Application of a fungal fermentation liquid to the prevention and treatment of betel nut leaf spot disease
By overexpressing RdRp protein in the fungal fermentation broth, the pathogenicity of the betel nut leaf spot pathogen was reduced, the problems of drug resistance and environmental pollution caused by chemical pesticides were solved, and an environmentally friendly disease control effect was achieved.
Patent Information
- Application Number
- CN202510968664.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-15
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2045-07-15
AI Technical Summary
The existing chemical pesticide control method of betel leaf spot disease leads to increased drug resistance of the pathogen, pollutes the environment, threatens the safety of humans and animals, and lacks environmentally friendly and effective control measures.
By using fungal fermentation broth and specific fungal culture fluid after filtering out the fungus, the overexpressed RdRp protein in Phomopsis rapae is utilized to reduce the pathogenicity of the betel leaf spot disease pathogen and maintain the balance of the microbial community.
It significantly reduces the pathogenicity of betel nut leaf spot disease pathogens, delays the development of drug resistance, maintains the stability of ecological functions, avoids imbalance of microbial communities, and is environmentally friendly.
Smart Images

Figure CN120464503B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the field of agricultural biotechnology, and in particular to application of fungal fermentation liquid to the prevention and treatment of betel nut leaf spot disease. Background Art
[0002] Betel nut ( Areca catechu ) belongs to the palm family ( Palms ). Continuous cropping of betel nut and improper cultivation and management lead to frequent leaf spot disease. Diaspora spp.) The asexual state of the fungus is Phomopsis spp. Phomopsis spp.), the betel nut leaf spot disease caused by it mainly harms betel nut leaves. The initial symptoms are small yellow spots, which then expand, turn black in the middle, light brown on the edges, and are accompanied by yellow halos, leading to leaf necrosis and weakened photosynthesis, seriously affecting the yield and quality of betel nut.
[0003] At present, chemical control of betel nut leaf spot disease mainly relies on chemical agents such as myclobutanil, flusilazole and myclobutanil. However, the long-term and irrational application of chemical pesticides can easily lead to increased drug resistance of pathogens, pollute the environment, and threaten the safety of humans and animals.
[0004] Therefore, it is crucial to develop a new prevention and control method that is both environmentally friendly and can effectively reduce the virulence of the pathogen for the prevention and control of betel leaf spot disease. Summary of the Invention
[0005] The invention aims to provide an application of a fungal fermentation liquid in preventing and treating betel nut leaf spot disease.
[0006] In a first aspect, the present invention claims the use of a fungal fermentation liquid in preventing and treating betel nut leaf spot disease;
[0007] The fungal fermentation liquid is a filtrate obtained by fermenting and culturing a specific fungus and filtering the culture liquid to remove the fungus bodies; the specific fungus is Phomopsis sp. that overexpresses the RdRp protein derived from the PaFV1 virus.
[0008] Furthermore, the amino acid sequence of the RdRp protein is shown in SEQ ID NO: 1.
[0009] Furthermore, the specific fungus is obtained by introducing the coding sequence of the RdRp protein or the genomic DNA of the PaFV1 virus into Phomopsis.
[0010] Furthermore, the coding sequence of the RdRp protein is shown in SEQ ID NO: 2. The genomic DNA of the PaFV1 virus is shown in SEQ ID NO: 3.
[0011] Furthermore, the coding sequence of the RdRp protein is introduced into the protoplasts of Phomopsis in the form of a recombinant vector.
[0012] Furthermore, the Phomopsis may be virus-free. Phomopsis asparagi .
[0013] In one embodiment of the present invention, the Phomopsis is Phomopsis ( Phomopsis asparagi ) XJ-1. The Phomopsis ( Phomopsis asparagi ) XJ-1 is the Phomopsis spp. Phomopsis asparagi ) The strain obtained after XJ5 is detoxified (such as using ribavirin to detoxify the tip of XJ5 mycelium).
