Method for absolutely and quantitatively constructing synthetic flora and application
By constructing the synthetic bacterial flora absolutely quantitatively, the optimal proportion of the three strains was screened using fluorescence quantitative PCR, which solved the problems of low colonization efficiency and poor environmental adaptability of a single strain in agricultural and forestry and bio-defense applications, and achieved a significant promotion effect on the propagation of × green hybrid bamboo.
Patent Information
- Application Number
- CN202510638878.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-19
- Publication Date
- 2025-08-19
AI Technical Summary
The existing single strains face the problems of low rhizosphere colonization efficiency, poor environmental adaptability and single functions in agricultural and forestry biodefense applications. Most of the commercially available biodefense agents are single strains, making it difficult to exert ideal antagonistic and proliferation effects.
The method of constructing synthetic bacteria was adopted to screen out the optimal proportions of Trichoderma spiralis RS05, Bacillus siamensis B11 and Streptomyces mirabilis BD2233 by fluorescence quantitative PCR to construct synthetic bacteria to promote plant growth.
It significantly improves the colonization efficiency and proliferation effect of synthetic bacteria in the rhizosphere of plants, overcomes the technical bottleneck of a single strain, provides higher environmental adaptability and proliferation effect, especially has a significant promoting effect on the growth of × green hybrid bamboo.
Smart Images

Figure CN120505442A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of microbial control, and in particular to a method for absolutely quantitatively constructing a synthetic bacterial community and its application. Background Art
[0002] The coordinated application of biocontrol and growth-promoting bacteria (PGPR) is a core strategy for promoting sustainable agricultural and forestry development. PGPR regulates plant health through both direct and indirect mechanisms: direct mechanisms include biological nitrogen fixation, phosphorus and potassium solubilization, siderophore production, and auxin production, significantly promoting host nutrient absorption and metabolic activity (Xie Jiufeng, Zhang Sen, Cui Guangzhou, et al. Screening and identification of tobacco growth-promoting bacteria and their growth-promoting effects [J]. Jiangsu Agricultural Sciences, 2024, 52(23): 230-237). Indirect mechanisms inhibit pathogen proliferation and enhance plant stress resistance through competition for ecological niches, secretion of antimicrobial substances such as antibiotics, and induction of systemic resistance (ISR). Compared to traditional chemical fertilizers and pesticides, PGPR-driven biofertilizers are both environmentally compatible and long-lasting, improving soil structure, reducing pesticide residue accumulation, and promoting healthy plant growth, meeting the needs of green agriculture and forestry.
[0003] For a long time, single bacterial strains have been the main control method for disease prevention and control. However, in agricultural and forestry biocontrol applications, these strains have long faced limitations such as low rhizosphere colonization efficiency, poor environmental adaptability, and single function. Their field effects are easily affected by soil antibacterial effects and population density fluctuations (Hu Zhan, Fu Zujiao, Guo Zhaohui, et al. Biocontrol effects of composite microbial agents on rice blast [J]. Bulletin of Microbiology, 2024, 51(2): 483-493.). On the other hand, the biocontrol agents currently available on the market are mainly Bacillus and Trichoderma products, with relatively single strains. Most of the strains used in production are single strains, making it difficult to achieve ideal antagonistic and growth-promoting effects. Therefore, there is an urgent need to evaluate the combination of bacterial strains.
[0004] Synthetic Microbial Community (SynCom), as a cross-product of synthetic biology and microbial ecology, breaks through the bottleneck of single-bacteria system by artificially creating a co-culture system of two or more known microorganisms under specific controllable environmental conditions (Wei Zhong, Yang Tianjie, Ren Peng, et al. Current status and future of synthetic microbial communities in rhizosphere immunity research [J]. Journal of Nanjing Agricultural University, 2021, 44(4): 597-603.). Compared with natural microbial communities and single bacterial species, synthetic microbial communities have many advantages: the species combination of synthetic microbial communities is simple and clear, and they are highly controllable; there are microbial species interactions in synthetic microbial communities, which synergistically complete complex functions such as nitrogen fixation, stress resistance or pathogen antagonism, and they show high stability and robustness, making them more likely to colonize specific parts of plants; their multidimensional interaction networks can resist environmental stresses (such as high salt content), and at the same time enhance community adaptability through functional redundancy, and have great potential in improving plant health (Weng Lingyin, Luan Dongdong, Zhou Dapu, et al. Using synthetic microbial communities to promote crop health: progress and prospects [J]. Chinese Journal of Applied Ecology, 2024, 35(3): 847-857.). Studies have confirmed that SynCom has significant advantages in improving crop resistance, alleviating soil-borne diseases and optimizing rhizosphere microecology. Its controllability and plasticity provide a new paradigm for precision agriculture and forestry. Since the growth-promoting characteristics and effects of different biocontrol strains are not the same, it is necessary to construct an absolute quantitative method for synthetic bacterial communities so that the growth-promoting effects of different bacterial species can be more comprehensive and the growth-promoting effects can be stronger.
[0005] Real-time fluorescence quantitative PCR (qPCR) monitors the amplification process in real time based on fluorescence signals. It has the advantages of high sensitivity (detection down to a single copy of nucleic acid), high specificity, and rapid response, and has become a core tool for studying microbial dynamics. Absolute quantification overcomes the limitation of relative quantification's reliance on internal reference genes by constructing a standard curve with known copy numbers, thus significantly improving the reliability of detection data. Compared with traditional culture methods, qPCR is rapid, sensitive, highly accurate, and highly specific. It can provide more accurate and reliable data in microbial dynamic analysis by directly quantifying population abundance, which helps to deepen our understanding of the dynamic changes in microbial populations and their survival strategies in different environments (Qu Zepeng, Chen Moxian, Cao Zhaohui, et al. Research Progress on Synthetic Microbial Communities [J]. Synthetic Biology, 2020, 1(6): 621-634.). Using qPCR absolute quantification technology, we can accurately analyze the abundance dynamics of biocontrol strains, systematically screen for optimal strain interactions, and reveal the multidimensional interaction mechanisms of synthetic microbial communities, thereby building functionally stable microbial alliances (Li Lili. Study on the Population Dynamics of Synthetic Microbial Communities in Camellia oleifera[D]. Central South University of Forestry and Technology, 2024). This strategy provides a theoretical framework for the precise design of SynComs and the optimization of their effectiveness in field applications. Summary of the Invention
[0006] The purpose of the present invention is to provide a method for constructing a synthetic bacterial community by absolute quantitative analysis. The constructed synthetic bacterial community can be used as a synthetic bacterial agent to promote plant growth, especially has a significant promoting effect on the growth of hybrid bamboo of support and green.
