Flagellin and its use in plant immunological elicitors

Abstract

The application belongs to the technical field of plant disease prevention and treatment, and discloses a flagellin and application of the flagellin in a plant immune elicitor. The flagellin is separated and extracted from Bacillus amyloliquefaciens Ba168, has good bacteriostatic activity, and has an immune induction effect on tobacco. The application realizes mass expression and purification of the flagellin by using genetic engineering technology. The flagellin can induce a plant immune response, can induce plant cell necrosis, plant active oxygen burst, and an increase of plant defense enzyme activity. The flagellin can induce plant resistance to PVX, and provides a new type of elicitor material for prevention and treatment of PVX.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant disease prevention and treatment, and relates to a flagellin and application of the flagellin in a plant immune elicitor. BACKGROUND

[0002] The plant immune elicitor, also known as a plant vaccine, belongs to a new type of biological pesticide, has high safety and environmental protection, and can effectively improve the plant resistance and prevent and control plant diseases. The plant immune elicitor does not have bactericidal activity itself, but the immune system of the plant is in an active state under the excitation of the plant immune elicitor. The substance can be recognized as a signal substance by the plant at a low concentration, so that the immune system of the plant is in an active state, thereby effectively resisting diseases and achieving the purposes of disease resistance and disease prevention.

[0003] The elicitation mechanism of the plant immune elicitor includes causing changes in hydroxyproline glycoprotein (HRGP) of the plant, promoting the deposition of lignin in the cell wall, thereby improving the resistance of the plant, and accelerating the accumulation of endogenous salicylic acid (SA), on the basis of which, oxidation is increased, local cells of the plant are apoptotic, and a hypersensitive response (HR) is formed. After the plant immune elicitor contacts the plant, the plant can be induced to produce an anti-disease signal and transmit the signal to the plant body. After the signal transmission, the plant is regulated by a series of anti-disease related genes, and the activity of defense enzymes such as phenylalanine ammonia lyase (PAL), peroxidase (POD), chitinase and beta-1,3-glucanase is changed, thereby effectively resisting the invasion of pathogenic bacteria and playing a protection and defense role.

[0004] Flagellin is the main structural protein of bacterial flagella and is the main part of flagellar filaments, which can endow the bacteria with the ability of movement. The flagellin helps pathogenic bacteria to move, adhere and invade the surface of the host, promotes the colonization, secretion of virulence factors and immersion on the host. Potato virus X (PVX) is widely distributed in the world and can infect more than 240 species of plants in 16 families, most of which are solanaceous species, causing economic losses. Due to the wide host range, strong stress resistance and various transmission routes of PVX, it is difficult to prevent and control the disease. At present, the prevention and control of PVX disease mainly focuses on the screening and use of synthetic compounds, plant-derived antiviral agents and microbial-derived antiviral agents, and there are few reports on the use of plant immune elicitors to prevent and control the disease. Therefore, it is of great significance to explore a plant immune elicitor capable of preventing and controlling PVX. SUMMARY

[0005] To solve the above technical problems, the application provides a flagellin and application thereof in a plant immune elicitor.

[0006] To achieve the technical purpose of the application, in one aspect, the application provides a flagellin, the amino acid sequence of which is shown as SEQ ID NO: 2. The application separates and extracts a protein capable of causing hypersensitive response of tobacco from Bacillus amyloliquefaciens Ba168, and identifies that the protein is flagellin, which has good antibacterial activity and immune induction effect on tobacco.

[0007] In another aspect, the application claims a flagellin gene, which comprises a nucleotide sequence encoding the above-mentioned flagellin, and the nucleotide sequence of the flagellin gene is shown as SEQ ID NO: 1.

[0008] In another aspect, the application claims a plant immune elicitor, the effective component of which comprises the above-mentioned flagellin.

[0009] In another aspect, the application claims application of the above-mentioned flagellin, or the flagellin gene, or the recombinant expression vector comprising the flagellin, or the recombinant bacteria comprising the flagellin, or the plant immune elicitor in inducing plant immune response. The plant immune response includes hypersensitive necrosis response of plant cells, active oxygen burst of plants, and increase of plant defense enzyme activity.