[0014] Furthermore, the specific fungus is fermented and cultured by inoculating the specific fungus into PDB liquid culture medium and shaking at 25-28° C. (such as 28° C.) and 120-180 rpm (such as 180 rpm) for 5-8 days (such as 7 days) to obtain the culture solution.
[0015] Furthermore, the culture solution is filtered and sterilized as follows: the culture solution is filtered in two steps to remove the bacteria. First, most of the bacteria and impurities are removed by filtering with 4 layers of gauze; then, the remaining bacteria and impurities are removed by using a 0.22 micron filter membrane to obtain the fungal fermentation solution.
[0016] In the present invention, the prevention and control of betel nut leaf spot disease is specifically embodied in: reducing the pathogenicity of the betel nut leaf spot disease pathogen without affecting the growth rate of the betel nut leaf spot disease pathogen.
[0017] Furthermore, the betel leaf spot disease is caused by Phomopsis or Metaschisome. In one embodiment of the present invention, the betel leaf spot disease is caused by Phomopsis ( Phomopsis asparagi ) caused by XJ-1.
[0018] In a second aspect, the present invention claims a method for preventing and controlling betel nut leaf spot disease.
[0019] The method for preventing and controlling betel nut leaf spot disease claimed in the present invention may include the following steps: applying (such as spraying) the fungal fermentation liquid described in the first aspect above to betel nut leaves, thereby preventing and controlling betel nut leaf spot disease.
[0020] In the present invention, the prevention and control of betel nut leaf spot disease is specifically embodied in: reducing the pathogenicity of the betel nut leaf spot disease pathogen without affecting the growth rate of the betel nut leaf spot disease pathogen.
[0021] Furthermore, the betel leaf spot disease may be caused by Phomopsis or Metaschizont. In one embodiment of the present invention, the betel leaf spot disease is caused by Phomopsis ( Phomopsis asparagus ) caused by XJ-1.
[0022] In the present invention, the prevention and control of betel leaf spot disease is the prevention and / or treatment of betel leaf spot disease.
[0023] In a third aspect, the present invention claims protection for the fungal fermentation broth described in the first aspect above.
[0024] In a fourth aspect, the present invention claims the following use of the fungal fermentation broth described in the third aspect above: reducing the pathogenicity of Phomopsis without affecting the growth rate of Phomopsis.
[0025] In the present invention, the pathogenicity of Phomopsis is reduced without affecting the growth rate of Phomopsis. This has the following advantages compared to reducing the pathogenicity of the betel leaf spot pathogen by inhibiting the growth rate of the betel leaf spot pathogen: (1) Maintaining the balance of the microbial community. By only reducing the pathogenicity of the betel leaf spot pathogen without inhibiting its growth, the pathogen can still occupy a certain proportion in the ecological niche, avoiding the imbalance of the microbial community caused by excessive killing. For example, the genus Metaschizophyllum ( Diaspora spp.) fungi (such as Areca leaf spot pathogen) are ubiquitous in nature, and some species even form symbiotic relationships with other microorganisms as plant endophytes. By targeting and regulating their pathogenic genes or metabolic pathways (such as toxin synthesis), interference with other beneficial microorganisms can be reduced, maintaining the stability of ecological functions. (2) Delaying the development of drug resistance. When the survival of pathogens is threatened (such as when growth is strongly inhibited), they may accelerate the evolution of resistance through gene mutation (such as changes in the target gene sequence). Inhibiting only pathogenicity while retaining growth ability can reduce the "survival pressure" of pathogens, delay the selection and spread of resistance genes, extend the effective period of the technology, and delay the development of drug resistance.
[0026] In the present invention, the genome sequence of the PaFV1 virus is shown in SEQ ID NO: 3.
[0027] Experiments have shown that spraying the fungal fermentation liquid provided by the present invention on betel nut leaves can significantly reduce the occurrence of betel nut leaf spot disease, demonstrating good disease control potential. The present invention is of great significance for the prevention and control of betel nut leaf spot disease.
