Biomarkers associated with sweet corn kernel zeaxanthin content traits and uses thereof

Abstract

The present application relates to the technical field of molecular marker, in particular to a biomarker related to the trait of maize xanthophyll content in sweet corn kernels and application thereof. The present application locates QTL of the trait of maize xanthophyll content in kernels by using RIL population, finds that there is one major QTL related to the trait of maize xanthophyll content in sweet corn kernels on the 6th chromosome of maize, which is located between SNP sites S_chr6:83027949 and S_chr6:84835891, and contributes to the phenotype of maize xanthophyll content in kernels by 18.69%, the major QTL can be used for screening or assisting in screening sweet corn with relatively high maize xanthophyll content, when the genotype of S_chr6:83027949 is GG and the genotype of S_chr6:84835891 is AA, the maize xanthophyll content is relatively high, which provides technical support for molecular marker assisted breeding, and has important significance for improving the nutritional quality of sweet corn.

Description

Technical Field

[0001] This invention relates to the field of molecular marker technology, and in particular to biomarkers related to the trait of zeaxanthin content in sweet corn kernels and their applications. Background Technology

[0002] Zeaxanthin, also known as zeaxanthin, is an important carotenoid, chemically named 3,3'-dihydroxyβ-carotene. It is a fat-soluble terpene compound and is yellow in color. It possesses various physiological functions, including antioxidant, visual protection, and anti-inflammatory effects. It is widely found in nature, especially in corn and goji berries. Sweet corn is an important type of fresh corn, and dietary intake or supplementation with zeaxanthin offers significant health benefits. Increasing the zeaxanthin content of sweet corn is currently one of the important directions in sweet corn nutritional quality breeding.

[0003] Zeaxanthin content is an important component of carotenoid content. Grain zeaxanthin content is a complex quantitative trait controlled by multiple genes. Traditional breeding methods rely on phenotypic selection, which is time-consuming, inefficient, and easily affected by environmental factors. Molecular marker-assisted selection (MTA) can directly target specific genes or QTLs for early screening, significantly improving breeding efficiency. Although previous studies have also performed QTL mapping for the trait of carotenoid content in sweet corn kernels, detecting some quantitative trait loci controlling this content, studies specifically targeting zeaxanthin for QTL mapping are relatively few. Research on zeaxanthin has focused more on its physiological functions, metabolic pathways, and associations with other pigments. Identifying QTLs related to zeaxanthin content in sweet corn kernels is of great significance for improving the nutritional quality of sweet corn. Summary of the Invention

[0004] To address the aforementioned problems, this invention provides biomarkers related to the zeaxanthin content trait in sweet corn kernels and their applications. The biomarkers provided by this invention are major-effect QTLs related to the zeaxanthin content in sweet corn kernels, which can be used to screen or assist in screening sweet corn with relatively high zeaxanthin content, resulting in more accurate screening results and significant benefits for improving the nutritional quality of sweet corn.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] This invention provides biomarkers related to the zeaxanthin content trait in sweet corn, the biomarkers including SNP01 and SNP02;

[0007] SNP01 is located at 83027949 bp on chromosome 6 of the maize B73 RefGen_V3 genome, with a base of G or C; SNP02 is located at 84835891 bp on chromosome 6 of the maize B73 RefGen_V3 genome, with a base of A or G.

[0008] When the genotype of SNP01 is GG and the genotype of SNP02 is AA, the zeaxanthin content of sweet corn is relatively high.

[0009] Preferably, the biomarker includes a first nucleic acid molecule containing the SNP01 information and a second nucleic acid molecule containing the SNP02 information; the nucleotide sequence of the first nucleic acid molecule is shown in SEQ ID NO.1; and the nucleotide sequence of the second nucleic acid molecule is shown in SEQ ID NO.2.

[0010] This invention provides the application of the biomarkers described in the above technical solutions or products that detect the biomarkers described in the above technical solutions in 1) and / or 2):

[0011] 1) Screening or assisting in the screening of sweet corn with relatively high corn xanthine content;

[0012] 2) Cultivate or assist in the cultivation of sweet corn varieties with high maize xanthine content;

[0013] When the genotype of SNP01 is GG and the genotype of SNP02 is AA, the zeaxanthin content of sweet corn is relatively high.

