RNAi target gene for preventing and controlling sitobion avenae and design and application of dsRNA of RNAi target gene

By screening the tyrosine hydroxylase gene as RNAi target and designing dsRNA, wheat seedlings transmittance interferes with the gene expression of oxala aphid, the residual and pest resistance problems of chemical pesticides in the prevention and control of oxala aphid is solved, and efficient biological control effects are achieved.

CN120442660AActive Publication Date: 2025-08-08INST OF PLANT PROTECTION HENAN ACAD OF AGRI SCI
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
CN202510584996.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-07
Publication Date
2025-08-08
Estimated Expiration
2045-05-07

AI Technical Summary

Technical Problem

When preventing and controlling fermented aphids, existing chemical pesticides have problems such as pesticide residues, increased pest resistance and non-target biological toxicity, and new and efficient control methods need to be found.

Method used

The tyrosine hydroxylase gene was screened as RNAi target, dsRNA was designed and synthesized, and the specific gene expression of wheat long tube aphids was transmitted through soaking wheat seedlings, and RNAi technology was used for prevention and control.

Benefits of technology

It significantly inhibits the expression of tyrosine hydroxylase of the wheat long tube aphid, resulting in the hindered growth and development of aphids and produces a lethal effect, achieving long-term control of tyrosine aphids and reducing the frequency of chemical pesticide use.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442660A_ABST
    Figure CN120442660A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biology, and particularly relates to an RNAi target gene for preventing and controlling sitobion avenae and design and application of dsRNA of the RNAi target gene. The sitobion avenae tyrosine hydroxylase gene is obtained through sequencing, annotation and verification, and the nucleotide sequence of the sitobion avenae tyrosine hydroxylase gene is SEQ ID No: 1; a sitobion avenae tyrosine hydroxylase gene is used as a target to design dsRNA, a primer with a T7 promoter sequence added at the 5'end is designed, and the nucleotide sequence of the obtained tyrosine hydroxylase dsRNA is SEQ ID No: 4. The sitobion avenae tyrosine hydroxylase gene is taken as a target gene, and sitobion avenae tyrosine hydroxylase dsRNA is correspondingly designed and is applied to prevention and control of sitobion avenae, so that the growth and development of the sitobion avenae are blocked, and a lethal effect is generated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to the design and application of an RNAi target gene for preventing and controlling aphids and a dsRNA thereof. Background Art

[0002] Wheat aphids, as a type of pest, feed on wheat leaves early in their lives. After wheat ears emerge, they cause damage, leading to a decrease in wheat yield. In addition to directly causing damage through feeding, wheat aphids are also the main vectors of viral diseases such as wheat yellow dwarf disease. There are three common wheat aphid species in my country: Macrosiphon wheatii (also known as reed and grain aphid), Aphis graminis, and Schizaphis wheatii. Macrosiphon wheatii is the dominant species in many wheat-growing areas. Currently, chemical control is still the main method for the prevention and control of wheat aphids. Neonicotinoid pesticides such as imidacloprid and thiamethoxam are often used to mix seeds and spray to kill aphids. However, wheat aphids multiply very quickly, and relying solely on chemical control will increase pesticide residues and endanger food safety. In addition, neonicotinoid pesticides commonly used in wheat aphid control are highly toxic to bees, silkworms, and shrimp, and their use has been restricted by the European Union. Therefore, finding new methods for wheat aphid control is of great significance.

[0003] RNAi (RNA interference), also known as RNA interference, is a highly specific gene silencing phenomenon mediated by double-stranded RNA (dsRNA) and involving specific enzymes. It is ubiquitous in organisms and can effectively block target gene expression. Nucleic acid pesticides, centered around RNAi technology, are at the forefront of global agricultural science and technology. The world's first commercialized nucleic acid insecticide is now available in the United States. Therefore, combining new pest control technologies like RNAi with the screening of highly effective lethal genes targeting wheat aphids has significant implications for establishing a green aphid control system, promoting the sustainable development of my country's wheat industry, and increasing my country's future competitiveness in related industries.