[0028] Preservation Instructions
[0029] Name of biological material: Phomopsis asparagi XJ5;
[0030] Proposed taxonomic name: Phomopsis asparagi ;
[0031] Depository: Guangdong Provincial Microbial Culture Collection Center;
[0032] Abbreviation of depository institution: GDMCC;
[0033] Address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou;
[0034] Deposit date: February 19, 2024;
[0035] The registration number of the deposit center is GDMCC No:64377.
[0036] The depositor, Hainan University, has authorized Hainan University Sanya South China Seed Breeding Research Institute and Hainan University Sanya Research Institute to use this strain. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] Figure 1 Figures 2 and 3 are the morphological images of different fungal colonies and the results of PCR identification. A represents the growth morphology of different fungal colonies on PDA solid culture medium. The one marked with "XJ1" represents Phomopsis spp. Phomopsis asparagi )XJ-1, "XJ1-V" indicates Phomopsis spp. Phomopsis asparagi ) The strain obtained after the PaFV1 viral genome (SEQ ID NO: 3) was introduced into XJ-1. The strain marked with "RdRp-OE" indicates that the strain was introduced into Phomopsis ( Phomopsis asparagi ) The strain obtained by introducing the RdRp protein coding sequence of PaFV1 virus (SEQ ID NO: 2) into XJ-1, and the strain marked with "ORF2-OE" indicates that it is introduced into Phomopsis ( Phomopsis asparagi ) The resulting strain was obtained by introducing the PaFV1 SMC protein coding sequence (positions 4644-6122 of SEQ ID NO: 3) into XJ-1. B shows PCR verification of the RdRp-OE strain (lanes 1-8 are positive). C shows PCR verification of the ORF2-OE strain (lanes 1-3 are negative, lanes 4 and 5 are positive).
[0038] Figure 2 This is a comparison chart of different fungal fermentation broth extractions. In the figure, the one labeled "XJ1 fermentation broth" represents Phomopsis ( Phomopsis asparagi ) XJ-1 fermentation broth, the one marked "XJ1-V fermentation broth" indicates that it is derived from Phomopsis spp. Phomopsis asparagus ) The fermentation broth of the strain obtained after the PaFV1 viral genome (SEQ ID NO: 3) was introduced into XJ-1. The fermentation broth marked with "RdRp-OE" indicates that the PaFV1 viral genome (SEQ ID NO: 3) was introduced into Phomopsis ( Phomopsis asparagi ) The fermentation broth of the strain obtained after the RdRp protein coding sequence of PaFV1 virus (SEQ ID NO: 2) was introduced into XJ-1. The fermentation broth marked as "ORF2-OE" indicates that the strain was introduced into Phomopsis ( Phomopsis asparagi ) The fermentation broth of the strain obtained after the SMC protein coding sequence of the PaFV1 virus (positions 4644-6122 of SEQ ID NO: 3) was introduced into XJ-1.
[0039] Figure 3 Figure 1 shows the effects of different fungal fermentation broths on the biological characteristics of the betel leaf spot pathogen. Figure A shows the colony morphology of the betel leaf spot pathogen after 4 days of growth on PDA medium supplemented with different fungal fermentation broths. Figure B shows the growth rate of the betel leaf spot pathogen. The area labeled "XJ1 fermentation broth" in the figure indicates Phomopsis spp. ( Phomopsis asparagi ) XJ-1 fermentation broth, the one marked "XJ1-V fermentation broth" indicates that it is derived from Phomopsis spp. Phomopsis asparagi ) The fermentation broth of the strain obtained after the PaFV1 viral genome (SEQ ID NO: 3) was introduced into XJ-1. The fermentation broth marked with "RdRp-OE" indicates that the PaFV1 viral genome (SEQ ID NO: 3) was introduced into Phomopsis ( Phomopsis asparagi ) The fermentation broth of the strain obtained after the RdRp protein coding sequence of PaFV1 virus (SEQ ID NO: 2) was introduced into XJ-1. The fermentation broth marked as "ORF2-OE" indicates that the strain was introduced into Phomopsis ( Phomopsis asparagi ) The fermentation broth of the strain obtained after the SMC protein coding sequence of the PaFV1 virus (positions 4644-6122 of SEQ ID NO: 3) was introduced into XJ-1.