[0014] Preferably, the zeaxanthin content is the zeaxanthin content in sweet corn kernels.

[0015] Preferably, the product includes a primer set and / or a kit.

[0016] The present invention provides a primer set for the biomarker described in the above technical solution, the primer set comprising a first primer pair and a second primer pair; the nucleotide sequence of the upstream primer of the first primer pair is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the first primer pair is shown in SEQ ID NO.4; the nucleotide sequence of the upstream primer of the second primer pair is shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer of the second primer pair is shown in SEQ ID NO.6.

[0017] This invention provides a method for screening or assisting in the screening of sweet corn with relatively high zeaxanthin content, comprising the following steps:

[0018] The genotypes of SNP01 and SNP02 in the biomarkers described in the above technical solution for the sweet corn to be tested were determined.

[0019] Based on the genotype results, sweet corn with genotype GG for SNP01 and AA for SNP02 was selected, which is sweet corn with relatively high zeaxanthin content.

[0020] This invention provides a method for breeding or assisting in the breeding of sweet corn varieties with high maize xanthine content, comprising the following steps:

[0021] The genotypes of SNP01 and SNP02 in the biomarkers described in the above technical solution for the sweet corn to be tested were determined.

[0022] Discard the sweet corn with SNP01 genotype CC and SNP02 genotype GG, and perform self-pollination and / or hybridization on the remaining sweet corn. Keep the sweet corn with SNP01 genotype GG and SNP02 genotype AA in the offspring, which are sweet corn with relatively high zeaxanthin content.

[0023] Preferably, the determination includes: performing PCR amplification on the sweet corn to be tested, and sequencing the obtained PCR amplification product; the primer set for the PCR amplification includes the primer set described in the above technical solution.

[0024] Preferably, the zeaxanthin content is the zeaxanthin content in sweet corn kernels.

[0025] Beneficial effects:

[0026] This invention provides biomarkers related to the zeaxanthin content trait in sweet corn, including SNP01 and SNP02; SNP01 is located at 83027949 bp on chromosome 6 of the maize B73 RefGen_V3 genome, with a base of G or C; SNP02 is located at 84835891 bp on chromosome 6 of the maize B73 RefGen_V3 genome, with a base of A or G; when the genotype of SNP01 is GG and the genotype of SNP02 is AA, the zeaxanthin content of sweet corn is relatively high. This invention utilizes sweet corn inbred lines SHL01 and SHL03 as parents to construct a Restricted Intake Line (RIL) population (permanent population). High-performance liquid chromatography (HPLC) was used to detect the zeaxanthin content trait data in sweet corn kernels. QTL mapping of the zeaxanthin content trait in kernels was performed using the RIL population. One major QTL associated with zeaxanthin content in sweet corn kernels was discovered on chromosome 6 of maize, located between SNP loci S_chr6:83027949 and S_chr6:84835891. This major QTL contributes 18.69% to the zeaxanthin content phenotype in sweet corn kernels. This major QTL can be used to screen or assist in screening sweet corn with relatively high zeaxanthin content, resulting in more accurate screening results. This provides technical support for molecular marker-assisted breeding and is of great significance for improving the nutritional quality of sweet corn. Attached Figure Description

[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0028] Figure 1 Map showing the location of closely linked SNPs on maize chromosomes for major QTLs related to maize xanthine content in sweet corn kernels. Detailed Implementation

[0029] This invention provides biomarkers related to the zeaxanthin content trait in sweet corn, the biomarkers including SNP01 and SNP02;

[0030] SNP01 is located at 83027949 bp on chromosome 6 of the maize B73 RefGen_V3 genome, with a base of G or C; SNP02 is located at 84835891 bp on chromosome 6 of the maize B73 RefGen_V3 genome, with a base of A or G.

[0031] When the genotype of SNP01 is GG and the genotype of SNP02 is AA, the zeaxanthin content of sweet corn is relatively high.