[0004] At present, the gene screening for the prevention and control of wheat aphids has also achieved initial results. The existing invention patents with application numbers CN201410474661.8, "A peroxidase gene dsRNA and its application in the prevention and control of wheat aphids", and CN201410474665.6, "A carboxylesterase gene dsRNA and its application in the prevention and control of wheat aphids", both disclose that dsRNA can be used for the prevention and control of wheat aphids; another invention patent with application number CN201210205601.7, "A cytochrome P450 gene dsRNA and its application in inhibiting aphid growth", discloses the use of RNAi technology to silence cytochrome P450 in wheat aphids and peach aphids; and another invention patent with application number CN201410328241.9, "A molting hormone receptor gene EcR dsRNA and its application in controlling aphid damage", and invention patent application number CN201410328484.2 "A dsRNA of ecdysone receptor gene USP and its application in controlling aphid damage", both disclose the technical content of using RNAi technology to inhibit the expression of corresponding genes in wheat aphids, resulting in the stunted growth and development of wheat aphids and a lethal effect. Summary of the Invention

[0005] One of the purposes of the present invention is to screen out a highly effective lethal gene as a target for the prevention and control of Macrosiphum avenae.

[0006] A second purpose of the present invention is to design and synthesize dsRNA using target genes.

[0007] The third purpose of the present invention is to apply the target gene dsRNA to the prevention and control of wheat aphid.

[0008] In order to achieve the above object, the technical solution adopted by the present invention is:

[0009] The tyrosine hydroxylase gene was screened out as the RNAi target gene for controlling the aphid. Tyrosine hydroxylase (TH) is a key enzyme involved in the biosynthesis of dopamine, which plays an important role in the insect's nervous system, behavioral regulation, growth and development, and immune response.

[0010] An RNAi target gene for controlling Macrosiphum avenae is a tyrosine hydroxylase gene of Macrosiphum avenae obtained through sequencing-annotation-verification, and the nucleotide sequence thereof is SEQ ID No: 1.

[0011] Furthermore, dsRNA was designed using the aphid tyrosine hydroxylase gene as a target to obtain a dsRNA synthetic fragment.

[0012] The above design process includes designing a primer with a T7 promoter sequence added to the 5' end. The specific nucleotide sequence of the primer is as follows:

[0013] G-t7:TAATACGACTCACTATAGGGTAGGGTCACTCGGCCCGTCG, recorded as SEQ ID No: 2,

[0014] R-t7:TAATACGACTCACTATAGGGGCGAAATGCGCTACGGCTGC, recorded as SEQ ID No: 3.

[0015] Furthermore, the specific nucleotide sequence of the designed dsRNA is SEQ ID No: 4.

[0016] The tyrosine hydroxylase gene of wheat aphid was used as the target gene, and the corresponding wheat aphid tyrosine hydroxylase dsRNA was designed, which was used to prevent and control wheat aphids, resulting in the stunted growth and development of wheat aphids and a lethal effect.

[0017] An application of an RNAi target gene for controlling wheat aphids, specifically: long-term control of wheat aphid populations is carried out through RNAi technology, and the tyrosine hydroxylase gene is a potential target for the development of nucleic acid pesticides.

[0018] An application of target gene dsRNA for preventing and controlling wheat aphids, specifically: tyrosine hydroxylase dsRNA can be delivered through wheat seedlings and interfere with the expression of specific genes corresponding to wheat aphids.

[0019] The beneficial effects of the present invention are:

[0020] 1. The present invention addresses the problems of the indiscriminate and overuse of chemical pesticides in the current prevention and control of wheat aphids, which leads to ecological pollution and increased pest resistance. By using RNAi technology to screen and obtain a tyrosine hydroxylase target gene with a long-term control effect on wheat aphid populations, the expression of the wheat aphid tyrosine hydroxylase gene can be effectively reduced by delivering specific dsRNA through the seedling immersion method. The present invention has a high reference value for the long-term prevention and control of wheat aphids using nucleic acid pesticides, is simple to use, and has good promotion significance.