[0010] Further, the active oxygen burst of plants includes accumulation of hydrogen peroxide and / or superoxide anion in plants, and the plant defense enzyme includes superoxide dismutase, peroxidase and phenylalanine ammonia lyase.

[0011] Specifically, the application finds that treatment of tobacco leaf surface with flagellin solution can induce typical necrotic spots by detecting the influence of flagellin on hypersensitive necrosis response of tobacco leaf surface. It is found that the absorbance is obviously increased after 4h of treatment with flagellin solution by Evans blue staining of infiltrated spot leaf tissue and determination of absorbance, and the absorbance reaches the maximum value after 16h of treatment, and then continuously decreases, thereby judging that the tobacco leaf cell tissue is necrotic after treatment with flagellin solution, and basically all necrotic after about 24h. It is found that the control group cannot be dyed blue by trypan blue staining of the tobacco leaf surface with necrotic spots, and the tobacco leaves treated with flagellin can be dyed blue, which further verifies that flagellin can induce cell death of tobacco leaf surface.

[0012] Specifically, the present application finds that the tobacco leaf surface treated by flagellin has obvious brown precipitate after DAB staining, while the control group of tobacco leaf surface treated by buffer has no obvious color change, indicating that flagellin induces the accumulation of hydrogen peroxide on the tobacco leaf surface. After NBT staining, the leaf treated by flagellin has obvious blue precipitate, while the control group of tobacco leaf surface has no color change, indicating that flagellin induces the accumulation of superoxide anion on the tobacco leaf surface.

[0013] Specifically, the present application finds that the activities of superoxide dismutase, peroxidase and phenylalanine ammonia lyase in the tobacco leaf surface are all improved after spraying flagellin solution, and the activity of superoxide dismutase is 3.32 times of the control group after 5 days of treatment, the activity of peroxidase is 5.95 times of the control group after 7 days of treatment, and the activity of phenylalanine ammonia lyase is 5.01 times of the control group after 5 days of treatment.

[0014] In addition, the present application claims the use of the above-mentioned flagellin, or flagellin gene, or recombinant expression vector containing the above-mentioned flagellin, or recombinant bacteria containing the above-mentioned flagellin, or plant immune elicitors in inducing plant resistance to viruses. The virus includes potato virus X.

[0015] Specifically, the present application finds that the tobacco leaf treated by flagellin solution has only a small amount of strip pattern, and the leaf curl is not obvious, and the disease symptoms are obviously lighter than the treatment group inoculated with PVX, indicating that flagellin can induce tobacco to produce resistance to PVX, and the disease symptoms of tobacco in the treatment group (P3) of spraying flagellin solution first and then inoculating PVX and the treatment group (P5) of inoculating PVX first and then spraying flagellin are both lighter, indicating that flagellin has a certain preventive and therapeutic effect on tobacco PVX disease.

[0016] Those artificially modified nucleotides having 75% or more identity with the nucleotide sequence of the flagellin gene isolated from the present application, as long as they encode flagellin and have the same function, are derived from the nucleotide sequence of the present application and equivalent to the sequence of the present application.

[0017] The term "identity" as used herein refers to sequence similarity with a native nucleic acid sequence. "Identity" includes nucleotide sequences having 75% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence encoding the flagellin shown in SEQ ID NO: 2 of the present application. Identity can be assessed by eye or by computer software. Using computer software, identity between two or more sequences can be expressed as a percentage (%) which can be used to assess identity between related sequences.

[0018] The 75% or more identity described above can be 80%, 85%, 90% or 95% or more identity.