[0032] This invention utilizes a RIL population to perform QTL mapping for the xanthine content trait in maize kernels, and screens out a major-effect QTL related to the xanthine content trait in sweet maize kernels, which is suitable for predicting the xanthine content trait in sweet maize kernels. The xanthine content in sweet maize kernels can be predicted using a combination of two SNP markers, providing technical support for molecular marker-assisted breeding.

[0033] In one embodiment, the biomarker includes a first nucleic acid molecule containing the SNP01 information and a second nucleic acid molecule containing the SNP02 information; the nucleotide sequence of the first nucleic acid molecule is shown in SEQ ID NO.1; the nucleotide sequence of the second nucleic acid molecule is shown in SEQ ID NO.2, as detailed below:

[0034] SEQ ID NO.1:

[0035] 5'-TTGGAGCTGCTCAAATTTGACTTTGTCTTCTACAGTACTGCAGGC GGCTTGCTGCCTGCTGCCAAGGCTGCCAGCTTTTGAGGACGACGGCTGTGGACATSACATGCACATGCATGCAGATCTTAGCTTACCGATCGATCATACCTGACAGTGAACTATATCATCTTGTTGCGCTGCATCTGTGAGGGCTGAGGCAGGTTC-3';

[0036] SEQ ID NO.2:

[0037] 5'-ACCCGTGATTTGGATCGCACCAAGGTGCCAGACTCTGGCATTGTT CCTGCTGCTGGTGGTGATGGAGGCGTGCACGATGCGGATGCCGATGGAACACGAARGCAGCTGAAGGTTCCTAGTTCAATGTTGGTTTCGGAGATGAATGACAGTGCTGTCGAAGCTGCGCCTATAGAAGAGGATCATGCTCAAGACATGTCTTGAA-3';

[0038] In this system, both bases S and R are degenerate bases, with base S being G / C and base R being A / G.

[0039] Using the biomarkers provided by this invention for molecular marker-assisted selection, it is only necessary to detect the genotype of SNP bases at specific loci, or the genotype at position 101 of the first and second nucleic acid molecules, to predict the zeaxanthin content trait in sweet corn kernels. The identification method is simple, the selection efficiency is high, the selection target is clear, and it is not affected by the environment. SNP markers can also achieve high throughput. It can be used for molecular marker-assisted breeding of the zeaxanthin content trait in sweet corn kernels at the seedling stage, and it can also be used for molecular aggregation breeding of the trait.

[0040] Based on the above advantages, the present invention provides the application of the biomarkers described in the above technical solutions or products that detect the biomarkers described in the above technical solutions in 1) and / or 2):

[0041] 1) Screening or assisting in the screening of sweet corn with relatively high corn xanthine content;

[0042] 2) Cultivate or assist in the cultivation of sweet corn varieties with high maize xanthine content;

[0043] When the genotype of SNP01 is GG and the genotype of SNP02 is AA, the zeaxanthin content of sweet corn is relatively high.

[0044] This invention can cultivate or assist in the cultivation of sweet corn varieties with high maize xanthine content by discarding sweet corn with SNP01 genotype CC and SNP02 genotype GG in the biomarkers, and retaining SNP01 genotype GG and SNP02 genotype AA.

[0045] In one embodiment, the zeaxanthin content is the zeaxanthin content in sweet corn kernels.

[0046] In one implementation, the product includes a primer set and / or a kit.

[0047] Based on the above advantages, the present invention provides a primer set for the biomarker described in the above technical solution. The primer set includes a first primer pair and a second primer pair. The nucleotide sequence of the upstream primer of the first primer pair is shown in SEQ ID NO. 3, and the nucleotide sequence of the downstream primer of the first primer pair is shown in SEQ ID NO. 4. The nucleotide sequence of the upstream primer of the second primer pair is shown in SEQ ID NO. 5, and the nucleotide sequence of the downstream primer of the second primer pair is shown in SEQ ID NO. 6, as detailed below:

[0048] SEQ ID NO.3: 5'-TTGGAGCTGCTCAAATTTGA-3';

[0049] SEQ ID NO.4: 5'-GAACCTGCCTCAGCCCTCAC-3';

[0050] SEQ ID NO.5: 5'-ACCCGTGATTTGGATCGCAC-3';

[0051] SEQ ID NO. 6: 5'-TTCAGACATGTCTTGAGCAT-3'.