[0040] Figure 4 Figure 1 shows the effects of different fungal fermentation solutions on the pathogenicity of the betel leaf spot pathogen. A shows the incidence of betel leaf spot pathogens 15 days after pre-spraying with different fungal fermentation solutions. B shows the statistical analysis of the area of lesions on betel leaf leaves. In the figure, the area labeled "XJ1 fermentation solution" indicates Phomopsis spp. Phomopsis asparagi ) XJ-1 fermentation broth, the one marked "XJ1-V fermentation broth" indicates that it is derived from Phomopsis spp. Phomopsis asparagi ) The fermentation broth of the strain obtained after the PaFV1 viral genome (SEQ ID NO: 3) was introduced into XJ-1. The fermentation broth marked with "RdRp-OE" indicates that the PaFV1 viral genome (SEQ ID NO: 3) was introduced into Phomopsis ( Phomopsis asparagi ) The fermentation broth of the strain obtained after the RdRp protein coding sequence of PaFV1 virus (SEQ ID NO: 2) was introduced into XJ-1. The fermentation broth marked as "ORF2-OE" indicates that the strain was introduced into Phomopsis ( Phomopsis asparagi ) Fermentation broth of the strain obtained after introducing the PaFV1 virus SMC protein coding sequence (positions 4644-6122 of SEQ ID NO: 3) into XJ-1. In the figure, **** indicates P < 0.0001. DETAILED DESCRIPTION
[0041] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.
[0042] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.
[0043] The Phomopsis involved in the following examples ( Phomopsis asparagi XJ5: Deposited with the Guangdong Provincial Center for Microbial Culture Collection, GDMCC No. 64377. Also described in the article "Jingyi Zhou, et al. Complete genome sequence of a novel botourmiavirus infecting the fungus Phomopsis asparagi. Archives of Virology, (2024) 169:161," the public can obtain it from the applicant for use solely in replicating the experiments described herein and for no other purpose.
[0044] Fungal virus PaFV1: It was discovered and named in the XJ5 strain of Phomopsis areca leaf spot pathogen. Fusariviridae division alphafusarivirus A new member of the genus, named Phomopsis asparagi fusarium 1, namely PaFV1. This virus lacks a poly(A) tail at its 3' end, and its genome is 6198 nt long. Its nucleotide sequence is shown in SEQ ID NO:3. It contains two open reading frames (ORFs), designated ORF1 and ORF2, with no sequence overlap between the two ORFs. ORF1 encodes 1522 amino acids (i.e., the RdRp protein of the present invention), encoding the RdRp conserved domain and the Hel conserved domain; ORF2 encodes 492 amino acids, encoding the SMC conserved domain (the encoding sequence is shown in positions 4644-6122 of SEQ ID NO:3). For related content, see Chinese patent application CN 118440973 A. The amino acid sequence of the RdRp protein involved in the present invention is shown in SEQ ID NO:1, and the corresponding encoding gene sequence is shown in SEQ ID NO:2.
[0045] Phomopsis Phomopsis asparagi ) XJ-1: for the application of ribavirin to Phomopsis ( Phomopsis asparagus ) Virus-free strain obtained by detoxifying the tip of XJ5 mycelium. Phomopsis asparagi) XJ-1 is also recorded in the article "Fu Yujia. Identification of fungal virus species in Phomopsis XJ5. Master's thesis of Hainan University in 2023". The public can obtain it from the applicant and can only be used to repeat the experiments of the present invention and may not be used for other purposes.
[0046] Fungal expression vector pFL2: described in “Chen, D., Wang, Y., Zhou, X., Wang, Y.,&Xu,JR (2014). The Sch9 kinase regulates conidium size, stress responses, andpathogenesis in Fusarium graminearum. PloS one, 9(8), e105811. https: / / doi.org / 10.1371 / journal.pone.0105811”, which is available to the public from the applicant and may only be used to replicate the experiments of the present invention and may not be used for any other purpose.