[0019] A skilled person can construct a recombinant vector containing the flagellin gene using an existing expression vector. The plant expression vector includes Agrobacterium binary vector and a vector that can be used for plant microprojectile bombardment, etc. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1305, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb, etc. The plant expression vector can also contain a 3' untranslated region of the foreign gene, i.e. containing a polyadenylation signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylation signal can direct the addition of polyadenosine to the 3 ′ end of the mRNA precursor, such as Agrobacterium Ti plasmid genes (such as nopaline synthase gene Nos), plant genes (such as soybean storage protein gene) 3 ′The untranslated regions of the terminal transcription also have similar functions. When the gene construction plant expression vector of the present application is used, enhancers, including translation enhancers or transcription enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent regions of start codons, but must be the same reading frame as the coding sequence to ensure correct translation of the entire sequence. The source of the translation control signal and the start codon is wide and can be natural or synthetic. The translation initiation region can be from the transcription initiation region or the structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants to produce color-changing enzymes or luminescent compounds (GUS genes, luciferase genes, etc.), marker genes of antibiotics (such as nptII genes that confer resistance to kanamycin and related antibiotics, bar genes that confer resistance to herbicide phosphine, hph genes that confer resistance to the antibiotic hygromycin, and dhfr genes that confer resistance to methotrexate, EPSPS genes that confer resistance to glyphosate), or chemical reagent-resistant marker genes (such as herbicide-resistant genes), mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose. For the safety of transgenic plants, no selective marker genes can be added, and the transformed plants can be directly screened under adverse conditions.

[0020] The above-mentioned vector or expression vector can be a plasmid, cosmid, bacteriophage or viral vector.

[0021] The above-mentioned microorganism can be yeast, bacteria, algae or fungi, such as Agrobacterium.

[0022] The above-mentioned transgenic plant cell lines do not include propagation materials.

[0023] Compared with the prior art, the technical scheme provided by the present application at least has the following beneficial effects or advantages:

[0024] (1) The present application isolates and extracts a protein from Bacillus amyloliquefaciens Ba168 that can cause hypersensitivity reaction in tobacco. The protein is identified as flagellin and has good antibacterial activity and immunological induction effect on tobacco. The present application uses the chromosomal walking method to clone the protein gene from Bacillus amyloliquefaciens Ba168, and uses genetic engineering technology to realize large-scale expression and purification of the flagellin. Through identification, it is found that the flagellin can induce plant immune response, improve plant resistance, and induce resistance of tobacco to PVX. The present application provides a new immunological resistance material for the prevention and treatment of PVX.

[0025] (2) The flagellin provided by the application can induce plant immune response, and the plant immune response is specifically plant hypersensitive response. The application finds that the flagellin solution treatment of tobacco leaf surface can induce typical necrotic spots by detecting the influence of flagellin on hypersensitive response of tobacco leaf surface. The light absorption value of the leaf tissue of the infiltrated spot is detected by Evans blue staining, and it is found that the light absorption value is obviously improved after 4 hours of treatment, the light absorption value reaches the maximum after 16 hours of treatment, and then continuously decreases, so it is judged that the tobacco leaf cell tissue is necrotic after the treatment of the flagellin solution, and the necrosis is basically complete after about 24 hours. The tobacco leaf surface with necrotic spots is stained with trypan blue, and it is found that the control group cannot be dyed blue, and the tobacco leaf treated by the flagellin can be dyed blue, which further verifies that the flagellin can induce the death of tobacco leaf surface cells.

[0026] (3) The flagellin provided by the application can induce plant immune response, and the plant immune response is specifically plant active oxygen burst. The application finds that the tobacco leaf surface treated by the flagellin has obvious brown precipitate after DAB staining, and the control group treated by the buffer solution has no obvious color change, which indicates that the flagellin induces the accumulation of hydrogen peroxide on the tobacco leaf surface. After NBT staining, the leaf treated by the flagellin has obvious blue precipitate, and the control group of tobacco leaf has no color appearance, which indicates that the flagellin induces the accumulation of superoxide anion on the tobacco leaf surface.

[0027] (4) The flagellin provided by the application can induce plant immune response, and the plant immune response is specifically the increase of plant defense enzyme activity. The application finds that the activities of superoxide dismutase, peroxidase and phenylalanine ammonia lyase in the tobacco leaf surface are improved after spraying the flagellin solution, and the activity of superoxide dismutase is 3.32 times of the control group after 5 days of treatment, the activity of peroxidase is 5.95 times of the control group after 7 days of treatment, and the activity of phenylalanine ammonia lyase is 5.01 times of the control group after 5 days of treatment.