[0052] The primer set provided by this invention can specifically amplify the first and second nucleic acid molecules in the above-mentioned technical solution. Then, through sequencing analysis of the first and second nucleic acid molecules, the genotype of SNP01 is selected as GG and the genotype of SNP02 is selected as AA, thereby screening out sweet corn with relatively high maize xanthine content. The identification method is simple, the selection efficiency is high, the selection target is clear, and it is not affected by the environment. SNP markers can also achieve high-throughput detection.

[0053] Based on the above advantages, the present invention provides a method for screening or assisting in screening sweet corn with relatively high zeaxanthin content, comprising the following steps:

[0054] The genotypes of SNP01 and SNP02 in the biomarkers described in the above technical solution for the sweet corn to be tested were determined.

[0055] Based on the genotype results, sweet corn with genotype GG for SNP01 and AA for SNP02 was selected, which is sweet corn with relatively high zeaxanthin content.

[0056] Based on the above advantages, the present invention provides a method for cultivating or assisting in the cultivation of sweet corn varieties with high maize xanthine content, comprising the following steps:

[0057] The genotypes of SNP01 and SNP02 in the biomarkers described in the above technical solution for the sweet corn to be tested were determined.

[0058] Discard the sweet corn with SNP01 genotype CC and SNP02 genotype GG, and perform self-pollination and / or hybridization on the remaining sweet corn. Keep the sweet corn with SNP01 genotype GG and SNP02 genotype AA in the offspring, which are sweet corn with relatively high zeaxanthin content.

[0059] In one embodiment, the assay includes: performing PCR amplification on the sweet corn to be tested, and sequencing the obtained PCR amplification product; the primer set for the PCR amplification includes the primer set described in the above-mentioned technical solution. In one embodiment, the PCR amplification system is: 2×PCRmix 25μL, ddH2O 22μL, forward and reverse primers 1μl each, and DNA template 1μl. In one embodiment, the PCR amplification program is: denaturation at 95℃ for 3 min; denaturation at 95℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 30 s, for a total of 35 cycles; and a final extension at 72℃ for 5 min.

[0060] In one embodiment, the zeaxanthin content is the zeaxanthin content in sweet corn kernels.

[0061] To further illustrate the present invention, the following detailed description, in conjunction with embodiments and accompanying drawings, describes the biomarkers related to the zeaxanthin content trait in sweet corn kernels provided by the present invention and their applications, but these should not be construed as limiting the scope of protection of the present invention.

[0062] Example 1

[0063] 1. Construction of a genetic map of sweet corn RIL population.

[0064] A Reproductive Inbred Line (RIL) population was constructed using sweet maize inbred lines SHL01 and SHL03 as parents and planted at the Zhuangxing Experimental Station of the Shanghai Academy of Agricultural Sciences. After emergence, leaf tissues from the RIL population were collected for DNA extraction. Genotyping by target sequencing (GBTS) was used to genotype 236 individuals from the F7 generation, yielding 10,000 SNP loci. PLINK software was used for quality control filtering, selecting SNPs with a deletion rate of less than 20%, a minimum allele frequency greater than 0.05, and a heterozygosity of less than 20%. The constructed genetic map contained 4253 high-quality SNP markers, divided into 10 linkage groups. The total genetic distance was 3052.3 cM, and the average genetic distance between SNP markers was 0.7 cM.

[0065] 2. Detection of zeaxanthin content in sweet corn kernels

[0066] RIL families were constructed using sweet maize inbred lines SHL01 and SHL03 as parents. These RIL families were then planted at the Zhuangxing Experimental Station of the Shanghai Academy of Agricultural Sciences using a randomized block design. Each RIL family was planted in two rows, with three replicates, and normal field management was implemented. After the sweet maize kernels were harvested, the zeaxanthin content in the kernels was determined using high-performance liquid chromatography (HPLC). Three ears were taken from each replicate, and 15 intact kernels free from disease and pests were selected from each ear for zeaxanthin extraction and determination. The average value of the three replicates was then used as the phenotypic data.