[0047] Example 1. Construction of Phomopsis strains overexpressing RdRp protein and SMC protein
[0048] 1. Construction of overexpression vector
[0049] Using the pEX2-PaFV1 vector carrying the PaFV1 (Phomopsis asparagi fusarivirus 1) genomic DNA sequence (SEQ ID NO: 3) as a template, the RdRp and SMC protein sequence fragments were amplified, respectively. Using a one-step cloning method, the RdRp and SMC protein sequence fragments were ligated into the fungal expression vector pFL2 to construct the pFL2-RdRp and pFL2-SMC vectors.
[0050] Description of the structure of the pFL2-RdRp vector: The recombinant plasmid is obtained by inserting the coding sequence of the RdRp protein shown in SEQ ID NO: 2 into the Xhol restriction site of the fungal expression vector pFL2.
[0051] Description of the structure of the pFL2-SMC vector: The recombinant plasmid is obtained by inserting the SMC conserved domain coding sequence shown in positions 4644-6122 of SEQ ID NO: 3 into the Xhol restriction site of the fungal expression vector pFL2.
[0052] In addition, the fungal expression vector pEX2 (the vector is preserved in this laboratory, and its full sequence is shown in SEQ ID NO:4) was digested with the restriction endonuclease XmalI, and the PaFV1 virus full genome sequence fragment (SEQ ID NO:3) was ligated with the linearized vector using a one-step cloning kit (CloneExpress II, Vazyme). The resulting recombinant vector was named pEX2-PaFV1.
[0053] 2. Protoplast Extraction
[0054] The PEG method was used to transform fungal protoplasts. The target fungus culture and protoplast preparation process was optimized as follows: First, the target strain Phomopsis ( Phomopsis asparagi XJ-1 was inoculated onto PDA solid medium and incubated in a 28°C incubator for 3 days. After colonies formed, fresh mycelial fragments from the edge of the colony were picked with a sterile toothpick and transferred to 100 mL of PDB liquid medium containing 50 μg / mL streptomycin. The culture was shaken at 28°C and 180 rpm for 2 days. Subsequently, 3 mL of the bacterial suspension was transferred to 150 mL of fresh PDB medium and shaken for another 24 hours, maintaining the same culture parameters. In a clean bench, the mycelial suspension was passed through three layers of sterile lens paper for solid-liquid separation, and the mycelia were collected. The mycelia were washed with sterile deionized water and 1.2 mol / L KCl solution to thoroughly remove residual medium components from the mycelial surface and promote adequate dispersion. The washed mycelia were spread flat on sterile absorbent paper to dry. Simultaneously, prepare the enzymatic hydrolysis solution: accurately weigh 0.03 g of snailase, 0.03 g of lyase, and 0.05 g of collapsase and dissolve them in 10 mL of 1.2 mol / L KCl solution. After mixing at 180 rpm for 20 minutes, filter through a 0.22 μm sterile filter to sterilize. Transfer the dried mycelium to a sterile centrifuge tube and weigh it. Then, 0.5-1.0 g of mycelium is immersed in the enzymatic hydrolysis solution. The solution is first hydrolyzed in a 33°C waterbath for 30 minutes, followed by gentle shaking at 80-90 rpm at 28°C for 3-5 hours. During the hydrolysis process, observe the protoplast release under a microscope every hour and terminate the reaction when optimal lysis is achieved. Filter the hydrolysis solution through three layers of sterile lens paper and collect the filtrate into a 50 mL sterile centrifuge tube. Rinse any remaining mycelium on the filter paper with 1.2 mol / L KCl to ensure complete recovery of the protoplasts. Centrifuge the filtrate at 3500 rpm for 10 minutes at 4°C. Discard the supernatant, resuspend the pellet in 10 mL of pre-chilled STC buffer, and repeat the washing steps. Finally, resuspend the protoplasts in 1 mL of pre-chilled STC buffer and aliquot into 50-100 μL tubes for storage.