[0028] (5) The flagellin provided by the application can induce the resistance of plants to PVX. The application finds that the tobacco leaf treated by the flagellin has only a small amount of strip patterns, and the leaf curl is not obvious, and the disease symptoms are obviously lighter than those of the treatment group inoculated with PVX, which indicates that the flagellin can induce the resistance of tobacco to PVX, and the disease symptoms of the tobacco in the treatment group (P3) sprayed with the flagellin solution before inoculation with PVX and the treatment group (P5) inoculated with PVX before spraying with the flagellin are both lighter, which indicates that the flagellin has a certain prevention and treatment effect on the PVX disease of tobacco. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 Figure 6 is a picture of agarose gel electrophoresis of flagellin gene. M is DNA Marker.

[0030] Figure 2 Figure 7 is a picture of agarose gel electrophoresis of the recombinant vector after enzyme digestion.

[0031] Figure 3 Figure 8 is a picture of SDS-PAGE analysis of the recombinant bacteria after IPTG induction. Lane 1 is total protein; Lane 2 is supernatant after induction at 20°C; Lane 3 is precipitate after induction at 20°C; Lane 4 is supernatant after induction at 37°C; Lane 5 is precipitate after induction at 37°C.

[0032] Figure 4 Figure 9 is a picture of SDS-PAGE analysis of flagellin after nickel agarose gel affinity chromatography purification. M is protein Marker; Lane 1 is loading solution; Lane 2 is permeate; Lane 3 is eluent after removing impurities with 20mM Imidazole; Lane 4 is eluent after removing impurities with 50mM Imidazole; Lane 5 is eluent after removing impurities with 500mM Imidazole.

[0033] Figure 5 Figure 10 is a picture of the results of hypersensitive necrosis reaction induced by flagellin in tobacco leaves. Figure 5 Figure 10A is a picture of the phenotype of hypersensitive necrosis reaction in tobacco leaves after treatment with flagellin solution; Figure 5 Figure 10B is a picture of the dynamic of cell death in hypersensitive necrosis reaction induced by flagellin;

[0034] Figure 5 Figure 10C is a picture of trypan blue staining of tobacco leaves after treatment with flagellin solution; Figure 5 Figure 10D is a picture of trypan blue staining of control group tobacco leaves.

[0035] Figure 6 Figure 11 is a picture of the effect of flagellin solution on reactive oxygen burst in tobacco leaves. Figure 6 Figure 11A is a picture of DAB staining of tobacco leaves after treatment with flagellin solution; Figure 6 Figure 11B is a picture of DAB staining of control group tobacco leaves; Figure 6 Figure 11C is a picture of NBT staining of tobacco leaves after treatment with flagellin solution, Figure 6 Figure 11D is a picture of NBT staining of control group tobacco leaves.

[0036] Figure 7 Figure 12 is a picture of the effect of flagellin solution on defense enzyme activity in tobacco leaves. Figure 7 Figure 12A is a picture of SOD activity curve of tobacco leaves after treatment with flagellin solution; Figure 7B in FIG. 4 is a graph of POD activity of tobacco leaf surface after treatment with flagellin solution; Figure 7 C in FIG. 4 is a graph of PAL activity of tobacco leaf surface after treatment with flagellin solution.

[0037] Figure 8 FIG. 5 is a graph of results of inducing PVX resistance in tobacco by flagellin solution. P1 is a control group; P2 is a treatment group in which only flagellin solution is sprayed; P3 is a treatment group in which PVX is inoculated after 24 h of spraying flagellin solution; P4 is a treatment group in which only PVX is inoculated; and P5 is a treatment group in which flagellin solution is sprayed after 24 h of inoculation of PVX. DETAILED DESCRIPTION

[0038] The technical solutions of the present application will be described in combination with examples, but the present application is not limited to the following examples. The experimental methods and detection methods described in the following examples are all conventional methods unless otherwise specified; and the reagents and materials described are all commercially available unless otherwise specified.

