Polyarginine-DNA nanotube material as well as preparation method and application thereof

Abstract

The invention relates to a polyarginine-DNA nanotube material as well as a preparation method and application thereof, and belongs to the technical field of biological medicines. Aiming at the technical problems of unstable structure, low cell uptake rate and easy degradation by nuclease caused by dependence on magnesium ions in the existing DNA nano-material, the invention provides a nano-tube material formed by self-assembly of four DNA single chains (Y1-Y4) according to a molar ratio of 1: 3: 3: 3 induced by polyarginine. The material can load p65 siRNA to form a composite preparation which is used for preparing a medicine for inhibiting lung inflammation. According to the polyarginine-DNA nanotube material disclosed by the invention, the stability and the cell uptake efficiency of the material are remarkably improved; the higher the polymerization degree of arginine is, the stronger the anti-inflammatory activity is; the compound preparation synergistically inhibits the expression of a proinflammatory factor through a dual mechanism of blocking an inflammatory pathway by polyarginine and silencing a p65 signal by p65 siRNA, and provides an efficient delivery carrier for the treatment of acute lung injury.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine and relates to a polyarginine-DNA nanotube material and a preparation method and application thereof. Background Art

[0002] DNA, the genetic material in the human body, can self-assemble into nanostructures through the principle of complementary base pairing. These assembled DNA nanostructures exhibit excellent biocompatibility, lack immunogenicity, and have potential toxicity, potentially addressing the shortcomings of common drug delivery vehicles. Furthermore, DNA nanostructures possess excellent programmability, enabling targeted therapy through the design of specific nucleic acid aptamers. Furthermore, guest molecules can be modified on the surface of the materials, imbuing them with novel functions while preserving their inherent properties. Interfering RNA can also be loaded into DNA nanostructures to modulate biological signaling pathways. However, the use of DNA nanostructures for disease treatment presents several key challenges that need to be addressed. Conventional approaches rely on magnesium ion-mediated DNA nanomaterial synthesis, which is magnesium ion concentration-dependent. Low magnesium ion concentrations in physiological environments make it difficult to maintain structural stability. Furthermore, complex annealing processes are required, making kinetic control difficult. Furthermore, negatively charged DNA repulses negatively charged cell membranes, resulting in low cellular uptake. Furthermore, DNA is easily degraded by nucleases in physiological environments, hindering its function in these environments.

[0003] Acute lung injury / acute respiratory distress syndrome (ARDS) is characterized by inflammatory disorders, oxidative stress, alveolar-capillary barrier disruption, and pulmonary edema, presenting a serious threat to human health. Currently, there are no effective treatments for ARDS. Therefore, the development of potential therapeutic agents and drug delivery vehicles is urgently needed. Summary of the Invention

[0004] In view of this, one of the objectives of the present invention is to provide polyarginine-mediated nucleic acid nanomaterials with varying degrees of polymerization. Polyarginine is a cell-penetrating peptide with a positive charge, and the amount of this charge is related to the degree of polymerization of the polyarginine. Positively charged polyarginine can interact with negatively charged DNA, so polyarginine can replace traditional magnesium ions and mediate the self-assembly of DNA nanomaterials through electrostatic interactions. A second objective is to provide a method for preparing polyarginine-mediated nucleic acid nanomaterials with varying degrees of polymerization. A third objective is to provide a use of polyarginine-DNA nanotube materials in the preparation of pharmaceuticals.