[0021] 2. The present invention utilized transcriptome data from the wheat aphid to identify a tyrosine hydroxylase gene fragment through alignment and annotation, and then identified the gene through conventional PCR and sequencing. Subsequently, tyrosine hydroxylase dsRNA from the wheat aphid was synthesized using an in vitro dsRNA synthesis system. Wheat seedlings were then soaked in tyrosine hydroxylase dsRNA, and then inoculated with wheat aphids for bioassays. Quantitative PCR results showed that tyrosine hydroxylase expression was significantly suppressed (p < 0.05) after wheat aphids ingested the wheat seedlings soaked in tyrosine hydroxylase dsRNA, indicating that tyrosine hydroxylase dsRNA can be transmitted through the wheat seedlings and interfere with the expression of the corresponding gene in wheat aphids. Bioassay results showed that ingestion of wheat seedlings soaked in tyrosine hydroxylase dsRNA resulted in 18.3% mortality within 48 hours, and a 77.7% mortality rate within 5 days. These results suggest that the tyrosine hydroxylase gene is a potential target for the development of nucleic acid pesticides for long-term control of wheat aphid populations using RNAi technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 is the tyrosine hydroxylase interference efficiency test result of the present invention;

[0023] Figure 2 This is the biological test result of RNAi in the present invention. DETAILED DESCRIPTION

[0024] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. It is obvious that the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0025] Tyrosine Hydroxylase (TH) is a key enzyme involved in the biosynthesis of dopamine, which plays an important role in the nervous system, behavioral regulation, growth and development, and immune response of insects.

[0026] The present invention uses the tyrosine hydroxylase gene as the RNAi target gene for controlling the aphid, and performs screening and verification of the target gene, synthesis of the target gene dsRNA, and RNAi bioassay.

[0027] Example 1: Screening and verification of target genes

[0028] Transcriptome sequencing: Twenty adult aphids of the wheat aphid were collected in triplicate and transcriptome sequencing was performed. Total RNA from aphids was extracted using TRIzol (Invitrogen, Carlsbad, CA, United States) according to the manufacturer's instructions. RNA quality was analyzed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). Aphid mRNA was enriched using Oligo(dT) magnetic beads and then fragmented into small fragments using fragmentation buffer. First-strand cDNA was synthesized using random primers. First-strand cDNA was amplified and purified using the QiaQuick PCR extraction kit (Qiagen, Venlo, The Netherlands), followed by sequencing adapters. The size of the ligated fragments was determined by agarose gel electrophoresis, and appropriate fragments were selected for downstream sequencing. Transcriptome sequencing was performed on the Illumina HiSeq 4000 sequencing platform (Gene Denovo Biotechnology, Guangzhou, China) using a paired-end 250bp sequencing strategy.

[0029] Transcriptome Analysis: Raw sequencing reads were deserialized using the fastp program to remove adapters and low-quality sequences (including sequences with more than 10% unknown base N and sequences with a quality score less than 20). Transcriptome assembly was performed using Trinity software with default parameters. Gene functional annotation was performed using BLASTx alignment to the NCBI Nr (non-redundant protein) database with an e-value of 1 × 10⁻⁵. The tyrosine hydroxylase gene of the aphid was identified and annotated. The annotation results are shown in the following table:

[0030]

[0031]

[0032] The aphid tyrosine hydroxylase gene fragment was obtained through alignment and annotation, and the specific nucleotide sequence is SEQ ID No: 1.

[0033] The tyrosine hydroxylase gene fragment of the aphid Avenae was used as the target gene. Primers were synthesized according to the above nucleotide sequence SEQ ID No: 1, and the sequence was verified by RT-PCR. The specific operation method is as follows.