[0055] 3. Protoplast Transformation
[0056] Take 10 μL of plasmid (the three overexpression vectors constructed in step 1) and add it to the protoplasts packaged in step 2. Let it stand on ice for 20 min, then add 1 mL of PTC buffer, gently pipette and mix evenly, let it stand at room temperature for 20 min, add the mixture to 5 mL of TB3 liquid medium (containing 50 μg / mL streptomycin), gently shake at 80-90 rpm at room temperature for 1 hour, then mix it with melted TB3 solid medium, add screening antibiotics (G418 70 μg / mL, streptomycin 50 μg / mL), turn the plate upside down, dry it, and then cover it with a layer of TB3 solid medium (G418 80 μg / mL, streptomycin 50 μg / mL) to make a double-layer plate. Place in a 28°C incubator. Once transformants have grown and broken through the top layer of culture medium, pick them out and transfer them to TB3 medium (containing 50 μg / mL streptomycin). After two generations of selection, plate them onto PDA plates covered with cellophane. After 3-5 days, scrape the mycelium and extract DNA for PCR verification. The primer sequences used for PCR are as follows:
[0057] Primer pairs for amplifying RdRp protein coding sequences:
[0058] F: CAGATCTTGGCTTTCGTAGGAACCCAATCTTCAATGAGTCGTGATATGATCGTTCA (SEQ ID NO: 5);
[0059] R: CACCACCCCGGTGAACAGCTCCTCGCCCTTGCTCACGGCCCGCTTTAAAGAATCTAG (SEQ ID NO: 6).
[0060] The target band size is 4635 bp.
[0061] Primer pair for amplifying SMC protein coding sequence:
[0062] F: CAGATCTTGGCTTTCGTAGGAACCCAATCTTCAATGTCCACGACTAGTAGGCAAG (SEQ ID NO:7);
[0063] R: CACCACCCCGGTGAACAGCTCCTCGCCCTTGCTCACGTCCAACTTCTCAGCATTGA (SEQ ID NO: 8).
[0064] The target band size is 1545 bp.
[0065] The experiment also set up untransfected Phomopsis ( Phomopsis asparagi )XJ-1 control group.
[0066] Figure 1 A in the middle is a picture of the morphology of different fungal colonies. Phomopsis asparagi ) The strain obtained by introducing the PaFV1 virus RdRp protein coding sequence (SEQ ID NO: 2) into XJ-1 was named RdRp-OE strain. Phomopsis asparagi ) The strain obtained by introducing the SMC protein coding sequence of PaFV1 virus (4644-6122 of SEQ ID NO:3) into XJ-1 was named ORF2-OE strain. Phomopsis asparagi The resulting strain, named XJ1-V, was derived by introducing the PaFV1 viral genome (SEQ ID NO: 3) into XJ-1. As shown in the figure, overexpression of the RdRp protein in the pathogen caused slowed mycelial growth and increased accumulation of yellow material.
[0067] Figure 1 B in the middle is the PCR verification result of RdRp-OE strain, Figure 1 Figure C shows the PCR verification results of the ORF2-OE strain. As can be seen from the figure, strains overexpressing the RdRp protein and the SMC protein of the PaFV1 virus have been successfully obtained.
[0068] Example 2: Extraction of fungal fermentation broth
[0069] The following steps were followed to prepare the three transformed Phomopsis strains obtained in Example 1 and the control Phomopsis ( Phomopsis asparagi ) The fermentation broth was prepared and extracted in XJ-1:
[0070] 1. Add the bacterial cake to PDB liquid culture medium and shake at 28°C and 180 rpm for 7 days to obtain 100 mL of culture medium.
[0071] 2. The culture medium is filtered in two steps to remove the bacteria. First, it is filtered through 4 layers of gauze to remove most of the bacteria and impurities. Then, it is filtered through a 0.22 micron filter membrane to remove the remaining bacteria and impurities to obtain the fungal fermentation liquid.
[0072] Figure 2 The figure shows a comparison of the extraction results of different fungal fermentation broths. As can be seen from the figure, the fermentation broths of RdRp-OE and XJ1-V accumulated more yellow substances than the fermentation broth of XJ1.
