ShRNA for knocking down BST2 gene expression, recombinant vector and application

Abstract

The invention belongs to the technical field of gene engineering, and provides shRNA (short hairpin Ribonucleic Acid) for knocking down BST2 gene expression, a recombinant vector and application of the shRNA, and the shRNA comprises Bst2-shRNA-1 or Bst2-shRNA-2; the Bst2-shRNA-1 comprises a positive-sense strand of which the nucleotide sequence is as shown in SEQ ID NO. 1 and an antisense strand of which the nucleotide sequence is as shown in SEQ ID NO. 2; the Bst2-shRNA-2 comprises a positive-sense strand of which the nucleotide sequence is as shown in SEQ ID NO. 3 and an antisense strand of which the nucleotide sequence is as shown in SEQ ID NO. 4. The shRNA disclosed by the invention plays an important role in inhibiting non-infectious aseptic inflammation, can effectively delay the ALS attack time and protect motor neurons, has a very good application prospect, and also provides a direction and a technical basis for searching, researching and developing new therapeutic drugs for treating ALS.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and particularly relates to a shRNA for knocking down BST2 gene expression, a recombinant vector and applications. Background Art

[0002] Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disease and one of the most common motor neuron diseases in adults. It selectively affects upper and lower motor neurons in the brain and spinal cord. Clinical manifestations include progressive muscle atrophy and weakness accompanied by pyramidal tract signs, slurred speech, coughing when drinking, and ultimately, death from respiratory failure. The pathogenesis of ALS is not fully understood, but research suggests that multiple mechanisms may be involved, including oxidative stress, mitochondrial dysfunction, abnormal protein aggregation, and neuroinflammation.

[0003] Currently, in addition to riluzole and edaravone, two drugs that slightly slow disease progression, there is also the use of single-stranded attachment oligonucleotides (ACOs) coupled to high-throughput screened siRNAs to form siRNA-ACOs, which can be injected intrathecally into SOD1G93A mice to delay disease progression. However, siRNA-ACOs have a short duration of action and poor stability, extending mouse survival in a dose-dependent manner. Existing treatments still cannot meet the personalized treatment needs of ALS patients.

[0004] Research has revealed that bone marrow stromal antigen 2 (BST2), also known as Tetherin, CD317, or HM1.24, is a type II transmembrane protein localized to the cell membrane. Its topology consists of an N-terminal cytoplasmic domain, a transmembrane domain, and a C-terminal glycosylphosphatidylinositol (GPI) anchor. This dual anchor structure enables BST2 to tether enveloped viral particles to the cell membrane, preventing their release. BST2 plays a role in cellular immunity, antiviral defense, and inflammation regulation. Its expression is induced by type I and type II interferons (IFNs), participating in immune regulation. In neurological diseases, BST2 expression is closely associated with the regulation of inflammatory responses. For example, in patients with multiple sclerosis (MS), high BST2 expression is positively correlated with disease severity, and anti-BST2 therapy has been shown to benefit the recovery of mice with autoimmune encephalomyelitis. Hu Ting et al. revealed that knocking down BST2 expression in a traumatic brain injury model also reduced TNF-α levels, alleviated brain edema, and improved blood-brain barrier integrity. Marina et al. demonstrated that knocking down the BST2 gene reduced pro-inflammatory phenotype polarization and promoted an anti-inflammatory phenotype in microglia, suppressing neuroinflammation through a type I interferon response. Therefore, the role of BST2 expression in various diseases suggests that targeted knockdown / knockout of the BST2 gene may serve as a new candidate for clinical treatment.

[0005] Furthermore, with the advancement of genetic technology, shRNA (short hairpin RNA) plays a crucial role in genetic engineering, primarily through the RNA interference (RNAi) mechanism for precise regulation of gene expression. shRNA silences the target gene's mRNA by forming siRNA (small interfering RNA), thereby reducing the expression of specific proteins. This allows for the study of target gene function and provides a theoretical basis for uncovering disease mechanisms through the lens of RNA regulation. Furthermore, lentiviral-encapsulated shRNA is a valuable tool in genetic engineering, capable of infecting a broad range of cells, offering advantages such as stable, long-lasting expression, high transfection efficiency, and flexible design. These shRNAs can provide new gene targets and molecular markers for disease diagnosis and treatment. shRNAs developed against the BST2 gene may protect motor neurons in individuals with ALS by ameliorating sterile inflammation in the nervous system. Summary of the Invention

[0006] In order to specifically reduce BST2 gene expression, thereby alleviating neuroinflammation and achieving the purpose of alleviating non-infectious sterile inflammation, the present invention discloses a shRNA for knocking down BST2 gene expression, wherein the shRNA includes Bst2-shRNA-1 or Bst2-shRNA-2.

[0007] Wherein, the Bst2-shRNA-1 comprises a sense strand with a nucleotide sequence as shown in SEQ ID NO.1 and an antisense strand with a nucleotide sequence as shown in SEQ ID NO.2; The Bst2-shRNA-2 includes a sense strand with a nucleotide sequence as shown in SEQ ID NO.3 and an antisense strand with a nucleotide sequence as shown in SEQ ID NO.4.

[0008] Furthermore, the Bst2-shRNA-1 is designed based on the shRNA target sequence shown in SEQ ID NO.5, and the Bst2-shRNA-2 is designed based on the shRNA target sequence shown in SEQ ID NO.6.

[0009] Furthermore, the shRNA knocks down BST2 gene expression in microglia in the spinal cord and inhibits T lymphocyte infiltration.

[0010] Furthermore, after the expression of BST2 gene in the microglia in the spinal cord is knocked down, the expression of CXCL10 gene in the microglia in the spinal cord is inhibited.