[0039] Example 1

[0040] This example provides obtaining of flagellin gene.

[0041] Using the genome of Bacillus amyloliquefaciens Ba168 (accession number CGMCC No. 6462) disclosed in patent application number CN201210342838.X as a template, amplification was performed using intermediate sequence primers 212F (CTCTTATCCAAACATCTGAGGGTG) and 988R (ATT GAAGAACTTGCTGAGGCTGT). The intermediate PCR product was recovered and sequenced for verification. The PCR reaction system of the intermediate product is shown in Table 1, and the PCR program is shown in Table 2. The chromosome walking method was used to further amplify the sequence. First, the intermediate PCR product was digested with EcoRI. Then, T4 ligase was used to ligate the digested product with adapter primers P1 (GTAATACGACTCACTATAGGGC) and P2 (TCGACGGCCCGGGCTGGTAG CT) to form a fragment. This fragment was used as a template for amplification using adapter primers P1 / P2 and walking primers R1 (TTTTGCGCAGTTCCGTCAAGAAGTT) / R2 (TCGTATTGAACTCAGTGTCAGTAGAGATTCTTGT) to obtain the first round of walking PCR product. The PCR reaction system for the walking product is shown in Table 3, and the PCR program is shown in Table 4. Using the first round of walking PCR product as a template, amplification was performed using adapter primers P1 / P2 and walking primers R1 / R2 to obtain the PCR product. The PCR reaction system for the walking product is shown in Table 3, and the PCR program is shown in Table 4. The PCR product was subjected to agarose gel electrophoresis, yielding a 1000bp band consistent with the expected size. Figure 1 The nucleotide sequence of the target product is shown in SEQ ID NO:1. The target band is detected and recovered by agarose gel electrophoresis to obtain the target DNA fragment.

[0042] Table 1 PCR reaction system for intermediate products

[0043]

[0044]

[0045] Table 2 PCR procedures for intermediate products

[0046]

[0047] Table 3. PCR reaction system for stepping products

[0048]

[0049] Table 4. PCR Procedures for Stepping Products

[0050]

[0051] Example 2

[0052] This embodiment provides the construction of flagellin expression vector and recombinant bacteria.

[0053] The purified target DNA fragment from Example 1 was ligated with the pET30a vector. The ligation system consisted of 8.5 μL of seamless cloning mixture, 4 μL of pET30a vector, 4 μL of the purified target DNA fragment, and ddH2O to a final volume of 20 μL. The mixture was placed in a PCR instrument at 50°C for 1 hour. The ligation reaction was then performed in Rosetta (DE3) competent cells. Positive clones were screened and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Plasmid DNA was extracted from the correctly sequenced bacterial cultures using a plasmid extraction kit (SanPrep column-based plasmid DNA mini-extraction kit).

[0054] The correctly sequenced plasmid and pET30a vector were double-digested with restriction endonucleases NcoI and XhoI, respectively. The digestion system consisted of: 4 μg plasmid DNA, 4 μg pET30a vector, 5 μL FD Buffer (10×), 0.5 μL restriction endonuclease NcoI (10 U / μL), 0.5 μL restriction endonuclease XhoI (10 U / μL), and ddH2O to a final volume of 50 μL. The mixture was incubated at 37°C for 2 h. Agarose gel electrophoresis was performed after digestion. Figure 2 The digested vector and target DNA fragment were recovered. PCR and enzyme digestion results showed that the target DNA fragment had been successfully introduced into the prokaryotic expression vector pET30a, and the size of the target DNA fragment was consistent with the coding region of the gene. The target DNA fragment was recovered by gel digestion and ligated into the pET30a(+) vector using T4 DNA ligase. The ligation product was transformed into Rosetta(DE3) competent cells to obtain recombinant bacteria. After extracting and processing the plasmid DNA from the recombinant bacteria, PCR detection showed that the target vector contained the target DNA fragment, thus obtaining a recombinant vector that met the requirements.

[0055] Example 3

[0056] This embodiment provides the induction, expression, and purification of the fusion protein.