[0007] In order to achieve the above object, the present invention provides a method for absolute quantification of synthetic bacterial flora, comprising the following steps: (1) Absolute quantification of each strain in the synthetic bacterial consortium; (2) Select the inoculation ratio of the three bacterial strains when the total bacterial DNA copy number is the highest; (3) preparing a synthetic bacterial consortium according to the selected inoculation ratio; The synthetic bacterial consortium includes Trichoderma spiralis ( Trichodermaspiralis )RS05, Bacillus siamensis ( Bacillus siamensis )B11, Streptomyces mirabilis ( Streptomyces mirabilis )BD2233.
[0008] The present invention also provides an absolute quantitative method for constructing a synthetic bacterial consortium that can be used to promote plant growth, wherein the synthetic bacterial consortium comprises Trichoderma spiralis ( Trichodermaspiralis )RS05, Bacillus siamensis ( Bacillus siamensis )B11, Streptomyces mirabilis ( Streptomyces mirabilis) BD2233; The constructed absolute quantification method uses three strains of bacteria in the synthetic bacterial consortium as standards for absolute quantification; The absolute quantification method comprises the following steps: (1) performing absolute quantification on the three bacterial strains in the synthetic bacterial population; (2) selecting the inoculation ratio of the three bacterial strains when the total bacterial population DNA copy number is the highest; and (3) preparing the synthetic bacterial population according to the selected inoculation ratio.
[0009] Preferably, the absolute quantitative primers for RS05 are shown as SEQ ID NOs. 5 and 6, the absolute quantitative primers for B11 are shown as SEQ ID NOs. 7 and 8, and the absolute quantitative primers for BD2233 are shown as SEQ ID NOs. 9 and 10.
[0010] Preferably, the inoculation ratio of the above three bacterial strains is RS05:B11:D2233=3:2:1.
[0011] Preferably, the concentration of each of the three strains is 1×10 8 cfu / mL.
[0012] The present invention also provides a synthetic bacterial community constructed by the above absolute quantitative method, which can be used to prepare a synthetic bacterial agent.
[0013] The synthetic bacterial flora or synthetic bacterial agent provided by the present invention can be used to promote plant growth, including promoting the growth of plants such as bamboo hybrids of the bamboo family and bamboo species of the bamboo family.
[0014] The present invention has the following advantages: This application innovatively uses the absolute quantitative method of high-precision fluorescent quantitative PCR to screen and combine three biocontrol strains. Through multi-proportion inoculation experiments, the optimal ratio for synergistic enhancement is determined to construct a synthetic bacterial community, which significantly improves the colonization efficiency and growth-promoting effect of the synthetic bacterial community in the plant rhizosphere, overcoming the technical bottlenecks of weak colonization ability, poor environmental adaptability, and unclear growth-promoting effect of a single strain; at the same time, the spatiotemporal distribution of the synthetic bacterial community in the rhizosphere soil and plant tissues can be dynamically tracked, providing data support for the optimization of bacterial community functions.
[0015] The present application also provides a synthetic bacterial agent that is beneficial to plant growth, and has a particularly significant promoting effect on the growth of hybrid bamboo of the type C. truncatum × L. truncatum, and has application prospects in the field of planting hybrid bamboo of the type C. truncatum × L. truncatum. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 Results of the heat map of interactions between three biocontrol bacteria and the absolute quantitative method of synthetic bacterial consortia were constructed.
[0017] Figure 2 The following are the DNAMAN8 sequence comparison results of three biocontrol bacteria.
[0018] Figure 3Shown are the growth curves of three biocontrol bacteria.
[0019] Figure 4 The results show the effects of different ratios of inoculation of three biocontrol bacteria on the bacterial DNA copy number.
[0020] Figure 5 The dynamic changes of DNA copy number of the constructed synthetic bacterial community under different environments.
[0021] Figure 6 These are the results of the effects of the synthetic flora on plant growth for one day.
[0022] Figure 7 These are the results of the effects of the synthetic flora on plant growth for 3 days.
[0023] Figure 8 These are the results of the effects of the synthetic flora on plant growth for 7 days.
[0024] Figure 9 These are the results of the effects of the synthetic flora on plant growth for 15 days.
[0025] Figure 10 These are the results of the effects of the synthetic flora on plant growth for 30 days.
[0026] Figure 11 These are the results of the effects of the synthetic flora on plant growth for 45 days.
[0027] Figure 12 These are the results of the effects of the synthetic flora on plant growth for 60 days. DETAILED DESCRIPTION
[0028] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.
[0029] Note: Unless otherwise noted, the experimental methods in the following examples are conventional methods, performed according to the techniques and conditions described in literature in the field or according to product specifications. Materials and reagents used in the following examples, unless otherwise noted, are commercially available.
[0030] Plants and experimental sites used in this study: This experiment was conducted in a greenhouse at Sichuan Agricultural University in Chengdu, Sichuan Province, China (30°42′N, 103°51′E). Located in the Sichuan Basin, this region is primarily hilly and plain, with an altitude ranging from 500 to 600 m. The climate is subtropical, with four distinct seasons and simultaneous rainfall and heat. The average annual temperature ranges from 15.7°C to 18.0°C, the total annual precipitation from 734.8 to 1142.3 mm, and the average annual sunshine duration from 843.9 to 1406.2 h.