[0011] Furthermore, after the expression of the BST2 gene in the microglia in the spinal cord is knocked down, the expression of any one or more of the CD93 gene, Mrc1 gene, Timp1 gene, Itgax gene and IL1RL1 gene in the microglia in the spinal cord is enhanced, and the expression of any one or more of the IL6 gene, IFIT1 gene, P50 gene, CD86 gene and LCN2 gene is inhibited.

[0012] The embodiment of the present invention also provides a recombinant vector containing the above shRNA.

[0013] Furthermore, the shRNA is cloned into an interfering lentivirus, and the interfering lentivirus includes GV493.

[0014] The embodiments of the present invention also provide a use of the above-mentioned shRNA or recombinant vector in the preparation of a drug for inhibiting non-infectious sterile inflammation. The preparation of a drug for inhibiting non-infectious sterile inflammation includes the preparation of a drug for inhibiting amyotrophic lateral sclerosis, inhibiting multiple sclerosis, inhibiting neuromyelitis optica, and inhibiting autoimmune encephalitis.

[0015] The shRNA and recombinant vector for knocking down BST2 gene expression provided by the present invention play an important role in inhibiting non-infectious sterile inflammation. For example, they can effectively delay the onset of ALS and have a protective effect on the anterior horn motor neurons of the spinal cord of ALS mice. They can be promoted and applied in the treatment of ALS and have good application prospects. They also provide a direction and technical basis for finding and developing new therapeutic drugs for ALS, which is beneficial for ALS patients to get rid of the pain of the disease as soon as possible. BRIEF DESCRIPTION OF THE DRAWINGS In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0016] Figure 1 BST2 gene in wild mice and SOD1 at different stages G93A The expression results of BST2 in the anterior horn of the spinal cord of mice, A is the immunofluorescence staining results of BST2 in the anterior horn of the spinal cord of mice at 30, 60, 90 and 120 days of age, B is the immunofluorescence staining results of BST2 + Quantitative analysis results of cells, C is the immunofluorescence co-staining result of IBa1 and BST2; Figure 2 The results of BST2 gene expression in BV2 microglia, where A is the q-PCR test to verify the BST2 knockdown effect, and B and C are the Western Blot immunoblotting test to verify the BST2 knockdown effect and relative quantitative analysis results, respectively; Figure 3 The transcriptome sequencing results after knocking down BST2 gene expression in BV2 microglia cells are shown in Figure 2, where A is the number of differentially expressed genes in transcriptome sequencing, and B is the clustering result of differentially expressed genes in transcriptome sequencing; Figure 4 The relative quantitative analysis results of various inflammatory genes after knockdown of BST2 gene expression in BV2 microglia cells, where A, B, C, D, E, and F represent the relative quantitative analysis results of q-PCR detection of CD86, CD206, Il6, P50, IFIT1, and LCN2 gene levels, respectively; Figure 5 Figure 3 is the Western Blot detection and relative quantitative analysis results of CXCL10 protein levels after knockdown of BST2 gene expression in BV2 microglia cells. G is the relative quantitative analysis result of CXCL10 gene level by q-PCR, and H and I are the Western Blot detection and relative quantitative analysis results of CXCL10 protein level, respectively. Figure 6 CXCL10 and SOD1 at different stages G93A Expression in microglia of the anterior horn of the mouse spinal cord. A shows the relative quantitative analysis results of CXCL10 gene levels by q-PCR in the spinal cords of 90- and 120-day-old mice. B and C show the Western Blot detection and relative quantitative analysis results of CXCL10 protein levels in the spinal cords of 30-, 60-, 90-, and 120-day-old mice, respectively. Figure 7 Immunofluorescence co-localization staining showed that CXCL10 was mainly expressed in microglia; Figure 8 Figure 3. Changes in body weight over survival time, as well as comparison of onset time and average onset time between the BST2 knockdown group and the control group. A represents the changes in body weight over survival time, B represents the onset time of the mice, and C represents the average onset time of the mice. Figure 9 The survival curves of mice in the BST2 knockdown group and the control group, as well as the comparison results of the average disease course of mice between the two groups, where D is the survival curve of mice and E is the average disease course of mice; Figure 10 Nissl staining for detection of SOD1 G93A The loss of motor neurons in the anterior horn of the mouse spinal cord. A is the Nissl staining result of the lumbar spinal cord of mice, and B is the quantitative analysis result of the number of motor neurons in the lumbar spinal cord of mice between the two groups. Figure 11 SOD1 G93A Results of BST2 knockdown efficiency verification in mice. A shows the q-PCR validation of BST2 knockdown, while B and C show the Western Blot validation of BST2 knockdown and relative quantitative analysis, respectively. Figure 12 SOD1 G93A Quantitative analysis of the number of microglia in the BST2 knockdown group and the control group of mice, where D is the immunostaining result of IBa1 in the anterior horn of the spinal cord of mice, and E is the quantitative analysis result of IBa1+ cells; Figure 13 SOD1 G93A Western Blot detection and relative quantitative analysis results of CD86 and CD206 protein levels in the BST2 knockdown group and control group of mice. F is the Western Blot detection result of CD86 and CD206 protein levels, G and H are the relative quantitative analysis results of CD86 and CD206 protein levels, respectively; Figure 14 SOD1 G93ARelative quantitative analysis results of inflammatory genes in the BST2 knockdown group and the control group of mice, where A, B, C, D, E, and F represent the relative quantitative analysis results of q-PCR detection of CD86, CD206, Il6, IFIT1, P50, and LCN2 gene levels, respectively; Figure 15 SOD1 G93A Western Blot detection and relative quantitative analysis results of CXCL10 and CXCR3 protein levels in the BST2 knockdown group and control group of mice, where A is the Western Blot detection result of CXCL10 and CXCR3 protein levels in mice, and B and C are the relative quantitative analysis results of CXCL10 and CXCR3 protein levels, respectively; Figure 16 Immunofluorescence co-localization staining showed that CXCR3 expression was associated with CD8 + There is co-localization of T cells; Figure 17 SOD1 G93A Western Blot detection and relative quantitative analysis results of CD8 protein levels in the BST2 knockdown group and control group of mice, where E is the Western Blot detection result of CD8 protein level in mice, and F is the relative quantitative analysis result of CD8 protein level. DETAILED DESCRIPTION

[0017] The embodiments of the present application are described in detail below with reference to the accompanying drawings.