[0057] 1. Induced expression of fusion proteins

[0058] Take 1 μL of recombinant bacteria, heat shock at 42℃ for 90 s, incubate on ice for 5 min, and then spread onto LB liquid medium containing 30 μg / mL kanamycin and 34 μg / mL chloramphenicol. Incubate overnight at 37℃ and 220 rpm. Then dilute the culture medium 1:100 and incubate at 37℃ and 220 rpm until OD reaches [value missing]. 600When the value of 0.6 is reached, continue to add 0.5 mM IPTG, keep 220 rpm, set two temperatures (20°C, 37°C) respectively, and induce overnight to investigate the induction effect of different temperatures; after 4 hours of overnight induction, use the sample without adding IPTG as a negative control. Centrifuge at 4000 rpm for 10 min, collect the bacterial cells and remove the supernatant, and find that a high expression amount of protein bands is detected in the bacterial cells. Figure 3

[0059] The collected bacterial cells are suspended with 500 μL bacterial lysis solution (50 mM Tris, 300 mM NaCl, pH 8.0), 0.5 mM lysozyme is added, and the bacterial cells are broken by ultrasonic for 6 min (ultrasonic 0.5 s, pause 1.5 s). Centrifuge at 12000 rpm and 4°C for 20 min to separate the supernatant and the precipitate. The precipitate is dissolved with 500 μL inclusion body lysis solution (8 M Urea, 50 mM Tris-HCl, 300 mM NaCl, pH 8.0), 40 μL sample and 10 μL protein buffer (PBS buffer: NaCl: 8 g / L, KCl: 0.2 g / L, Na2HPO4: 1.44 g / L, KH2PO4: 0.24 g / L) are mixed, and boiled in water bath for 10 min. After high-speed centrifugation (12000 rpm, 5 min) at room temperature, the supernatant is taken and subjected to gel electrophoresis detection: prepare 12% SDS-PAGE, Tris-Gly electrophoresis buffer (Tris 3.0 g, glycine 14.4 g, SDS 1.0 g, dilute to 1 L), load 10 μL, concentrate the gel at 80 V for 20 min, separate the gel at 120 V for 60 min, and after gel electrophoresis, treat with Coomassie brilliant blue for 20 min, and analyze the protein bands after decolorization. It is found that the fusion protein is induced to express in a large amount.

[0060] 2. Purification of the fusion protein

[0061] The collected bacterial cells are dissolved with a broken buffer (0.2 mM PMSF, 0.1% Triton X-100, 50 mM Tris, 300 mM NaCl, pH 8.0), and the bacterial cells are broken by ultrasonic (ultrasonic 2 s, pause 6 s) for 20 min in an ice bath. After ultrasonic, centrifuge at 12000 rpm and 4°C for 20 min, collect the supernatant for purification.

[0062] ​Nickel-agarose gel affinity chromatography was used to purify flagellin proteins highly expressed in *E. coli*: 5 mL of Ni-NTA was used, and the column was equilibrated with 5-fold column bed binding buffer (50 mM Tris, 300 mM NaCl, pH 8.0) at a flow rate of 5 mL / min. After incubation of the sample and packing material for 1 h, the sample was loaded onto the column, and the permeate was collected. Subsequently, impurities were washed away with Wash buffer (50 mM Tris, 300 mM NaCl, 20 / 50 mM Imidazole, pH 8.0), and the eluent was collected. Elution buffer (50 mM Tris, 300 mM NaCl, 500 mM Imidazole, pH 8.0) was used for elution, and the eluent was collected. The eluent was then analyzed by SDS-PAGE. The protein fraction was dialyzed into buffer (50 mM Tris, 300 mM NaCl, pH 8.0) for SDS-PAGE electrophoresis. Figure 4 The amino acid sequence of flagellin was found to be as shown in SEQ ID NO:2. After dialysis, the sample was concentrated with PEG20000, filtered through a 0.22 μm filter membrane, and aliquoted into 1 mL tubes, then stored at -80℃.

[0063] Depend on Figure 4 It can be seen that elution with different concentrations of Imidazole (20, 50, and 500 mM) resulted in distinct bands in the 35-40 kDa range, which correspond to the size of flagellin, indicating that Imidazole at concentrations of 20–500 mM can effectively separate and purify flagellin.

