 MdERF77 gene (70 ng / μl) 1 pBI121 empty vector (25 ng / μl) 4 ddH2O Upto 10

[0073] The connected product was transformed into E. coli competent cells, and the positive bacterial liquid was screened by colony picking, shaking and PCR identification. The positive bacterial liquid was sent to a third-party company for sequencing. After the sequencing was verified, the plasmid MdERF77-pBI121 was extracted.

[0074] 4. Transformation of Agrobacterium with MdERF77-pBI121

[0075] The Agrobacterium competent cells EH105 were placed on ice to melt. 50 μL of the melted competent cells were taken in a sterilized 1.5 mL centrifuge tube, 10 μL of MdERF77-pBI121 plasmid was added, and the mixture was gently mixed. The mixture was placed in an ice bath for 30 min, then quickly frozen in liquid nitrogen for 5 min, and then placed in a water bath at 37°C for 5 min. Then the tube was quickly transferred to an ice bath for 5 min. 500 μL of YEP liquid medium was added to the centrifuge tube, and the mixture was mixed by blowing and then placed in a shaking bed at 28°C and 180 rpm for 4-6 h. The mixture was centrifuged at 5000 rpm for 1 min to collect the bacterial cells. After the end, 100 μL of liquid was left in the ultraclean workbench to resuspend the bacterial cells, which were then coated on YEP solid medium and dried. Then the plate was sealed and inverted in a constant temperature incubator at 28°C for 48-72 h to obtain Agrobacterium transformed with MdERF77-pBI121.

[0076] Example 3: Obtaining of Transgenic Strains

[0077] 1. Pre-culture

[0078] In the ultraclean workbench, the apple Gala-3 plant leaves (provided by Qingdao Agricultural University) were cut into 1.5 cm in size with scissors. The leaves were cut horizontally on the main leaf veins with a clean knife (the leaves were fixed with tweezers, and the two cuts did not break the leaves). The leaves were placed on the pre-culture plate with the back down, and placed in the dark for 2-3 days.

[0079] 2. Co-culture

[0080] The obtained Agrobacterium containing MdERF77-pBI121 expression vector was cultured in YEP liquid medium at 28°C and 170 rpm in a shaking bed. Small shaking (50 μL of bacterial liquid + 700 μL of YEP), medium shaking (small shaking bacterial liquid + 5 mL of YEP), and large shaking (medium shaking bacterial liquid + 50 mL of YEP). The OD value of the Agrobacterium liquid after large shaking was measured by spectrophotometer, and YEP was used as zero. When the OD 600 = 0.4-0.6, the bacterial cells were collected by centrifugation at 5000 rpm for 5 min, and resuspended with 1:1 equal amount of resuspension liquid (the resuspension liquid was prepared in advance with AS, 400 μL / L, and the OD 600=0.5), dark environment for 1 h. Put all leaves into the resuspended bacteria solution, shake constantly, and treat for 8 min. Dry the treated leaves with filter paper, and put them on the co-culture plate with filter paper, dark culture for 3 d.

[0081] 3, Delayed culture

[0082] Put all the co-cultured leaves into the water with antibiotics (250 mg / L Cef and 250 mg / L Tim), shake and wash for 3 times. Dry the leaves with filter paper, and put them on the delayed culture plate, dark culture for 2-3 d.

[0083] 4, Selection culture

[0084] After the delayed selection culture, put the leaf blocks into the solid regeneration medium with 250 mg / L Cef + 250 mg / L Tim for selection culture (put the leaves upside down). The initial selection culture is still in the dark, and change the fresh medium every 2 weeks. After 3 weeks of selection culture, callus and adventitious buds appear, and then transfer them to the light. When the green resistant buds grow, transfer them to the solid proliferation medium [MS + 1.0 mg / L 6-BA + 0.2 mg / L NAA + 0.5 mg / L GA3 (pH = 5.4-5.6)] containing 5 mg / L Kan + 250 mg / L Cef + 250 mg / L Tim, and gradually increase the concentration of Kan. Before rooting, only add 25 mg / L Kan to the medium.

[0085] 5, Identification of transgenic lines

[0086] When the resistant plants grow to 4-5 cm, extract the DNA and RNA of the leaves of the resistant plants, and perform general PCR and RT-qPCR detection, respectively. Identify the transgenic lines with the target band and high differential expression fold at the DNA level, and propagate and root the transgenic lines.

[0087] Example 4: Functional verification of transgenic lines

[0088] 1, Plant material

[0089] Wild type (WT): Gala-3 seedlings;

[0090] Transgenic lines (OE): Gala-3 seedlings overexpressing MdERF77 (obtained in Example 3).