[0018] The following describes the embodiments of the present application through specific examples, and those skilled in the art can easily understand other advantages and effects of the present application from the contents disclosed in this specification. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. The present application can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present application. It should be noted that, in the absence of conflict, the features of the following embodiments and embodiments can be combined with each other. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of this application.

[0019] Example 1: Design of shRNA and recombinant vector for knocking down BST2 gene expression The embodiments of the present invention provide a shRNA capable of knocking down the expression of the BST2 gene. The shRNA can knock down the expression of the BST2 gene in microglial cells in the spinal cord, including Bst2-shRNA-1 or Bst2-shRNA-2.

[0020] The Bst2-shRNA-1 was designed based on the shRNA target sequence gcttgagaatgaagtcacgaa (SEQ ID NO. 5) and includes a sense strand and an antisense strand. The nucleotide sequence of the sense strand is 5'-ccgggcttgagaatgaagtcacgaactcgagttcgtgacttcattctcaagctttttg-3' (SEQ ID NO. 1), and the nucleotide sequence of the antisense strand is 5'-aattcaaaaagcttgagaatgaagtcacgaactcgagttcgtgacttcattctcaagc-3' (SEQ ID NO. 2).

[0021] The Bst2-shRNA-2 was designed based on the shRNA target sequence ctggagaagaaggtgtctcaa (SEQ ID NO. 6), and includes a sense chain and an antisense chain. The nucleotide sequence of the sense chain is 5'-ccggctggagaagaaggtgtctcaactcgagttgagacaccttcttctccagtttttg-3' (SEQ ID NO. 3), and the nucleotide sequence of the antisense chain is 5'-aattcaaaaactggagaagaaggtgtctcaactcgagttgagacaccttcttctccag-3' (SEQ ID NO. 4).

[0022] In the embodiment of the present invention, the shRNA is cloned into an interfering lentivirus to construct a recombinant vector for knocking down the expression of the BST2 gene. The interfering lentivirus can be GV493, or other types of lentiviral vectors.

[0023] The embodiments of the present invention provide a method for preparing a drug for inhibiting non-infectious sterile inflammation by using shRNA or a recombinant vector. The methods for preparing a drug for inhibiting non-infectious sterile inflammation include preparing a drug for inhibiting amyotrophic lateral sclerosis, inhibiting multiple sclerosis, inhibiting neuromyelitis optica, and inhibiting autoimmune encephalitis.

[0024] The present invention takes amyotrophic lateral sclerosis (ALS) as an example, and describes in detail the shRNA and recombinant vector for knocking down BST2 gene expression through the following Examples 2-8.

[0025] Example 2: Cellular localization analysis of BST2 gene expression The present invention extracts lumbar spinal cord tissue from SOD1G93A and wild-type (Wt) male mice at asymptomatic (30 days of age), presymptomatic (60 days of age), symptomatic (90 days of age), and late symptomatic (120 days of age) stages, and then uses immunofluorescence staining to localize BST2 gene expression in cells. Specifically, the following steps are involved: (1) Animal models: Select transgenic SOD1 G93A Mice (B6SJL-Tg-SOD1G93A-1Gur, No. 002726) were bred in an SPF animal facility. Homozygotes of this transgenic (Tg) mouse strain are inviable, while heterozygotes exhibit pathological changes and symptoms similar to ALS. Male transgenic (Tg) mice were mated with female wild-type (Wt) B6SJL mice of the same genetic background to obtain sufficient Tg animals. At 30 days of age, the mouse tails were lysed to release DNA for PCR amplification. Primers used in this experiment were designed and synthesized by Shanghai Shengong Biotechnology Co., Ltd.; primer sequences are shown in Table 1 below. The experimental sample system was prepared according to the instructions of the mouse tail identification kit provided by Guangzhou Yuanjing Biotechnology Co., Ltd. After thorough mixing, the system was placed in a PCR amplification instrument for amplification. The amplification program selected was: a: 95°C for 3 minutes, b: 95°C for 15 seconds, c: 60°C for 15 seconds, d: 72°C for 1 minute, e: 35 cycles of steps b, c, and d, and f: 72°C for 1 minute. The amplified products were subjected to nucleic acid gel electrophoresis. 9 μl of the sample was loaded on a 1.5% agarose gel containing GelStain stain. Electrophoresis was performed at 120 V for 36 minutes. The gel was taken out and observed on a BIO-RAD gel imaging system. Photos were taken and recorded.

[0026] Table 1: Primers for PCR amplification of mouse tail DNA

[0027] (2) Animal experimental grouping: SOD1G93A and wild male mice of the same age were selected at the asymptomatic stage (30 days old), presymptomatic stage (60 days old), symptomatic stage (90 days old), and late symptomatic stage (120 days old), namely Wt30d group, Tg30d group, Wt60d group, Tg60d group, Wt90d group, Tg90d group, Wt120d group, and Tg120d group, with 3 mice in each group. The changes in BST2 gene and CXCL10 protein expression in the spinal cord of mice in the asymptomatic and symptomatic stages were detected.