[0064] Example 4

[0065] This embodiment provides the effect of flagellin on the allergic necrosis (HR) response of tobacco leaves.

[0066] Tobacco leaves were injected with a 100 μg / mL flagellar protein solution (elution buffer from Wash buffer (containing 20 mM Imidazole) as described in Example 3), with Wash buffer injection serving as the control group. The injection volume was 100 μL. Tobacco leaf observations were performed at 0, 4, 8, 12, 16, and 24 hours after treatment. Figure 5 The treated areas were stained with Evans blue, and the absorbance at 600 nm was measured. Figure 5 When obvious necrotic spots appear on tobacco leaves, the leaves are cut off and stained with trypan blue solution for identification. Figure 5 ).

[0067] Depend on Figure 5 As shown in A, treatment of tobacco leaves with flagellin solution can induce typical necrotic spots (red circles), indicating that flagellin can induce cell death in tobacco leaves.Figure 4 As shown in B, the absorbance of the control group at 600nm remained relatively stable, indicating normal tobacco cell tissue. In the treatment group, the absorbance significantly increased 4 hours after injection of flagellin solution, with the tobacco leaves clearly absorbing Evans blue, and the absorption level continuously increased, reaching its maximum at 16 hours post-treatment, followed by a continuous decrease. This indicates that flagellin solution treatment caused necrosis of the tobacco cell tissue, with almost all cells dying by approximately 24 hours. Figure 5 As shown in C and D, the control group could not be stained blue, while the tobacco leaves treated with flagellin could be stained blue, further verifying that flagellin can induce cell death on the surface of tobacco leaves.

[0068] Example 5

[0069] This embodiment provides the effect of flagellin on reactive oxygen species bursts on tobacco leaf surfaces.

[0070] Using a needleless syringe, 50 μL of 100 μg / mL flagellin solution was injected into the stomata of healthy tobacco leaves. A buffer injection was used as a control group. After 8 hours, the leaves were cut and aliquoted into Erlenmeyer flasks. 0.5 mg / mL NBT staining solution was added, and a vacuum pump was used to allow the staining solution to penetrate the leaves. Staining was carried out for 2 hours in the dark. The stained leaves were then soaked in ethanol to remove chlorophyll. The amount of NBT deposition in the leaves was observed, and photographs were taken. Figure 6 The 1 mg / mL DAB staining method was the same as above. The amount of DAB deposited in the leaves was observed, and photographs were taken. Figure 6 Reactive oxygen species (ROS) emission is an important signal for elicitors to induce immune responses in plants. ROS in plants include superoxide radicals, hydrogen peroxide, hydroxyl radicals, and lipid peroxide radicals. This invention uses DAB and NBT staining to analyze hydrogen peroxide and superoxide anions produced on tobacco leaves induced by flagellin.

[0071] Depend on Figure 6 It was observed that after DAB staining, the tobacco leaves treated with flagellin showed obvious brown precipitate, while the tobacco leaves of the control group treated with buffer did not show obvious color change, indicating that flagellin induced the accumulation of hydrogen peroxide on the tobacco leaves. After NBT staining, the leaves treated with flagellin showed obvious blue precipitate, while the tobacco leaves of the control group did not show any color, indicating that flagellin induced the accumulation of superoxide anions on the tobacco leaves.

[0072] Example 6

[0073] This embodiment provides the effect of flagellin on the activity of tobacco defense enzymes.

[0074] Spray the tobacco leaf surface with 100 μg / mL of flagellin solution, spray until the tobacco leaf surface is fully wetted, but the liquid does not flow from the leaf, and use the spraying buffer as a control group. Detect the changes in the activities of superoxide dismutase (SOD), peroxidase (POD), and phenylalanine ammonia lyase (PAL) in the tobacco leaf surface at 1, 3, 5, 7, 9, 11, and 13 days after spraying, and the results are shown in Figure 7 SOD is an antioxidant enzyme that can catalyze the dismutation of superoxide anion radicals into H2O2 and O2, thereby reducing or eliminating harmful substances produced in the metabolic process of the body. POD is an antioxidant enzyme that is closely related to the plant resistance to environmental influences. PAL is a plant defense enzyme that is closely related to the resistance of plants.