[0034] Reverse transcription was performed using aphid total RNA as template and Oligo dT as primer using PrimeScriptTM The 1st Strand cDNA Synthesis Kit (TaKaRa, Dalian, China) was used and the operation was performed according to the kit level. The RT-PCR reaction system was: 10 μl 2×Premix Taq TM (TaKaRa Taq TM Version 2.0 plus dye, TaKaRa, Dalian, China), 0.8 μl of each upstream and downstream primer (10 mM), 2 μl of reverse transcription product, and 20 μl of double-distilled water were added. The PCR reaction procedure was as follows: initial denaturation at 94°C for 2 minutes; 35 cycles of denaturation at 94°C for 10 seconds, annealing at 53°C for 30 seconds, and extension at 72°C for 30 seconds; and a final extension at 72°C for 10 minutes. 1-2 μl of the PCR product was spotted onto the wells of a 1.0% agarose gel placed in an electrophoresis tank. Electrophoresis was performed at 120 V and the gel was analyzed using a UV transilluminator or gel image analyzer. Specific amplification primer sequences (F: GAATCATCCGAATCATCTG; R: CCGGGGTGGTTCATGTCC) were used. Primer synthesis and PCR product sequencing were performed by Sangon Biotech (Shanghai) Co., Ltd.

[0035] Target gene verification results: A 464bp gene fragment was obtained through RT-PCR amplification and sequencing. The gene sequence of the aphid tyrosine hydroxylase gene obtained by comparison with the transcriptome data was completely consistent, proving the reliability of the aphid tyrosine hydroxylase gene sequence and providing a reliable gene sequence for the subsequent dsRNA synthesis.

[0036] Example 2: Target gene dsRNA synthesis

[0037] The target gene CDS sequence was analyzed, and the appropriate dsRNA segment was selected through siRNA target site prediction, GC content analysis, and secondary structure prediction, and primers with a T7 promoter sequence added to the 5' end were designed.

[0038] The specific nucleotide sequence of the T7 promoter sequence is as follows: 5'-TAATACGACTCACTATAGGG-3',

[0039] The specific nucleotide sequences of the primers are shown below:

[0040] F-t7:TAATACGACTCACTATAGGGTAGGGTCACTCGGCCCGTCG (denoted as SEQ ID No: 2)

[0041] R-t7:TAATACGACTCACTATAGGGGCGAAATGCGCTACGGCTGC (denoted as SEQ ID No: 3)

[0042] The template containing the T7 promoter was obtained by PCR amplification, and then reacted at 37°C for 4-6 hours under the action of T7 RNA polymerase, buffer, and NTP, followed by annealing at 72°C and slowly cooling to room temperature to terminate the reaction. The synthesized dsRNA was purified by magnetic beads to remove unsynthesized NTPs, proteins, ions, etc. in the reaction solution, eluted with a certain amount of enzyme-free water, and then the dsRNA concentration was measured by NanaDrop. The experiment was commissioned to Shanghai PlantScience Biotechnology Co., Ltd. for custom synthesis.

[0043] The dsRNA synthetic fragment obtained by the above method is recorded as SEQ ID No: 4, and the specific nucleotide sequence is as follows:

[0044]

[0045]

[0046] Example 3: RNAi bioassay

[0047] Twenty 4-day-old (approximately 2nd instar) aphid nymphs were selected and fed on wheat seedlings soaked in dsRNA (1500 ng / ul) (GFP as a control) for 48 hours (2 days) and 120 hours (5 days), respectively, with the mortality rate counted.

[0048] RNAi bioassay results Figure 2 As shown in the results of bioassays, feeding wheat seedlings soaked with tyrosine hydroxylase dsRNA resulted in 18.3% aphid mortality within 48 hours, and a 77.7% mortality rate within 5 days. These results suggest that the tyrosine hydroxylase gene is a potential target for the development of nucleic acid pesticides, enabling long-term control of the wheat aphid population through RNAi technology.

[0049] Example 4: RNAi interference efficiency detection

[0050] After 48 hours of feeding, an appropriate number of surviving aphids were selected and quantitative PCR (qRT-PCR) was used to detect the relative expression level of the target gene to verify the RNAi efficiency.