[0028] (3) Immunofluorescence staining: Six male SOD1G93A and Wt mice aged 30, 60, 90, and 120 days were selected and anesthetized with 1.25% tribromoethanol. The mice were then perfused with 1X PBS pre-cooled at 4°C at a rate of 12 ml / min for 4 minutes. The lumbar spinal cord was isolated on ice. Three mice in each group were frozen for protein extraction, and three mice were fixed with 4% paraformaldehyde for frozen sections. The frozen sections were baked in a 55°C oven for 30 minutes, marked with a water-blocking pen, and air-dried for 10 minutes. The sections were washed with PBS three times, each for 10 minutes. The sections were then blocked and permeabilized with 5% BSA containing 0.3% Triton X-100 for 1 hour at room temperature. After adding anti-IBa1 and BST2 antibodies and incubating overnight at 4°C, the cells were washed three times with PBS. The corresponding secondary antibodies Alexa Fluor 594 (Proteintech, 1:2000) and Alexa Fluor 488 (CellSignaling, 1:2000) were added at room temperature and incubated in the dark for 90 minutes. The cells were washed again with PBS three times, and the Hoechst antibody was added at room temperature for incubation for 10 minutes, and then washed again with PBS three times. Anti-fluorescence quenching sealant was added to seal and dry, and the anterior horn of the spinal cord was observed and photographed under a 40x fluorescence microscope. There were 3 mice in each group, and 3 sections were randomly selected from each mouse. A person who was not aware of the specific experimental groups used ImageJ software to perform grid analysis on the unilateral anterior horn of the spinal cord, drew a 50μm×50μm grid, covering the entire 40x microscope field of view, and manually and accurately counted the BST2 protein and the total number of cells. The data of the 3 sections of each mouse were averaged as the final data of the mouse. The staining results are shown in the figure. Figure 1 As shown in C.

[0029] The results show that: Figure 1 As shown in Figures A and B, compared with Wt mice (wild mice) of the same age, the BST2 protein in the anterior horn of the spinal cord of Tg mice (SOD1G93A transgenic mice) increased nearly 6 times at 60 days of age (7.33±1.86 vs. 1.03±0.25, P <0.01), while at 90 days of age (11.44±0.84 vs. 1.53±0.21, P <0.0001) and 120 days of age (14.00±0.67 vs. 2.00±0.53, P <0.0001) the increase is more significant. Figure 1 As shown in middle C, immunofluorescence co-staining analysis showed that the BST2 gene was mainly expressed in spinal cord microglia. The Merge legend in this figure is the result of the merger of the fluorescent staining images of IBa1 antibody, BST2 antibody and Hoechst antibody.

[0030] Example 3: CXCL10 expression was analyzed by qPCR, Western Blot and immunofluorescence staining. Line cell positioning (1) Detection of SOD1 at different stages by qPCR G93A CXCL10 mRNA expression in microglia of the anterior horn of the mouse spinal cord RNA was extracted from cell tissues using the TRIzol method. The experimental sample system was prepared according to the reverse transcription kit's instructions. After gentle mixing, the sample was transferred to a PCR instrument using a cycle of 42°C for 15 minutes and 85°C for 5 seconds. The reverse transcription product (cDNA) was used immediately for qPCR or stored at -80°C. The experimental sample system was prepared according to the qPCR kit's instructions. The primers used in the experiment are listed in Table 2 below. The reaction system was gently mixed and briefly centrifuged before performing qPCR real-time fluorescence quantitative nucleic acid amplification. The program selected was a: 94°C for 30 seconds, b: 94°C for 5 seconds, c: 60°C for 30 seconds, and d: repeat steps b and c for 40 cycles. A melting curve was then inserted.

[0031] Using the universal 2 -ΔΔCt The method (i.e., quantitative PCR (qPCR) data analysis method, used to calculate changes in relative gene expression, is used to compare the expression differences of target genes in different samples, especially between experimental and control groups) to calculate relative gene expression. The results showed that the expression of the target gene BST2 was different in different samples.

[0032] (2) Detection of SOD1 at different stages by Western Blot G93A Expression of CXXL10 protein in microglia of the anterior horn of the mouse spinal cord Lumbar spinal cord tissue was placed in an EP tube and lysed on ice using a mixture of RIPA and PMSF (RIPA:PMSF = 100:1). After ultrasonic homogenization, the supernatant (i.e., protein) was collected by centrifugation and stored frozen at -80°C until further use. Protein concentration was determined using a BCA protein assay kit. All protein samples were normalized and then loaded with SDS-PAGE loading buffer. Proteins were heated in a 100°C metal bath for 5 minutes to fully denature, cooled to room temperature, and stored at -80°C. Electrophoresis was performed using an 8%-12% SDS-PAGE gel. After assembling the electrophoresis apparatus, 20 μg of protein sample was added to each well, and an equal volume of 1× loading buffer was added to a blank well. Electrophoresis conditions were set to a constant voltage: 80 V for 30 minutes for the stacking gel and 120 V for 60-90 minutes for the separating gel. After electrophoresis, the transfer apparatus was installed and transferred at a constant current of 300 mA for 50 minutes in an ice-water bath. After transfer, the PVDF membrane was completely immersed in a TBST solution containing 5% skim milk powder. The membrane was placed on a shaker and gently agitated for 90 minutes at room temperature. Following blocking, the CXCL10 primary antibody was incubated. The PVDF membrane was cut according to the marker instructions and placed in the primary antibody solution. The membrane was incubated overnight at 4°C. The primary antibody was removed the next day, and the membrane was washed three times with TBST. An HRP anti-mouse secondary antibody (1:2000, Proteintech, SA-00001-1) was added and incubated for 90 minutes at room temperature. Afterward, the secondary antibody was removed and the membrane was washed three times with TBST.

[0033] Finally, the PVDF membrane was placed on a gel imager, and an appropriate amount of premixed ECL luminescent solution was added. After acquiring images with Image Lab, the grayscale values of the bands were quantitatively analyzed using Image J software. The results showed that the expression of the target protein CXXL10 was different in different samples.