[0067] Table 1. Comparison of phenotypic variation and heritability among RIL populations

[0068] Properties Average value (μg / g) Variation (μg / g) Skewness Kudo coefficient of variation Corn xanthine content 2.53 0～8.65 1.05 -0.04 86％

[0069] 3. Obtain the main effect QTL for the zeaxanthin content trait in sweet corn kernels.

[0070] QTL analysis was performed on the mean xanthine content of maize kernels in the RIL population using QTL IciMapping 4.2 software and Composite Interval Mapping (CIM). 1000 randomization tests were conducted at a significance level of P < 0.05 to determine the logarithm of the odds (LOD). The 2-LOD interval method was used to determine the confidence intervals (QTL intervals). The format for naming QTLs was: prefix "q" + trait abbreviation + chromosome number of the QTL + serial number of the QTL on the same chromosome, with the number connected to the chromosome number by a "-". QTL analysis of xanthine content in maize kernels was performed, as follows: Figure 1 As shown, a total of two QTLs were detected, located on chromosomes 2 and 6, with LOD values ​​between 2.90 and 5.74, respectively. The contribution rates of individual QTLs to phenotypic variation were 8.81% and 18.69%, respectively. A single QTL contributing ≥10% to phenotypic variation was considered a major-effect QTL. Among them, qZEA6, located on chromosome 6, had a contribution rate of 18.69% and was therefore considered a major-effect QTL.

[0071] Table 2. QTL results for xanthine content in maize kernels.

[0072]

[0073] 4. Development and application of SNP markers closely linked to the zeaxanthin content trait in sweet corn kernels

[0074] qZEA6 is a major-effect QTL located on chromosome 6 of maize that regulates the zeaxanthin content in maize kernels. It lies between SNP loci S_chr6:83027949 and S_chr6:84835891. SNP locus S_chr6:83027949 has a variant of G / C, and SNP locus S_chr6:84835891 has a variant of A / G. Its physical location is chr6:83027949-84835891 in the maize RefGen_V3 genome. These two SNP loci can be used to predict the zeaxanthin content in sweet maize kernels.

[0075] Example 2

[0076] Based on the two SNP sites screened in Example 1, a primer set was designed to screen sweet corn with relatively high xanthine content in the kernels. The primer set consists of a first primer pair and a second primer pair. The nucleotide sequence of the upstream primer of the first primer pair is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the first primer pair is shown in SEQ ID NO.4. The nucleotide sequence of the upstream primer of the second primer pair is shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer of the second primer pair is shown in SEQ ID NO.6. The screening method is as follows:

[0077] DNA was extracted from maize plant leaves using standard methods. PCR amplification was performed using the first and second primer pairs. The PCR amplification system consisted of: 25 μL 2×PCRmix, 22 μL ddH2O, 1 μL each of forward and reverse primers, and 1 μL DNA template. The PCR reaction conditions were: 95℃ denaturation for 3 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; and a final extension at 72℃ for 5 min. The PCR products were sequenced. Plants with G at S_chr6:83027949 and A at S_chr6:84835891 were considered candidates for high xanthine content in maize kernels and were retained. Plants that did not meet these two site conditions were discarded.

[0078] PCR amplification and sequencing were performed on 82 sweet maize populations from the Maize Center of Shanghai Academy of Agricultural Sciences, and the content of xanthine in the kernels was determined. The results are shown in Table 3.

[0079] When the SNP site S_chr6:83027949 had a base of G and S_chr6:84835891 had a base of A, the zeaxanthin content in the sweet corn kernels was high. When the SNP site S_chr6:83027949 had a base of C and S_chr6:84835891 had a base of G, the zeaxanthin content in the sweet corn kernels was low. The average values ​​of the two phenotypes showed a significant difference, with a P-value of 2.04 × 10⁻⁶. -17 .