[0075] As shown in A of Figure 7 , spraying the flagellin solution has a significant effect on the SOD enzyme activity in the tobacco leaf surface. The SOD activity curve of the flagellin solution treatment group has a significant difference from the control group. The SOD activity of the flagellin solution treatment group is significantly increased and reaches a maximum after 5 days of treatment, which is 3.32 times that of the control group, and then gradually decreases. Figure 7 As shown in B of Figure 7 , the POD activity in the tobacco leaf surface after treatment with the flagellin solution increases significantly. Compared with the control group, the POD activity in the tobacco leaf surface reaches a maximum after 3 days of treatment with the flagellin solution, which shows a significant statistical difference. The change trend of the POD activity is first increased and then decreased, and then slowly remains stable. The POD activity in the tobacco leaf surface of the treatment group is higher than that of the control group, and reaches a maximum after 7 days of treatment, which is 5.95 times that of the control group. Figure 7 As shown in C of Figure 7 , compared with the control group, the PAL activity in the tobacco leaf surface reaches a maximum after 5 days of treatment with the flagellin solution, which is 5.01 times that of the control group.

[0076] Example 7

[0077] This example provides that the flagellin induces the tobacco to produce resistance to the potato virus X (PVX).

[0078] Five treatments were designed, and healthy N. benthamiana plants with 5-6 leaves were treated according to the following methods: P1 (control group): spraying with the buffer; P2: spraying with the flagellin solution; P3: inoculating with PVX after 24 hours of spraying with the flagellin solution; P4: inoculating with PVX; and P5: spraying with the flagellin solution after 24 hours of inoculation with PVX. After the treatment, the tobacco plants were placed in a greenhouse for cultivation, and the disease conditions of the tobacco leaves were observed every day. The disease conditions of the tobacco plants after 5 days of treatment are shown in Figure 8 .

[0079] Depend on Figure 8 It was found that the control group (P1) and the treatment group sprayed with flagellin solution only (P2) grew well. Tobacco inoculated only with PVX (P4) exhibited typical PVX symptoms, with severe leaf curling and delayed new leaf growth. The tobacco in the treatment groups sprayed with flagellin solution before PVX inoculation (P3) and the treatment groups inoculated with PVX before flagellin inoculation (P5) showed milder symptoms, with only a few striped patterns and less noticeable leaf curling. This indicates that flagellin can induce resistance to PVX in tobacco and has a certain preventive and therapeutic effect against tobacco PVX disease.

[0080] As described above, the basic principles, main features, and advantages of the present invention have been well described. The above embodiments and specifications are merely descriptions of preferred embodiments of the present invention, and the present invention is not limited to the above embodiments. Various changes and improvements made to the technical solutions of the present invention by those skilled in the art without departing from the spirit and scope of the present invention should fall within the protection scope defined by the present invention.

Claims

1. The use of flagellin, or a gene encoding flagellin, or a recombinant expression vector comprising a flagellin gene, or a recombinant bacterium comprising a flagellin gene, or a plant immune elicitor comprising flagellin as an active ingredient, in inducing a plant immune response, characterized in that, The nucleotide sequence of the gene encoding the flagellin is shown as SEQ ID NO: 1; The amino acid sequence of the flagellin is shown as SEQ ID NO: 2; The plant immune response is to confer resistance to the plant against the Potato virus X.

2. The use of flagellin, or a gene encoding flagellin, or a recombinant expression vector comprising a flagellin gene, or a recombinant bacterium comprising a flagellin gene, or a plant immune elicitor comprising flagellin as an active ingredient, in inducing resistance of a plant to a virus, characterized in that, The virus is the Potato virus X; The nucleotide sequence of the gene encoding the flagellin is shown as SEQ ID NO: 1; The amino acid sequence of the flagellin is shown as SEQ ID NO: 2.

Images