[0034] (3) Immunofluorescence staining to detect SOD1 at different stages G93A Localization of CXCL10 in the anterior horn of the mouse spinal cord Six male SOD1G93A and Wt mice, each aged 30, 60, 90, and 120 days, were anesthetized with 1.25% tribromoethanol and perfused transcardially with 4°C pre-chilled 1X PBS at 12 ml / min for 4 minutes. The lumbar spinal cords were isolated on ice. Three mice in each group were cryopreserved for protein extraction, and three mice were fixed with 4% paraformaldehyde for cryosectioning. The cryosections were baked in a 55°C oven for 30 minutes, blocked with a water-blocking pen, and air-dried for 10 minutes. The sections were then washed three times with PBS for 10 minutes each. The sections were then blocked and permeabilized with 5% BSA containing 0.3% Triton X-100 for 1 hour at room temperature. After adding anti-IBa1 and CXCL10 antibodies and incubating overnight at 4°C, the cells were washed three times with PBS. The corresponding secondary antibodies Alexa Fluor 594 (Proteintech, 1:2000) and Alexa Fluor 488 (Cell Signaling, 1:2000) were added at room temperature and incubated in the dark for 90 minutes. After that, the cells were washed again three times with PBS. Hoechst was added and incubated for 10 minutes at room temperature. The cells were washed again with PBS three times. Anti-fluorescence quenching sealant was added and sealed and dried. The anterior horn of the spinal cord was observed under a 40x fluorescence microscope and photographed. The staining results are shown in Figure 2. Figure 7 shown.

[0035] The above results show that: Figure 6 As shown in Figure A, the expression of CXCL10 gene in the spinal cord of Tg mice at 90 days of age was approximately 1.8 times higher than that of Wt mice (1.83±0.15 vs. 1.01±0.03, P <0.001), and the increase was more obvious at 120 days of age, increasing by about 3 times (3.04±0.43 vs. 1.03±0.02, P <0.01). Further, if Figure 6 As shown in Figures B and C, Western Blot analysis also revealed that the expression of BST2 protein in the spinal cord of Tg mice at 90 days of age was approximately 1.6 times higher than that of Wt mice (2.52±0.39 vs. 1.69±0.22, P <0.05), and increased by about 2.6 times at 120 days of age (3.89±0.31 vs. 1.47±0.43, P <0.01). Figure 7 As shown in the figure, immunofluorescence co-localization staining suggests that CXCL10 is mainly expressed in microglia. The Merge image in this figure is the result of merging the fluorescence staining images of IBa1 antibody, BST2 antibody and Hoechst antibody.

[0036] Example 4: Effect of shRNA in Example 1 on the expression of BST2 gene in BV2 cells (1) BST2-shRNA lentiviral coating: Preparation of RNAi lentiviral clones: Upstream and downstream primers were synthesized from the RNA (RNAi) interference sequence targeting the BST2 gene to obtain the sense strand shown in SEQ ID NO.1 and the antisense strand shown in SEQ ID NO.2 (or the sense strand shown in SEQ ID NO.3 and the antisense strand shown in SEQ ID NO.4) in Example 1. The synthesized paired primer powders were dissolved in annealing buffer, incubated in a 90°C water bath for 15 min, and naturally cooled to room temperature. The double-digested linearized GV493 vector and the annealed double-stranded DNA were ligated with T4 DNAligase at 16°C for 1-3 h. The exchange reaction products were transformed into competent cells and then cultured for colonies. Single clones were extracted for sequencing identification. After sequencing identification, the recombinant vector was extracted to obtain the BST2 knockdown lentiviral vector (i.e., the recombinant vector in Example 1). Lentivirus packaging and quality testing: Three plasmids (20 μg of GV vector plasmid, 15 μg of pHelper1.0 vector plasmid, and 10 μg of pHelper2.0 vector plasmid) were co-transfected into 293T cells. The recombinant vector was harvested 48-72 hours after transfection, and concentrated, purified, and quality tested.

[0037] (2) Cell experiments ① Cell culture After thawing, add an appropriate amount of complete culture medium to the frozen BV2 cells and culture them in an incubator. Replace the complete culture medium every 1-2 days depending on the cell culture status to provide the cells with the nutrients they need for growth. When the cell density reaches above 80%, perform cell passage.

[0038] ② Method for constructing stably transfected cell lines a. 24 hours before transfection, seed the cells cultured in step ① into a 6-well plate so that the cell density reaches 70-80% at the time of transfection.

[0039] b. Prepare transfection complexes separately: add 2 mL complete medium + 5 μL BST2 knockdown lentiviral vector (titer 5 × 108 / mL) + 20 μL Polybrene to tube A. Add 2 mL complete medium + 5 μL empty vector lentivirus (titer 5 × 108 / mL) + 20 μL Polybrene to tube B. Mix gently.

[0040] c. Add the transfection complexes in tubes A and B to the corresponding wells of a 6-well plate and gently shake the plate to mix.

[0041] d. Place the cells in a 37°C, 5% CO2 incubator for 24 hours and then replace with complete medium.

[0042] e. Observe the transfection efficiency under a fluorescence microscope 48 hours after transfection. Then, replace the culture medium with complete medium containing puromycin (5 μg / mL). Replace the complete medium containing puromycin (5 μg / mL) every 2 days for 5-7 days. Observe cell survival until the untransfected cells die completely.

[0043] f. Detect BST2 mRNA and protein expression levels by qPCR and Western blot.

[0044] g. Continue culturing the cells with complete medium containing puromycin (2 μg / mL).