[0031] To better replicate field conditions, the experimental soil was collected from a red soil in a bamboo forest in Huaning Village, Renshou County, Sichuan Province (29°41′N, 104°11′E). A 20 m × 20 m plot within a healthy bamboo forest was selected as a standard plot. Three S-shaped sampling points were selected, and soil samples were collected from the 10-40 cm depth after removing litter and topsoil. The soil was crushed and sieved through a 5 mm sieve, mixed evenly, and used in the potted experiments. Plants were planted in the same substrate, and the effects of soil mixing were similar and negligible, focusing on comparisons between treatments.
[0032] The hybrid bamboo seedlings (herein referred to as hybrid bamboo) used in this study were purchased from Neijiang, Sichuan. They were six months old, with culms 20–40 cm tall and 0–4 mm in diameter. All plants were planted in pots containing 4 kg of naturally mixed soil (the pots were wiped with 75% ethanol and exposed to ultraviolet light for 30 minutes) in the greenhouse of the Fifth Teaching Building of Sichuan Agricultural University, Chengdu Campus. The temperature was maintained at 25–35°C, the relative humidity at 65%–85%, and the sunlight was natural. The experimental period for the bamboo seedlings was from April to September of the same year.
[0033] The strains used in this study include: Biocontrol fungus Trichoderma spiralis ( Trichodermaspiralis )RS05(Accession No.: ITS OK605030, TEF1 OK905444, RPB2 OK905445; accession number: CGMCC No.40012); Bacillus siamensis ( Bacillus siamensis )B11(Accession No.: 16S OP925891, gyrB OP937001; accession number: CGMCC No.19894); Streptomyces mirabilis ( Streptomyces mirabilis )BD2233 (Accession No.: 16S OP236556; atpD OP390162; recA OP390163; rpoB OP390164; gyrB OP413833; trpB OP413834; Accession number: GMCC No. 25634); Pathogen: Fusarium spp. Fusarium proliferatum )BD2010( ITS , OK325614; TUB , OK377026; TEF , OK377027; RPB2 , OK377028; HIS , OK377029 and mtSSU , OK338638) were stored by the Forest Protection Laboratory of Sichuan Agricultural University. To prevent bacterial strain degradation, each strain was activated from a slant tube stored at 4°C.
[0034] Experimental Example 1 In vitro interaction assay between strains To explore the interaction between biocontrol microorganisms, an in vitro strain pairing supernatant test was performed. 8 Three biocontrol strains were inoculated into 20 mL of PDB medium at a concentration of cfu / mL and cultured at 28°C and 220 rpm for 48 hours. The cultures were centrifuged at 8000 rpm for 10 minutes, and the supernatant was filtered through a 0.22 μm sterile filter to obtain the sterile supernatant (S) of each strain. Each culture of each strain was adjusted to the same OD600 value (= 0.1) and inoculated into the sterile supernatant (1%, v / v) of all strains. Each strain was inoculated into fresh PDB medium as a control. Each treatment was cultured at 28°C and 220 rpm for 48 hours, and the OD600 of all cultures was measured. Results are expressed as the OD600 of the strain in the different S cultures divided by the OD600 of the strain control culture (i.e., OD600 spent / fresh). Each treatment was repeated three times. Interactions between microorganisms were determined by measuring the OD600 spent / fresh. If OD600 spent / fresh is greater than 1, it indicates that there is a promoting effect between the strains, and if it is less than 1, it indicates that there is an inhibitory effect between the strains.
[0035] The in vitro interaction heat map between the three biocontrol bacteria was obtained by in vitro strain pairing supernatant test. Figure 1In figure a, RS05_S, B11_S, and BD2233_S represent the sterilized supernatants of RS05, B11, and BD2233, respectively. As can be seen, the sterile supernatant of strain B11 strongly promoted the growth of strains RS05 and BD2233, while the sterile supernatant of strain RS05 significantly promoted the growth of strains B11 and BD2233, indicating that the three biocontrol strains mutually promoted growth (OD600 spent / fresh > 1).
[0036] Experimental Example 2 Establishment of an absolute quantitative method for synthetic bacterial flora 1. Design specific primers DNA from RS05 was extracted using the Solarbio Fungal Genomic DNA Extraction Kit, and DNA from B11 and BD2233 was extracted using the TIANGEN Bacterial Genomic DNA Extraction Kit, according to the kit instructions. PCR amplification of bacterial 16s rRNA and fungal ITS was performed using primers 27F and 1492R, along with primers ITS1 and ITS4. The primer sequences are listed below. The PCR mixture (25 µL) consisted of: 12.5 µL of 2× EasyTaq PCR Supermix, 1 µL of upstream primer (10 mmol / L), 1 µL of downstream primer (10 mmol / L), 1 µL of DNA template, and 9.5 µL of ddH2O. PCR reaction conditions included initial denaturation at 95°C for 10 min, denaturation at 94°C for 1 min, annealing at 55°C for 30 s, extension at 72°C for 1 min, and 35 cycles followed by a final extension at 72°C for 10 min. The PCR product was electrophoresed using a 1% agarose gel as a carrier to detect whether it was a single band. PCR products with qualified sequence sizes were sent to Qingke Biotechnology Co., Ltd. for sequence determination. The sequencing results were compared in the NCBI database, and the gene sequences of each strain were compared using DNAMAN8 software, with conserved sequences selected as target fragments. Primers were designed using Primer3 Plus. The primers were synthesized by Qingke Biotechnology Co., Ltd. DNA from all strains was amplified using the designed primers, and the resulting PCR products were tested for specificity using gel electrophoresis.