[0051] Specifically, aphid housekeeping genes were used as controls, and each treatment was repeated three times. Total RNA was extracted using the TaKaRa MiniBEST Universal RNA Extraction Kit (TaKaRa), and reverse transcription was performed using aphid total RNA as a template and Oligo dT as a primer using PrimeScript TM The 1st Strand cDNA Synthesis Kit (TaKaRa, Dalian, China) was used, and the protocol was performed according to the kit specifications. The qRT-PCR reaction system consisted of 10 μl of 2× Green Realtime PCR Master Mix (Toyobo, Shanghai, China), 0.8 μl of 10 mM upstream and downstream primers, 2 μl of reverse transcription product, and 20 μl of double-distilled water. The qRT-PCR reaction program was as follows: 95°C denaturation for 5 seconds, 55°C annealing for 10 seconds, and 72°C extension for 15 seconds, for 40 cycles. Melting curve analysis was performed. The qRT-PCR primer sequences (F: CCGTGGTTCCCGAGACAC; R: CCAATAGCACCTCTTCTT), primer synthesis, and PCR product sequencing were all performed by Sangon Biotech (Shanghai) Co., Ltd.

[0052] The results of RNAi interference efficiency test are as follows Figure 1 The results showed that when wheat aphids fed on wheat seedlings soaked with tyrosine hydroxylase dsRNA, the expression of tyrosine hydroxylase was significantly suppressed (p < 0.05). The results indicate that tyrosine hydroxylase dsRNA can be transmitted through wheat seedlings and interfere with the expression of the corresponding specific gene in wheat aphids.

Claims

1. An RNAi target gene for controlling Aphid avenae, characterized in that: The aphid tyrosine hydroxylase gene was obtained through sequencing-annotation-verification, and its nucleotide sequence is SEQ ID No:

1.

2. The RNAi target gene for controlling Aphid avenae according to claim 1, characterized in that: The tyrosine hydroxylase gene of Macrosiphum avenae was used as a target to design dsRNA and obtain a synthetic dsRNA fragment.

3. The RNAi target gene for controlling Aphid avenae according to claim 2, characterized in that: This included designing a primer with a T7 promoter sequence added to the 5' end. The specific nucleotide sequence of the primer was as follows: F-t7:TAATACGACTCACTATAGGGTAGGGTCACTCGGCCCGTCG, recorded as SEQ ID No: 2, R-t7:TAATACGACTCACTATAGGGGCGAAATGCGCTACGGCTGC, recorded as SEQ ID No:

3.

4. The RNAi target gene for controlling Aphididae according to claim 2, characterized in that: The specific nucleotide sequence of the designed dsRNA is SEQ ID No:

4.

5. The RNAi target gene for controlling Aphid avenae according to any one of claims 1 to 4, characterized in that: Used to prevent and control wheat aphids.

6. A target gene dsRNA for controlling Aphid avenae, characterized in that: The dsRNA is designed with the tyrosine hydroxylase gene of the aphid Avens as the target, and the specific nucleotide sequence is SEQ ID No:

4.

7. An application of an RNAi target gene for controlling Aphid avenae, characterized in that: Long-term control of the wheat aphid population is achieved through RNAi technology, and the tyrosine hydroxylase gene is a potential target for the development of nucleic acid pesticides.

8. An application of target gene dsRNA for controlling Aphid avenae, characterized in that: Tyrosine hydroxylase dsRNA can be transmitted through wheat seedlings and interfere with the expression of the corresponding specific gene in the aphid.

Citation Information

Patent Citations

  • Cytochrome P450 dsRNA (double-stranded ribonucleic acid) and application to aphid growth inhibition

    CN102776189A

  • An ecdysone receptor gene EcR dsRNA and its application in controlling aphid damage

    CN104109672B

  • A kind of ecdysone receptor gene usp dsRNA and its application in controlling aphid damage

    CN104109673B

  • Peroxidase gene dsRNA (double-stranded ribonucleic acid) and application of peroxidase gene dsRNA in control of sitobion avenae

    CN104232645A

  • Carboxylesterase gene dsRNA and applications thereof in prevention and treatment of sitobion avenae

    CN104293809A