[0080] Table 3. Correspondence between SNP genotypes and xanthine content phenotypes in sweet corn materials to be tested.

[0081]

[0082]

[0083] Note: Blank tables in Table 4 indicate no data. 6_83027949 is the SNP locus S_chr6:83027949, and 6_84835891 is the SNP locus S_chr6:84835891.

[0084] In summary, the major-effect QTL tightly linked SNP markers related to zeaxanthin content in sweet corn, obtained using this invention, can assist in the selection of corn with high zeaxanthin content. Only the genotype of the SNP base at a specific locus needs to be detected, or the genotype at position 101 of the first and second nucleic acid molecules needs to be detected, to predict the zeaxanthin content trait in sweet corn kernels. The identification method is simple, the selection efficiency is high, the selection target is clear, and it is not affected by the environment. SNP markers can also achieve high throughput. They can be used in marker-assisted breeding for the zeaxanthin content trait in sweet corn kernels during the seedling stage, and can also be used for molecular aggregation breeding of the trait.

[0085] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A combination of SNP markers associated with the zeaxanthin content trait in sweet corn, characterized in that, The SNP marker combination includes a first nucleic acid molecule containing SNP01 information and a second nucleic acid molecule containing SNP02 information; the nucleotide sequence of the first nucleic acid molecule is shown in SEQ ID NO.1; the nucleotide sequence of the second nucleic acid molecule is shown in SEQ ID NO.2; SNP01 is located at 83027949 bp on chromosome 6 of the maize B73 RefGen_V3 genome, with a base of G or C; SNP02 is located at 84835891 bp on chromosome 6 of the maize B73 RefGen_V3 genome, with a base of A or G. When the genotype of SNP01 is GG and the genotype of SNP02 is AA, the zeaxanthin content of sweet corn is relatively high.

2. The application of the SNP marker combination of claim 1 or the product detecting the SNP marker combination of claim 1 in 1) and / or 2): 1) Screening or assisting in the screening of sweet corn with relatively high corn xanthine content; 2) Develop or assist in the development of sweet corn varieties with high maize xanthine content; When the genotype of SNP01 is GG and the genotype of SNP02 is AA in the SNP marker combination, the zeaxanthin content of sweet corn is relatively high.

3. The application according to claim 2, characterized in that, The zeaxanthin content refers to the zeaxanthin content in sweet corn kernels.

4. The application according to claim 2, characterized in that, The products include primer sets and / or kits.

5. A primer set for detecting the SNP marker combination of claim 1, characterized in that, The primer set includes a first primer pair and a second primer pair; the nucleotide sequence of the upstream primer of the first primer pair is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the first primer pair is shown in SEQ ID NO.4; the nucleotide sequence of the upstream primer of the second primer pair is shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer of the second primer pair is shown in SEQ ID NO.

6.

6. A method for screening or assisting in the screening of sweet corn with relatively high zeaxanthin content, characterized in that, Includes the following steps: Determine the genotypes of SNP01 and SNP02 in the SNP marker combination of claim 1 of the sweet corn to be tested; Based on the genotype results, sweet corn with genotype GG for SNP01 and AA for SNP02 was selected, which is sweet corn with relatively high zeaxanthin content.

7. A method for cultivating or assisting in the cultivation of sweet corn varieties with high maize xanthine content, characterized in that, Includes the following steps: Determine the genotypes of SNP01 and SNP02 in the SNP marker combination of claim 1 of the sweet corn to be tested; Discard the sweet corn with SNP01 genotype CC and SNP02 genotype GG, and perform self-pollination and / or hybridization on the remaining sweet corn. Keep the sweet corn with SNP01 genotype GG and SNP02 genotype AA in the offspring, which are sweet corn with relatively high zeaxanthin content.

8. The method according to claim 6 or 7, characterized in that, The assay includes: performing PCR amplification on the sweet corn to be tested, and sequencing the obtained PCR amplification product; the primer set for the PCR amplification includes the primer set described in claim 6.

9. The method according to claim 6 or 7, characterized in that, The zeaxanthin content refers to the zeaxanthin content in sweet corn kernels.

Images