[0037] The primer sequences are as follows (5'-3'): 27F (SEQ ID NO. 1): AGAGTTTGATCCTGGCTCAG; 1492R (SEQ ID NO. 2): TACGACTTAACCCCAATCGC; ITS1 (SEQ ID NO.3):TCCGTAGGTGAACCTGCGG; ITS4 (SEQ ID NO. 4):TCCTCCGCTTATTGATATGC.
[0038] 2. Preparation of standards and standard curves for fluorescent quantitative PCR (1) Preparation of standard products ① PCR amplification: Perform PCR amplification according to the reaction system and procedure in Table 2 to obtain the target gene fragment. The PCR product is subjected to gel electrophoresis.
[0039] Table 2 PCR reaction system and procedure
[0040] ② After gel electrophoresis, use the SanPrep column DNA gel recovery kit to cut the gel and recover the purified PCR product.
[0041] ③PCR products and TRAN pEASY -T&B Zero Cloning Kit pEASY -Connection of T&B Zero carrier.
[0042] ④Use Qingke Bio DH5α Chemically Competent Cell for transformation.
[0043] ⑤ Identify positive colonies using PCR. Pick a single colony from the LB plate and transfer it to 10 μL of sterile water. Vortex and mix. Transfer 1 μL of this mixture to a 25 μL PCR reaction system and perform PCR amplification using the vector-derived primers M13F and M13R (specific primers are listed below). The 25 μL PCR mixture includes: 12.5 μL 2× EasyTaq PCR Super Mix, 1 μL upstream primer (10 mmol / L), 1 μL downstream primer (10 mmol / L), 1 μL DNA template, and 9.5 μL ddH2O. PCR reaction conditions: 95°C initial denaturation for 5 min, 94°C denaturation for 30 s, 55°C annealing for 15 s, and 72°C extension for 1 min, for 30 cycles, followed by a final extension at 72°C for 10 min. Gel electrophoresis was performed to detect the presence of a single, specific band. PCR products of acceptable size were sent to Qingke Biotechnology Co., Ltd. for sequencing. The obtained sequences were aligned using Snapgene software. Meanwhile, the colony mixture with qualified sequence size was inoculated into LB liquid medium containing kanamycin and incubated at 37°C and 220 rpm in a shaking incubator for 16 h.
[0044] Specific primers: M13F (SEQ ID NO.11): GTAAAACGACGGCCAGT; M13R (SEQ ID NO. 12): CAGGAAACAGCTATGAC.
[0045] ⑥ Use the FlashPure Fast Plasmid Mini Kit from Daling Bio to extract the plasmid.
[0046] (2) Establishment of standard curve A standard curve was prepared using a 10-fold dilution series of the extracted plasmid. 1 μL of plasmid DNA was placed in a centrifuge tube containing 9 μL of Eluent and vortexed to mix thoroughly. The copy number was then adjusted from n×10 8 Serial dilutions to n × 10 copies / mL 4 copies / mL. The conversion formula for DNA copy number is as follows:
[0047] DNA =
[0048] DNA represents the DNA copy number, in copies / mL; Amount represents the concentration of the plasmid, in ng / μL; Length represents the sum of the vector and fragment length, i.e., 3955 + fragment length, in bp.
[0049] This standard and the specific primers designed in this experiment were used to perform fluorescence quantitative reaction and establish an absolute quantitative method based on SYBR Green. qPCR reaction system: 2×ChamQ Blue Universal SYBR qPCR Master Mix 10.0 µL, Primer 1 (10 µM) 0.4 µL, Primer 2 (10 µM) 0.4 µL, Template DNA / cDNA 1 µL, ddH2O 8.2 µL. qPCR reaction conditions: 95 °C pre-denaturation for 30 s; 95 °C denaturation for 10 s, 60 °C annealing for 30 s, 40 cycles. After the reaction was completed, the logarithm of the positive template was used as the horizontal axis, and the initial cycle number (Ct) at which the fluorescence signal appeared during the PCR reaction was used as the vertical axis to draw a standard curve. The correlation coefficient R was used. 2 The standard curve was used to evaluate the amplification efficiency (E). 2 The value should be greater than 0.98. The closer the value is to 1, the better the linear relationship is and the more accurate the data is. Amplification efficiency (E) calculation formula: E=10 -1 / 斜率 It is generally believed that the amplification efficiency should be between 90-110%, and the corresponding slope should be between -3.58 and -3.1.
[0050] The ITS amplification products of RS05 and the 16s amplification products of B11 and BD2233 strains were obtained by amplification. After sequencing, the sequences were aligned with DNAMAN8 to find the specific sequences of each strain for the design of specific primers. The results of sequence alignment are shown in Figure 2 As shown, the results showed that the segments 20-470 and 835-1257 had high specificity for each strain, so these segments were selected to design primers.
[0051] According to the general principles of fluorescence quantitative primers, Primer 3plus was used to design primers, as shown in Table 1. Three pairs of specific primers were cross-validated, and the electrophoresis results of primer specificity validation were obtained as shown in Table 1. Figure 1 As shown in b, M is a DNA marker; lanes 1, 2, 7, 8, 13, and 14 are RS05; lanes 3, 4, 9, 10, 15, and 16 are B11; and lanes 5, 6, 11, 12, 17, and 18 are BD2233. It can be seen that all three strains have specific amplification at 250 bp, while other strains have no specific amplification in the same region. At the same time, the specific melting curve of the primers was determined, and the results are shown in Figure 1 As shown in Figure c, all specific primers produced single-peak melting curves with no obvious miscellaneous peaks, indicating good primer specificity and suitable for absolute quantification of synthetic bacterial populations.