[0045] ③ According to the stable transfection cell line construction method in ②, the BV2 microglia cultured in ① were divided into a BST2 knockdown group (BST2-shRNA) and a control group (NC-shRNA). The BST2-shRNA group was transfected with 5 μL of BST2 knockdown lentiviral vector (titer of 5 × 108 / mL), and the NC-shRNA group was transfected with an equal amount of empty vector lentivirus for transcriptome sequencing and molecular verification.

[0046] ④ Transcriptome sequencing and differential gene expression analysis a. Transcriptome sequencing BV2 cells in the BST2 knockdown group (BST2-shRNA) and control group (NC-shRNA) were washed with PBS and then 1 mL of TRIzol was added. The mixture was pipetted against the bottom of the culture dish until the liquid was evenly distributed, and then three samples were collected from each group. RNA extraction, sample detection, library construction and quality control were performed on each sample, and sequencing was performed on an Illumina high-throughput sequencer.

[0047] b. Differential gene expression analysis Sequencing results were used to analyze differential gene expression. DESeq2 software (1.20.0) was used to analyze the differential expression between the BST2 knockdown group and the control group. The Benjamini & Hochberg method was used to correct the P value, and the corrected P value and |log2foldchange| were used as the thresholds for significant differential expression.

[0048] The analysis results show that: Figure 3 As shown in Figure A, there were significant differences in the expression of multiple genes between the BST2-shRNA group and the NC-shRNA group, with some genes upregulated and some downregulated. Figure 3As shown in Figure B, compared with the NC-shRNA group, the expression of anti-inflammatory molecules such as CD93, Macrophage Receptor with Collagenous Tail 1 (Mrc1), Tissue Inhibitor of Metalloproteinase 1 (Timp1), Immunoglobulin Alpha Chain Constant Region Gene (Itgax), and Interleukin 1 Receptor Like 1 (IL1RL1) in the BST2-shRNA group were increased, while the expression of pro-inflammatory factors such as IL6, Interferon-induced Protein with Tetratricopeptide Repeats 1 (IFIT1), Nuclear Factor Kappa B p50 Subunit (P50, gene numbered NFκB1), and Lipocalin 2 ,LCN2), CXCL10 (XC chemokine ligand 10, also known as interferon-induced protein 10), etc.

[0049] ⑤ Conduct molecular verification: a. Real-time fluorescence quantitative PCR (qRT-PCR) technology was used to detect changes in neuroinflammatory response caused by knockdown of BST2 expression in BV2 cells.

[0050] RNA was extracted from BV2 cells using the TRIzol method. The experimental sample system was prepared according to the instructions of the reverse transcription kit. After gentle mixing, it was transferred to a PCR instrument. The program selection was 42°C for 15min and 85°C for 5s. The reverse transcription product (cDNA) was immediately used for qPCR or stored at -80°C. The experimental sample system was prepared according to the instructions of the qPCR kit. The primer sequences shown in Table 2 were used for amplification. The reaction system was gently mixed. After a brief centrifugation, qPCR real-time fluorescence quantitative nucleic acid amplification was performed. The program selections were a: 94°C for 30s, b: 94°C for 5s, c: 60°C for 30s, d: repeat steps b and c for 40 cycles, and a melting curve was inserted. Data analysis: 2 -ΔΔCt Methods The relative gene expression levels were calculated.

[0051] Table 2: Primers used for PCR amplification

[0052] The results showed that in in vitro cell experiments, Figure 2 As shown in Figures A, B, and C, the expression of BST2 gene in the BST2 knockdown group was significantly reduced compared with the control group. Figure 5 As shown in middle G, knockdown of BST2 gene expression resulted in a 69% decrease in CXCL10 gene expression (0.91±0.11 vs. 0.28±0.05, P <0.05). Figure 4 As shown in A, the expression of CD86 gene in the BST2-shRNA group was reduced by about 40% (1.00±0.04 vs. 0.61±0.07, P <0.05); Figure 4 As shown in middle B, the expression of CD206 gene, a surface marker of anti-inflammatory phenotype, increased by approximately 3.6-fold (1.00±0.06 vs. 3.63±0.41, P <0.01); some pro-inflammatory factors were also found, such as Figure 4 As shown in C, D, E, and F, the IL6 gene expression decreased by approximately 38% (0.95±0.05 vs. 0.59±0.04, P <0.05), P50 gene decreased by about 40% (1.01±0.05 vs. 0.64±0.05, P <0.05), IFIT1 gene decreased by about 40% (1.04±0.05 vs. 0.59±0.01, P <0.01), LCN2 gene decreased by about 45% (1.02±0.05 vs. 0.55±0.03, P <0.01). According to the above data, knocking down the BST2 gene may promote the transformation of BV2 cells to an anti-inflammatory phenotype, thereby exerting an anti-inflammatory effect.

[0053] b. The changes in CXCL10 protein expression after knockdown of BST2 gene expression in BV2 cells were detected by Western Blot method.

[0054] First, harvested BV2 cells were placed in EP tubes and lysed on ice using a mixture of RIPA and PMSF (RIPA:PMSF = 100:1). After ultrasonic homogenization, the supernatant (i.e., protein) was collected by centrifugation and stored frozen at -80°C until further use. Protein concentration was determined using a BCA protein assay kit. All protein samples were normalized to the same concentration and loaded with SDS-PAGE loading buffer. Proteins were heated in a 100°C metal bath for 5 minutes to fully denature, cooled to room temperature, and stored at -80°C. Next, electrophoresis was performed on 8%-12% SDS-PAGE gels. After assembling the electrophoresis apparatus, 20 μg of protein sample was added to each well, and an equal volume of 1× loading buffer was added to a blank well. Electrophoresis conditions were set to a constant voltage: 80 V for 30 minutes for the stacking gel and 120 V for 60-90 minutes for the separating gel. Finally, after electrophoresis, install the transfer apparatus and set the transfer conditions to a constant current of 300 mA for 50 minutes in an ice-water bath. After transfer, completely immerse the PVDF membrane in TBST containing 5% skim milk powder, place it on a shaker, and incubate it at room temperature for 90 minutes. After blocking, proceed to primary antibody incubation. Cut the PVDF membrane according to the marker instructions and incubate it with the primary antibodies listed in Table 3 below. Incubate overnight at 4°C. The next day, remove the primary antibody and wash the membrane three times with TBST. Then, add HRP anti-rabbit secondary antibodies (1:2000, Proteintech, SA-00001-2) and anti-mouse secondary antibodies (1:2000, Proteintech, SA-00001-1). Incubate at room temperature for 90 minutes, remove the secondary antibodies, and wash the membrane three times with TBST. Finally, place the PVDF membrane on a gel imager, add an appropriate amount of premixed ECL luminescent solution, collect images with Image Lab, and use Image J software to quantify the grayscale value of the bands.