[0091] 2, Salt stress treatment

[0092] Transgenic lines and wild-type Gala-3 seedlings were simultaneously subjected to rooting and acclimatization. After acclimatization, each line was transplanted into pots containing nutrient soil. One week after transplanting, each line was subjected to salt-alkali stress treatment. The function of the MdERF77 gene was verified by observing phenotypes and measuring relevant physiological data. The specific operation steps are as follows:

[0093] Wild-type and transgenic seedlings with uniform growth and moderate size were selected. They were randomly divided into two groups (treatment group and control group), with 10 seedlings in each group.

[0094] Treatment group: Irrigated with a nutrient solution containing 100mM NaHCO3:NaCl = 1:1 (pH = 8.3).

[0095] Control group: Irrigated with the same amount of water.

[0096] The control and treatment groups were irrigated once every 3 days for 2 weeks. Their phenotypes were observed. After the phenotypes appeared, biomass was measured. The chlorophyll content, photosynthetic rate of leaves, and activities of SOD, CAT, and POD in the seedlings were measured and statistically analyzed. The experiment was set up with three replicates.

[0097] 3. Results Analysis

[0098] After salt-alkali treatment, observation of the phenotypes of wild-type plants and plants overexpressing MdERF77 revealed that wild-type plants exhibited wilting, while overexpressing plants grew well, indicating that plants overexpressing MdERF77 had a significant effect on resisting salt-alkali stress. Figure 1 ).

[0099] The wilting rate, dry weight, and fresh weight of the two groups of plants were measured. The wilting rate of the MdERF77 transgenic plants was significantly lower than that of the control group, while the dry and fresh weights were significantly higher. Figure 2 Phenotypic data showed that transgenic plants overexpressing MdERF77 had strong salt and alkali resistance.

[0100] Comparison of chlorophyll content and photosynthetic rate between the two groups of plants revealed that the chlorophyll content and photosynthetic rate of plants overexpressing MdERF77 were significantly higher than those of the wild type. Figure 3 The activities of SOD, CAT, and POD in the two groups of plants were measured. It was found that the activities of CAT and POD in the transgenic plants were significantly higher than those in the wild type, while the activity of SOD was significantly lower in the transgenic plants. Figure 4 This indicates that under salt-alkali stress, the degree of oxidative damage suffered by MdERF77 transgenic Gala-3 seedlings was significantly lower than that of the control group Gala-3 plants. The above experiment demonstrates that MdERF77 transgenic plants can significantly scavenge reactive oxygen species induced by salt-alkali stress.

[0101] In summary, MdERF77 transgenic Gala-3 plants greatly improve the ability to resist salt stress.

[0102] The above-described embodiments are merely intended to describe the preferred modes of the present application, and are not intended to limit the scope of the present application. Various modifications and improvements to the technical solutions of the present application made by those skilled in the art without departing from the design spirit of the present application shall fall within the protection scope of the present application as defined by the claims.

Claims

1. The application of MdERF77 gene and biological material overexpressing MdERF77 gene in improving the salt and alkali stress resistance of plants, characterized in that, The CDS sequence of the MdERF77 gene is shown as SEQ ID NO. 3; Overexpression of the MdERF77 gene in the plant can improve the ability of the plant to resist saline-alkali stress; The plant is apple. The related biological materials include recombinant vectors and recombinant microorganisms containing the MdERF77 gene.

2. A method for improving the ability of plants to resist saline-alkali stress, characterized in that, The step of overexpressing the MdERF77 gene in the plant, the CDS sequence of the MdERF77 gene is shown as SEQ ID NO. 3; The plant is apple.

3. The application of MdERF77 gene and biological material related to overexpression of MdERF77 gene in cultivating plants with high salt-alkali stress resistance, characterized in that, The CDS sequence of the MdERF77 gene is shown as SEQ ID NO. 3; Stable overexpression of the MdERF77 gene in the plant can improve the resistance of the plant to saline-alkali stress; The plant is apple. The related biological materials include recombinant vectors and recombinant microorganisms containing the MdERF77 gene.

4. A method of breeding plants with high salt-alkali stress tolerance, characterized in that, The step of introducing the MdERF77 gene into the plant to obtain a plant stably overexpressing the MdERF77 gene; the CDS sequence of the MdERF77 gene is shown as SEQ ID NO. 3; The plant is apple.

Citation Information

Patent Citations

  • Wheat saline-alkaline tolerant ERF transcription factor gene TaERF109 and application thereof

    CN120330213A