[0052] Table 1 qRT-PCR primers
[0053] After the qRT-PCR amplification products in Table 1 were recovered, purified, connected and transformed, single colonies were picked for colony PCR. The electrophoresis results of positive single colonies were shown in the table. Figure 1 As shown in Figure d, the electrophoresis detection bands are single and meet the target size. M is a DNA marker; lanes 1-4 are RS05; lanes 5-8 are B11; and lanes 9-12 are BD2233. The sequencing results were compared with the original gene sequence and the sequence was correct, indicating that the recombinant plasmid was successfully constructed and can be used as a standard. Fluorescence quantitative PCR reaction was performed using the standard and specific primers. The results were plotted with the Ct value as the vertical axis and Log [pM] as the horizontal axis to draw the standard curve. The standard curves for RS05, B11, and BD2233 are shown in Figure d. Figure 1 The standard curves of RS05, B11 and BD2233 strains were y = -3.4757x + 37.45 (R 2 = 0.9914), y = -3.4335x +36.361 (R 2 = 0.9968) and y = -3.3785x + 40.254 (R2 = 0.9914), with amplification efficiencies of 93.96%, 95.55%, and 97.69%, respectively. Because the Ct value is linearly related to the logarithm of the initial template copy number, after obtaining the Ct value of an unknown sample, the actual copy number of that sample can be calculated based on the standard curve.
[0054] Experimental Example 3: Plotting the Growth Curve of Biocontrol Strain 1×10 8 A 1% inoculum of 1% cfu / mL suspension of Bacillus siamese B11, Streptomyces mirabilis BD2233, and Trichoderma spiralis RS05 spores was inoculated into 20 / 50 mL PDB medium. Three replicates were incubated at 28°C and 180 rpm for 0, 6, 12, 18, 24, 30, 36, 42, 48, 60, 72, 84, 96, 108, and 120 h, respectively. DNA was extracted from each replicate using the Solebro Universal Genomic DNA Extraction Kit (Solutions) according to the kit's instructions. Real-time quantitative polymerase chain reaction (PCR) was performed using SYBR Green. Real-time quantitative PCR, combined with an absolute quantification standard curve and calculation formula, was used to calculate the DNA copy number of different strains at different time points, and growth curves of the different biocontrol agents were plotted. Real-time fluorescence quantitative PCR reactions were performed as described above.
[0055] The corresponding growth curves were drawn using the DNA copy numbers of the three biocontrol bacteria at different time periods from 0 to 120 h. The results are shown in Figure 3 As shown in the figure, strains RS05, B11, and BD2233 entered the logarithmic growth phase after 36, 6, and 18 hours, respectively, and their DNA copy numbers reached their maximums at 60, 48, and 60 hours, respectively. After 60 hours, the curves showed a slow downward trend, indicating that the strains entered the decline phase. Based on the logarithmic growth phases of the three biocontrol bacteria, 60 hours was selected as the optimal culture time for the three strains.
[0056] Experimental Example 4 Effects of different inoculation conditions on bacterial DNA copy number 1. Effect of changes in the single-strain inoculation ratio on bacterial DNA copy number In order to screen the optimal inoculation ratio of synthetic bacteria, 6 experimental groups were designed, with 1×10 8 A 1% inoculum of each of B11, BD2233, and RS05 bacterial suspensions was inoculated into 20 / 50 mL of PDB medium (strain volume ratio of 1:1:1) as a control. Different inoculation volumes were used for each experimental group as shown in Table 3, with three replicates per group. After inoculation, the culture was incubated at 28°C on a shaker at 220 rpm for 60 h.
[0057] Table 3 Inoculation ratio of synthetic flora
[0058] 2. Effects of changes in the inoculation ratio of different strains on the bacterial DNA copy number In order to screen the optimal inoculation ratio of the synthetic bacterial consortium, 1× 10 8 B11, BD2233, and RS05 spore suspensions were inoculated at 1% inoculum into PDB medium as a control (strain volume ratio of 1:1:1). Six permutations (see Table 4) were used to adjust the inoculation ratios for the experimental groups. Three replicates were used for each experiment. These permutations were used to investigate the effects of different inoculation ratios on bacterial population structure. After inoculation, the samples were incubated at 28°C on a shaker at 220 rpm for 60 h.
[0059] Table 4 Inoculation ratio of synthetic flora
[0060] Total DNA from control and experimental samples was extracted using the Solebro Universal Genomic DNA Extraction Kit, and real-time quantitative PCR reactions were performed using SYBR Green. Real-time quantitative PCR, combined with an absolute quantification standard curve and calculation formula, determined the inoculum ratio with the highest DNA copy number. DNA extraction was performed according to the kit, and real-time quantitative PCR reactions were performed as described above for fluorescence quantification.
[0061] The results of the effects of different ratios of inoculation of three biocontrol bacteria on the DNA copy number of the bacterial population are shown in Figure 4 As shown, a is the effect of changing the inoculation ratio of a single strain on the total DNA copy number of the bacterial community; b is the effect of changing the inoculation ratio of a single strain on the DNA copy number of the biocontrol bacteria; c is the effect of changing the inoculation ratio of different strains on the total DNA copy number of the bacterial community; d is the effect of changing the inoculation ratio of different strains on the DNA copy number of the biocontrol bacteria. According to the one-way analysis of variance, different letters indicate significant differences between the treatments at p < 0.05. The effect of changing the inoculation ratio of a single strain on the total DNA copy number of the bacterial community is shown in Figure 4 As shown in a; the effect of changing the single plant inoculation ratio on the DNA copy number of biocontrol bacteria is shown in Figure 4 As shown in b. It can be seen that changing the inoculation ratio of individual strains has a significant effect on the growth and DNA copy number of the bacterial colony (P<0.05). In all experimental groups, when the inoculation ratio of BD2233 was increased by 3 times, the total DNA copy number of the bacterial colony was significantly higher than that of other experimental groups, reaching a maximum value of 5.88×10 6In contrast, the total DNA copy number was the lowest when the inoculation ratio was equal, only 1.70×10 5 copies / µL. When the inoculum ratio of a single strain was increased, the total bacterial DNA copy number also increased significantly compared to the control group, indicating that changes in the inoculum size of a single strain significantly affect the DNA synthesis and proliferation of the synthetic bacterial community. Furthermore, increasing the inoculum ratio of BD2233 to varying degrees significantly affected the DNA copy number of RS05 and B11.