[0055] Table 3: Summary of primary antibodies

[0056] like Figure 5 As shown in H and I, with β-actin as a reference, Western Blot analysis revealed that CXCL10 protein also decreased by approximately 45% after knockdown of BST2 expression (1.00±0.02 vs. 0.56±0.17, P <0.01), these findings indicate that knockdown of BST2 can reduce the expression of CXCL10 molecules.

[0057] Example 5: Behavioral evaluation and analysis of experimental mice after knockdown of BST2 gene expression (1) Body weight measurement: Starting from 60 days of age, body weight was measured every other day and the values were recorded until death, to observe the changes in body weight between the two groups.

[0058] (2) Rotarod fatigue test: Each group of mice was trained for 7 days. Then, starting from the 70th day of age, the mice were tested every other day using a rotarod fatigue tester at a constant speed of 20 r / min. The exercise time of the mice was recorded (up to 5 minutes) to evaluate their exercise status. The measurement was repeated 3 times for each experiment, and the best result was recorded. The date of onset was determined as follows: if the best exercise time of the mice in a certain experiment was less than 5 minutes, that day was recorded as the date of onset of the mice. (3) Determination of the date of death of mice: According to animal ethics principles, when the mouse's hind limbs are completely paralyzed and unable to eat, the mouse is placed on a flat surface with its back facing the ground. If the mouse cannot turn around and return to a normal posture after 30 seconds, the day is recorded as the date of death and the mouse is euthanized.

[0059] The experimental results show that: Figure 8 As shown in Figure A, the weight loss rate of mice in the BST2-shRNA group was significantly slower than that of mice in the NC-shRNA group. Figure 8 As shown in B and C, knockdown of BST2 in the pre-symptomatic stage can delay the onset of disease by about 1 week (115.50±5.20 days vs. 109.83±6.29 days, P <0.05), which is equivalent to 280 days for humans. Figure 9 As shown in Figures D and E, while survival was prolonged by approximately one week (130.00 ± 5.26 days vs. 124.83 ± 8.02 days, P < 0.05), the disease course was not prolonged. These results suggest that knocking down BST2 may delay the onset of ALS.

[0060] Example 6: Experimental study of mice after knockdown of BST2 gene expression Motor neuron analysis Frozen spinal cord tissue was placed in a -20°C cryostat and serially sectioned at 10 μm thickness. 200 sections were mounted on electrostatically coated slides. One of every four sections (50 sections per mouse) was Nissl-stained to count the number of motor neurons between the two groups. Sections were immersed in 1% toluidine blue solution (1 g toluidine blue, 1 g sodium borate, 100 ml distilled water) for 10 minutes. After washing with distilled water, sections were dehydrated in a gradient of 70% ethanol for 36 minutes, 80% ethanol for 21 minutes, 90% ethanol for 21 minutes, and 100% ethanol for 21 minutes. Sections were cleared with xylene I and xylene II for 5 minutes each. Sections were mounted in neutral gum, air-dried, and observed under a microscope and photographed for storage. A person who was not aware of the specific experimental group counted the total number of motor neurons in the anterior horn of the unilateral lumbar spinal cord. Motor neuron counting criteria were: ① the motor neuron was located in the anterior horn region anterior to the central canal of the spinal cord; ② the motor neuron diameter was >20 μm; and ③ the motor neuron had a distinct nucleus.

[0061] The results showed that: Figure 10 As shown in A and B, knockdown of BST2 preserved approximately 44.5% of the number of motor neurons in SOD1G93A mice compared to the control group (277.33.00±11.06 vs. 154.33±9.61, P <0.001).

[0062] Example 7: After knocking down BST2 gene expression SOD1 G93A Mouse spinal cord anterior horn tissue Neuroinflammatory changes Analysis (1) Using the primers shown in Table 2 above, the expression of SOD1 after knockdown of BST2 gene was detected by qPCR. G93A The mRNA expression of BST2, CD86, CD206, IL6, P50, IFIT1 and LCN2 in the anterior horn of the mouse spinal cord.

[0063] (2) Western Blot was used to detect the expression of SOD1 in BST2 knockdown cells using the primary antibodies listed in Table 3. G93A Protein expression of CD86 and CD206 in the anterior horn tissue of mouse spinal cord.

[0064] (3) Immunofluorescence staining to detect SOD1 in patients with BST2 gene knockdown G93A Changes in the number of microglia in the anterior horn of the mouse spinal cord.