[0073] Example 3: Effect of fungal fermentation broth on the biological characteristics of Areca leaf spot pathogen
[0074] The specific pathogen of Areca leaf spot disease tested was Phomopsis spp. Phomopsis asparagi )XJ-1.
[0075] The different fungal fermentation broths obtained in Example 2 were aseptically added to PDA solid medium cooled to 50-60°C at a volume ratio of 1:5 (fermentation broth:PDA solid medium). After thorough mixing, the mixture was poured onto plates to prepare PDA solid medium containing the different fungal fermentation broths. The test pathogen, P. betel nut leaf spot, was inoculated onto the PDA solid medium containing the different fungal fermentation broths and cultured at 28°C for 5 days. The colony diameters were then measured using the cross-counter method, and the growth rate of the test pathogen was calculated.
[0076] The results showed that there was no significant difference in the growth rate of Areca leaf spot pathogen on different fungal fermentation broths and PDA culture medium. Figure 3 As shown in A and B.
[0077] Example 4: Effect of fungal fermentation liquid on the pathogenicity of Areca leaf spot pathogen
[0078] Take betel nut leaves of similar size and color, and pre-spray the leaves with 10 μL of the four different fungal fermentation broths prepared in Example 2. Then, inoculate the sprayed areas with a bacterial cake of similar size (0.3 cm 2 ) of the Areca leaf spot pathogen Phoma spp. Phomopsis asparagi ) XJ-1, the observations were recorded continuously for 15 days, and the lesion areas of betel nut leaves in each group were counted on the 15th day.
[0079] The results showed that compared with other groups, the fungal fermentation liquid group overexpressing PaFV1 virus RdRp protein had a significantly reduced number of betel nut leaf spot lesions, which indicated that the fungal fermentation liquid overexpressing PaFV1 virus RdRp protein prepared in Example 2 could significantly reduce the pathogenicity of betel nut leaf spot pathogen. Figure 4 As shown in A and B.
[0080] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.
Claims
1. Application of fungal fermentation liquid in the prevention and treatment of betel nut leaf spot disease; The fungal fermentation broth is a filtrate obtained by fermenting and culturing a specific fungus and filtering the culture broth to remove the fungi; the specific fungus is Phomopsis sp. that overexpresses the RdRp protein derived from the PaFV1 virus; The amino acid sequence of the RdRp protein is shown in SEQ ID NO: 1; The Phomopsis is virus-free Phomopsis asparagi ; The betel nut leaf spot disease is caused by the genus Phomopsis or the genus Metaschisis.
2. The use according to claim 1, characterized in that: The specific fungus is obtained by introducing the coding sequence of the RdRp protein or the genomic DNA of the PaFV1 virus into the Phomopsis sp.
3. The use according to claim 2, characterized in that: The coding sequence of the RdRp protein is shown in SEQ ID NO:
2.
4. The use according to claim 2, wherein: The sequence of the genomic DNA of the PaFV1 virus is shown in SEQ ID NO:
3.
5. The use according to claim 1, characterized in that: The specific fungus is fermented and cultured by inoculating the specific fungus into a PDB liquid culture medium and shaking the culture medium at 25-28° C. and 120-180 rpm for 5-8 days to obtain the culture solution.
6. The use according to claim 1, characterized in that: The culture solution is filtered to remove the bacteria by first filtering the culture solution using 4 layers of gauze, and then filtering using a 0.22 micron filter membrane to obtain the fungal fermentation solution.
7. The use according to any one of claims 1 to 6, characterized in that: In the application, the fungal fermentation liquid reduces the pathogenicity of the Phomopsis without affecting the growth rate of the Phomopsis.
8. A method for preventing and treating betel nut leaf spot disease, comprising the steps of applying the fungal fermentation liquid described in any one of claims 1 to 7 to betel nut leaves, thereby preventing and treating betel nut leaf spot disease.
Citation Information
Patent Citations
Application of fungal virus PaFV1 in prevention and control of plant diseases
CN118440973A