[0062] Changing the inoculation ratio of different strains significantly affected the DNA copy number and structure of the synthetic bacterial community. The results are shown in Figure 4 c. When RS05:B11:BD2233 was inoculated at a ratio of 3:2:1, the total DNA copy number of the bacterial colony was significantly higher than that of the other experimental groups, reaching a maximum value of 7.46×10 8 copies / µL. The total DNA copy number of the bacterial colony was the lowest when the inoculation ratio was 1:1:1, which was only 2.65×10 5 copies / µL. Inoculation ratios of 1:3:2, 2:1:3, and 2:3:1 were all able to significantly promote DNA synthesis and proliferation of the synthetic bacterial community, possibly because the synergistic effect between the strains was enhanced. However, the DNA copy numbers of the 1:2:3 and 3:1:2 groups were less than those of the control group, and there was no significant difference between them. This indicates that the inoculation ratio was not effective in promoting DNA synthesis and proliferation, possibly because changes in the number structure between strains led to changes in the interaction between strains. The number of strains in the synthetic bacterial community under different inoculation ratios is shown in the figure. Figure 4 As shown in Figure d, B11 is the dominant species, significantly outnumbering other strains at different inoculation ratios. Furthermore, the experimental groups with high B11 abundance also showed a relatively high total DNA copy number, inferred to be due to B11's important role in promoting positive regulation of the synthetic microbial community. RS05 and BD2233 have similar abundances, with no significant differences across different inoculation ratios, indicating relatively stable populations. These results suggest that even small adjustments in the ratio can have a significant impact on microbial community structure.
[0063] Experimental Example 5 Determination of the dynamic changes of synthetic microbial communities under different environments (PDB culture medium, synthetic microbial communities, and rhizosphere soil and root systems containing synthetic microbial communities and pathogens) 1. Monitoring the number of synthetic bacteria in PDB culture medium A 1% inoculum of the prepared synthetic bacterial suspension was inoculated into PDB liquid culture medium at 220 rpm and 28°C. Colonization was quantitatively assessed at 1, 3, 7, 15, and 30 days. DNA extraction and real-time fluorescence quantitative analysis were performed as described above.
[0064] 2. Monitoring the number of synthetic microbiota and synthetic microbiota + pathogens colonized in the rhizosphere of hybrid bamboo Using the root irrigation method, the suspensions of various strains were mixed in the optimal ratio to construct a synthetic bacterial community. 8 cfu / mL) was applied to the rhizosphere soil of hybrid bamboo seedlings at a height of 3-4 cm from the soil layer, with 100 mL applied per pot. A randomized block design experiment was used, with a total of 35 pots treated. Plants in each treatment were placed in a school greenhouse and watered with 100 mL of sterile water every 3 days and 30 mL of Hoagland's nutrient solution every 15 days. Three seedlings were randomly selected for sampling at 1, 3, 7, 15, 30, 45, and 60 days after inoculation. The plants were removed with their roots, large clumps of soil were removed, and the soil remaining attached to the roots after gentle shaking was collected as the rhizosphere soil. The rhizosphere soil was collected with a brush, mixed, and 0.2 g of the rhizosphere soil was used for total DNA extraction. Roots from random plants were excised and mixed. 0.2 g of the root tissue was soaked in 75% anhydrous ethanol for 30 seconds, then in 2% sodium hypochlorite for 2 minutes, rinsed three times with sterile deionized water, and then dried with sterile filter paper. The final wash water was inoculated onto PDA medium to confirm the absence of residual microorganisms. Total DNA from the rhizosphere soil and synthetic bacterial consortium was extracted using a universal genomic DNA kit (Solarbio). RS05, B11, and BD2233 were quantified using a qPCR instrument to obtain Ct values. Ct values were converted to copy numbers using a standard curve. Real-time fluorescence quantitative PCR reactions were performed as described above.
[0065] By root irrigation method, 100 mL of synthetic bacterial colony (1×10 8 cfu / mL) and 100 mL of Fusarium spp. (1×10 5 cfu / mL) were simultaneously applied to the rhizosphere soil of hybrid bamboo seedlings at a height of 3-4 cm above the soil layer. A randomized block design was used, with a total of 35 pots treated. Plant management was the same as above. Samples were randomly collected from three seedlings at 1, 3, 7, 15, 30, 45, and 60 days after inoculation. Rhizosphere soil and root microbial community samples were collected, and DNA was extracted and analyzed using real-time fluorescence quantitative PCR as described above.
[0066] After measurement, the dynamic changes of DNA copy number of synthetic bacterial colonies in different environments are shown in Figure 5 As shown, Figure 5a is the dynamic change of the total DNA copy number of the synthetic community in PDB culture medium; b is the dynamic change of the total DNA copy number of the synthetic community in the rhizosphere soil of hybrid bamboo; c is the dynamic change of the total DNA copy number of the synthetic community in the root system of hybrid bamboo; d is the dynamic change of the total DNA copy number of the synthetic community in the rhizosphere soil of hybrid bamboo under the treatment of synthetic community + pathogens; e is the dynamic change of the total DNA copy number of the synthetic community in the root system of hybrid bamboo under the treatment of synthetic community + pathogens; f is the dynamic change of the DNA copy number of biocontrol bacteria in PDB culture medium; g is the dynamic change of the DNA copy number of biocontrol bacteria in the rhizosphere soil of hybrid bamboo; h is the dynamic change of the DNA copy number of biocontrol bacteria in the root system of hybrid bamboo; i is the dynamic change of the DNA copy number of biocontrol bacteria in the rhizosphere soil of hybrid bamboo under the treatment of synthetic community + pathogens; j is the dynamic change of the DNA copy number of biocontrol bacteria in the root system of hybrid bamboo under the treatment of synthetic community + pathogens. Different letters indicate significant differences among treatments at p < 0.05 according to one-way ANOVA.