[0065] According to the results of the above animal experiments, Tulin antibody was used as an internal reference. Figure 11As shown in Figures A, B, and C, compared with the NC-shRNA group, BST2-shRNA was able to significantly knock down the mRNA and protein expression of BST2 in the spinal cord of mice. Figure 14 As shown in A, B, C, D, E, and F, by reducing the number of iBa1-positive microglia, the expression of CD86 gene in the BST2-shRNA group mice was reduced by about 47% (0.98±0.02 vs. 0.54±0.08, P<0.05), the expression of CD206 gene increased by about 1 fold (1.04±0.04 vs. 2.05±0.13, P<0.01), the expression of IL6 gene was reduced by about 49% (1.03±0.06 vs. 0.51±0.01, P<0.01), the expression of P50 gene was reduced by about 28% (1.03±0.03 vs. 0.73±0.06, P<0.05), and the expression of IFIT1 gene was reduced by about 45% (1.00±0.04 vs. 0.55±0.02, P<0.01), and LCN2 gene expression decreased by about 50% (1.03±0.04 vs. 0.51±0.06, P<0.05). Figure 13 As shown in Figures F, G, and H, using β-actin as an internal reference, the expression of CD86 protein in mice in the BST2-shRNA group decreased by approximately 50% (1.02±0.10 vs. 0.49±0.09, P<0.05), while the expression of CD206 protein increased by approximately 70% (1.00±0.10 vs. 1.73±0.16, P<0.05). Figure 12 As shown in D and E, the number of microglia in the anterior horn of the spinal cord of mice in the BST2-shRNA group was reduced by 38.2% compared with that in the NC-shRNA group (28.43±3.75 vs. 17.57±1.90, P <0.05).

[0066] Example 8: Knockdown of BST2 exerts anti-inflammatory effects by reducing CD8 and T cell infiltration through CXCL10 (1) The levels of CXCL10 protein, CXCR3 protein and CD8 protein were detected by Western blotting. Among them, XC chemokine ligand 10 (CXCL10), also known as interferon-induced protein 10, mainly binds to the receptor CXCR3, participates in the recruitment and activation of immune cells, and can induce the migration of T cells. In the inflammatory response, CXCL10 can aggravate the infiltration of immune cells and tissue damage, especially in chronic inflammation and autoimmune diseases. It plays a key role in attracting activated T cells, monocytes and dendritic cells through CXCR3, and promotes the infiltration of immune cells in the inflammatory site.

[0067] (2) Fluorescence staining analysis was performed using the immunofluorescence staining method described in Example 2 to observe the co-localization of CXCR3 and CD8+ T cells.

[0068] The test results show that: Figure 15 As shown in A, B, and C, using β-actin as an internal reference, the expression of CXCL10 protein in the spinal cord of mice in the BST2-shRNA group was reduced by 45% compared with that in the NC-shRNA group (1.00±0.15 vs. 0.55±0.04, P <0.01), and CXCR3 protein expression decreased by 37% (1.00±0.08 vs. 0.64±0.09, P <0.01); Figure 16 As shown in the figure, immunofluorescence staining revealed that CXCR3 protein co-localized with CD8 protein+T cells. The Merge image in this figure is the result of merging the fluorescence staining images of CD8, CXCR3 and Hoechst. Figure 17 As shown in E and F, compared with the NC-shRNA group, the expression of CD8 protein in the spinal cord of the BST2-shRNA group mice was reduced by 67.2% (1.00±0.07 vs. 0.33±0.12, P <0.001).

[0069] According to the above examples, the shRNA and recombinant vector for knocking down BST2 gene expression provided by the present invention play an important role in inhibiting non-infectious sterile inflammation. For example, they can effectively delay the onset of ALS and have a protective effect on the anterior horn motor neurons of the spinal cord of ALS mice. They can be promoted and applied in the treatment of ALS and have good application prospects. They also provide a direction and technical basis for finding and developing new therapeutic drugs for ALS, which is beneficial for ALS patients to get rid of the pain of the disease as soon as possible. Obviously, those skilled in the art will understand that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations are possible in the embodiments of the present invention. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. A shRNA for knocking down BST2 gene expression, characterized in that The shRNA includes Bst2-shRNA-1 or Bst2-shRNA-2; The Bst2-shRNA-1 includes a sense strand with a nucleotide sequence as shown in SEQ ID NO.1 and an antisense strand with a nucleotide sequence as shown in SEQ ID NO.2; The Bst2-shRNA-2 includes a sense strand with a nucleotide sequence as shown in SEQ ID NO.3 and an antisense strand with a nucleotide sequence as shown in SEQ ID NO.

4.

2. The shRNA according to claim 1, wherein The Bst2-shRNA-1 is designed based on the shRNA target sequence shown in SEQ ID NO.5, and the Bst2-shRNA-2 is designed based on the shRNA target sequence shown in SEQ ID NO.

6.

3. The shRNA according to claim 1, wherein The shRNA knocks down BST2 gene expression in microglia in the spinal cord and inhibits T lymphocyte infiltration.

4. The shRNA according to claim 3, wherein After the expression of BST2 gene in the microglia in the spinal cord is knocked down, the expression of CXCL10 gene in the microglia in the spinal cord is inhibited.

5. The shRNA according to claim 1 or 4, characterized in that After the expression of the BST2 gene in the microglia in the spinal cord is knocked down, the expression of any one or more of the CD93 gene, Mrc1 gene, Timp1 gene, Itgax gene and IL1RL1 gene in the microglia in the spinal cord is enhanced, and the expression of any one or more of the IL6 gene, IFIT1 gene, P50 gene, CD86 gene and LCN2 gene is inhibited. A recombinant vector comprising the shRNA according to any one of claims 1 to 5.

7. The recombinant vector according to claim 6, characterized in that The shRNA is cloned into an interfering lentivirus, which includes GV493.

8. Use of the shRNA according to any one of claims 1 to 5 or the recombinant vector according to claim 6 or 7 in the preparation of a medicament for inhibiting non-infectious sterile inflammation.

9. The use according to claim 8, characterized in that The preparation of drugs for inhibiting non-infectious sterile inflammation includes the preparation of drugs for inhibiting amyotrophic lateral sclerosis, multiple sclerosis, neuromyelitis optica and autoimmune encephalitis.

Images