[0067] As can be seen, the total DNA copy number of the synthetic microbial community in both the PDB and rhizosphere soil was highest on day 1, then rapidly decreased from day 1 to 15, with minimal fluctuations after day 15, gradually leveling off. Under both the synthetic microbial community and synthetic microbial community + pathogen culture conditions, the synthetic microbial community slowly increased in the root system from day 1 to 30, reaching a maximum total DNA copy number on days 15 and 30, respectively. Afterwards, the DNA copy number fluctuated within a small range, gradually leveling off. DNA copy number varied under different conditions over the same period. The total DNA copy number in the PDB environment was significantly higher than in the other two environments from day 1 to 30, possibly due to the rich nutrients in the PDB, which facilitated its growth and reproduction. The total DNA copy number in both the rhizosphere soil and the root system of the synthetic microbial community + pathogen group was slightly higher than that in the synthetic microbial community from day 1 to 60, possibly due to the stimulation of the pathogen, which promoted the growth and reproduction of the biocontrol bacteria. There was no significant difference in the total DNA copy number of the rhizosphere soil microbial community in the synthetic bacteria group within 7-60 days, while there was no significant difference in the total DNA copy number of the rhizosphere soil microbial community in the synthetic bacteria group + pathogen group within 30-60 days, indicating that the microbial community of the synthetic bacteria group tended to stabilize before the synthetic bacteria group + pathogen group, and the colonization of the synthetic bacteria group may be greatly affected by pathogens.
[0068] PDB environment (see Figure 5 (f) The dynamic changes of the synthetic bacterial communities within 30 days were significantly different. RS05 increased by 56.13% from day 1 to day 3, reaching a maximum of 7.45×10 5The DNA copy number of RS05 decreased by 94.57% from day 3 to day 30. The number of B11 decreased the most from day 1 to day 30, decreasing by 99.55%. The number of BD2233 increased by 10957.44% from day 1 to day 3, reaching a maximum of 3.54×10 6 copies / µL, and the DNA copy number decreased by 96.54% from day 3 to day 30.
[0069] In the rhizosphere soil of the synthetic bacterial group (see Figure 5 (g), the number of RS05 and B11 decreased continuously, with the largest decreases from 3 to 7 days, by 60.14% and 84.19%, respectively, and from 1 to 60 days, by 95.84% and 98.49%, respectively. The number of BD2233 decreased the most from 7 to 15 days, by 66.62%, and from 1 to 60 days, by 92.50%. In the root environment (see Figure 5 The three strains showed an overall increasing trend (h). RS05 showed the largest increase between 3 and 7 days, increasing by 148.85%; B11 showed the largest increase between 7 and 15 days, increasing by 121.32%; and BD2233 showed the largest increase between 3 and 7 days, increasing by 293.74%. RS05, B11, and BD2233 reached their maximum values of 7.12×10-10 on day 30, day 15, and day 15, respectively. 3 , 9.38×10 3 and 1.72×10 4 copies / µL, which increased by 1231.90%, 687.65% and 1539.83% respectively compared with the first day.
[0070] In the rhizosphere soil of the synthetic bacterial community + pathogen group (see Figure 5 (i) The numbers of RS05, B11, and BD2233 showed an overall downward trend. Specifically, RS05 and B11 showed the largest decreases between 3 and 7 days, by 79.83% and 87.95%, respectively. BD2233 showed a slight increase of 214.55% between 1 and 3 days, and the largest decrease between 7 and 15 days, by 63.20%. Compared to the first day, the numbers of RS05, B11, and BD2233 on the 60th day decreased by 98.31%, 98.96%, and 89.71%, respectively. The decrease in BD2233 was smaller than that of the other two strains, indicating a more stable population. In the root environment (see Figure 5(j) The numbers of RS05, B11, and BD2233 showed an overall upward trend, then leveled off later. Specifically, the numbers of RS05 and BD2233 increased the most between 3 and 7 days, by 215.94% and 232.25%, respectively. The number of B11 increased the most between 1 and 3 days, by 357.86%. RS05, B11, and BD2233 reached their maximum values of 1.87×10-1 on days 30, 15, and 30, respectively. 4 , 1.57×10 4 and 2.08×10 4 copies / µL, which increased by 2903.25%, 2135.49% and 1828.62% respectively compared with the first day.
[0071] In summary, the changes in the number of different strains in the synthetic microbial community under different culture conditions showed obvious differences, reflecting the large differences in the growth and adaptability of strains in different living environments.
[0072] Experimental Example 6 Effect of synthetic bacterial flora on plant growth The root irrigation method was used to inoculate the synthetic bacterial community (RS05, B11 and BD2233 in a volume ratio of 3:2:1, denoted as Syncoms group), RS05+B11 (volume ratio 3:2), RS05+BD2233 (volume ratio 3:1), B11+BD2233 (volume ratio 2:1), RS05, B11 and BD2233 bacterial suspension (the bacterial suspensions of different groups were all 1×10 8 cfu / mL) was applied to the rhizosphere soil of the seedlings in a randomized block design, with an equal amount of sterile water (CK) serving as a control. A total of 175 pots were treated. Plant management was the same as above. Three seedlings were randomly sampled at 1, 3, 7, 15, 30, 45, and 60 days after inoculation. After removing the rhizosphere soil, the roots were rinsed with running water, and plant morphological indicators were immediately measured: plant height (the distance from the base of the rhizome to the top of the growing point), plant fresh weight (the plant surface was cleaned with clean water, the surface moisture was wiped off, and the entire plant was weighed), stem diameter (the stem diameter at the base of the plant stem was measured using a vernier caliper), and root length (the distance from the root tip to the base of the plant rhizome).
[0073] After measurement, the effect of synthetic flora on plant growth was obtained. Figure 6-12 As shown, Figure 6-12 The results of the effects of the synthetic flora on plant growth at 1, 3, 7, 15, 30, 45, and 60 days are shown. According to one-way analysis of variance, different letters indicate significant differences between treatments at p < 0.05. Figure 6-12The results indicate that different combinations of biocontrol bacteria colonized the rhizosphere of hybrid bamboo significantly promoted plant height, root length, fresh weight, and stem width. During the initial growth period (1-30 days), the different treatments had no significant effect on plant height and root length. However, after 30 days, the different treatments showed significant improvements, with the synthetic bacterial consortium exhibiting the most significant effects. Specifically, at 60 days, the plant height of the Syncoms, RS05+B11, RS05+BD2233, B11+BD2233, RS05, B11, BD2233, and CK groups increased by 134.38%, 99.87%, 97.56%, 109.19%, 77.90%, 90.54%, 82.68%, and 55.35%, respectively, compared to the 1-day growth period. The root lengths of the hybrid bamboos in the Syncoms, RS05+B11, RS05+BD2233, B11+BD2233, RS05, B11, BD2233, and CK groups increased by 100.40%, 72.73%, 65.31%, 79.84%, 68.56%, 64.88%, 58.37%, and 56.72% compared to 1 day, respectively. Meanwhile, the plant heights in the Syncoms group were 1.18, 1.21, 1.14, 1.33, 1.23, 1.29, and 1.53 times those in the RS05+B11, RS05+BD2233, B11+BD2233, RS05, B11, BD2233, and CK groups, respectively. The root lengths of the Syncoms group were 1.18, 1.22, 1.13, 1.28, 1.24, 1.28, and 1.33 times those of the RS05+B11, RS05+BD2233, B11+BD2233, RS05, B11, BD2233, and CK groups, respectively. The different treatments significantly affected the fresh weight of hybrid bamboo. In the early growth stages, the effects of the treatments on fresh weight were not significant. However, significant differences in the effects of the treatments on fresh weight were observed between 15 and 60 days of age. Specifically, at 60 days, the fresh weight of the hybrid bamboo treated with Syncoms was the highest, 1.17, 1.20, 1.10, 1.31, 1.23, 1.26, and 1.43 times that of the RS05+B11, RS05+BD2233, B11+BD2233, RS05, B11, BD2233, and CK groups, respectively. From 1 to 60 days, there was no significant difference in the effect of the different treatment groups on the stem width of the hybrid bamboo. However, according to the results measured at 60 days, the hybrid bamboo treated with Syncoms had the highest stem width, 1.16 times that of the CK group. In summary, the synthetic bacterial consortium significantly promoted plant growth in four areas: plant height, root length, fresh weight, and stem width. The synthetic bacterial consortium provided by the present invention can be used to prepare synthetic bacterial agents, which have a significant effect on promoting plant growth, especially the growth of the "Chang × Green" hybrid bamboo.
[0074] Although the present invention has been described in detail through the above preferred embodiments, it should be understood that the above description is not intended to limit the present invention. After reading the above description, various modifications and substitutions of the present invention will become apparent to those skilled in the art. Therefore, the scope of protection of the present invention should be defined by the appended claims.
Claims
1. A method for absolute quantification of synthetic bacterial flora, characterized in that: The following steps are included: (1) performing absolute quantification of each strain in the synthetic bacterial consortium; (2) Select the inoculation ratio of each strain when the total bacterial DNA copy number is the highest; (3) Prepare a synthetic bacterial community according to the selected inoculation ratio.
2. The absolute quantitative method according to claim 1, characterized in that The synthetic bacterial consortium comprises Trichoderma spiralis ( Trichoderma spiralis )RS05, Bacillus siamensis ( Bacillus siamensis )B11, Streptomyces mirabilis ( Streptomyces mirabilis )BD2233.
3. An absolute quantitative method for constructing a synthetic bacterial consortium that can be used to promote plant growth, characterized in that: The synthetic bacterial consortium comprises Trichoderma spiralis ( Trichoderma spiralis )RS05, Bacillus siamensis ( Bacillus siamensis )B11, Streptomyces mirabilis ( Streptomyces mirabilis ) BD2233; the constructed absolute quantification method uses three strains of bacteria in the synthetic bacterial consortium as standards for absolute quantification; The absolute quantification method comprises the following steps: (1) performing absolute quantification on the three bacterial strains in the synthetic bacterial population; (2) selecting the inoculation ratio of the three bacterial strains when the total bacterial population DNA copy number is the highest; and (3) preparing the synthetic bacterial population according to the selected inoculation ratio.
4. The absolute quantitative method according to claim 3, characterized in that The absolute quantitative primers for RS05 are shown in SEQ ID NOs. 5 and 6, the absolute quantitative primers for B11 are shown in SEQ ID NOs. 7 and 8, and the absolute quantitative primers for BD2233 are shown in SEQ ID NOs. 9 and 10.
5. The absolute quantitative method according to claim 3, characterized in that The inoculation ratio of the three bacterial strains is RS05:B11:D2233=3:2:
1.
6. The absolute quantitative method according to claim 5, characterized in that: The concentration of each of the three strains was 1×10 8 cfu / mL.
7. The synthetic bacterial consortium constructed according to the absolute quantitative method of claim 6.
8. Use of the synthetic bacterial consortium according to claim 7 in the preparation of a synthetic bacterial agent.
9. Use of the synthetic bacterial flora as claimed in claim 7 in promoting plant growth.
10. The use according to claim 9, characterized in that The plants include hybrid bamboo of the species "Zheng" and "Lv".