[0005] In order to achieve the above object, the present invention provides the following technical solutions: The present invention provides a polyarginine-DNA nanotube material, wherein the nanotube material is assembled from four different DNA single strands under the induction of polyarginine, wherein the molar ratio of the four DNA single strands: Y1, Y2, Y3, and Y4 is 1:3:3:3, and the polyarginine forms any one of a dimer, a trimer, or an octamer; Preferably, the nucleic acid sequences of the four DNA single strands: Y1, Y2, Y3, and Y4 are SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, respectively; Furthermore, the preparation method of the polyarginine-DNA nanotube material comprises the following steps: S1: Prepare aqueous solutions of Y1, Y2, Y3, and Y4; S2: Y1, Y2, Y3, and Y4 are complementary paired in a polyarginine solution at a molar concentration ratio of 1:3:3:3, and a polyarginine-DNA nanotube solution is prepared after gradient annealing and / or constant temperature annealing. Preferably, the gradient annealing program is: 95°C for 5 min, 65°C for 30 min, 50°C for 30 min, 37°C for 30 min, and finally 22°C for 30 min. Preferably, the constant temperature annealing procedure is: placing the single-stranded DNA solution at a constant temperature of 37°C or 45°C for 30-90 minutes, then mixing the DNA solution, and then placing it at the same constant temperature of 37°C or 45°C for 30-90 minutes; Preferably, the polymerization degree of the polyarginine is dimerization, trimerization and octamerization, respectively, the concentration of the dimerization arginine is 100 μM-50 mM, the concentration of the trimerization arginine is 1 μM-1 mM, and the concentration of the octaarginine is 100 μM-10 μM; Furthermore, the application of polyarginine-DNA nanotube materials in the preparation of drug delivery materials; Preferably, the polyarginine-DNA nanotube material is used in the preparation of a pharmaceutical preparation for treating lung inflammation; Furthermore, the present invention provides a pharmaceutical preparation for treating pulmonary inflammation, comprising the polyarginine-DNA nanotube material and p65 siRNA, wherein the molar ratio of Y1, Y2, Y3, Y4 to p65 siRNA is 1:3:3:3:3; Preferably, the nucleic acid sequence of the p65 siRNA is shown in SEQ ID NO: 5.

[0006] The beneficial effects of the present invention are: The nanocomposite formulation of the present invention enhances cellular uptake and anti-inflammatory effects through arginine polymerization. This anti-inflammatory effect is also modulated by varying the degree of polymerization. After loading with p65 siRNA, the synergistic effect of polyarginine and p65 siRNA is ultimately utilized to effectively suppress inflammatory responses. Polyarginine-mediated DNA nanotube structures with varying degrees of polymerization are each composed of two hollow, three-arm nanotube structures spliced ​​together. Each arm contains a functional site and a p65 siRNA for base pairing, allowing the polyarginine-mediated DNA nanotube structure to ultimately load six p65 siRNAs.

[0007] 1) Self-assembled DNA nanomaterials retain the programmability of traditional nucleic acid nanomaterials while being modified to load other therapeutic molecules, such as p65 siRNA, and possess significant potential for gene therapy of disease. 2) Compared with conventional magnesium-ion-constructed nanotubes, arginine polymerization significantly enhances their cellular uptake, with uptake increases of 2.02-, 1.96-, and 2.85-fold for 2R, 3R, and 8R nanotubes, respectively. Compared with conventional magnesium-constructed nanotubes, arginine polymerization significantly enhances their anti-inflammatory properties. For example, cell experiments demonstrated that 2R, 3R, and 8R nanotubes downregulated IL-6 mRNA expression by 15.7%, 36.1%, and 44.4%, respectively. 3) Polyarginine-mediated self-assembled DNA nanomaterials exhibit excellent stability at physiological temperatures, good biocompatibility, and no cytotoxicity, greatly enhancing their potential for clinical application. 4) The prepared polyarginine-DNA nanotubes exhibit excellent stability in serum at 37°C, ensuring they are not degraded before interacting with target cells, thereby enhancing their effectiveness. 5) The present invention incorporates p65 siRNA into the DNA nanotube backbone through complementary base pairing, forming a "polyarginine-DNA-siRNA" ternary complex system. This system achieves dual anti-inflammatory mechanisms: polyarginine directly blocks inflammatory signaling pathways, activating p65 siRNA to specifically silence key nodes in the NF-κB pathway, thereby inhibiting the expression of pro-inflammatory cytokines IL-1β and IL-6.

[0008] Other advantages, objects, and features of the present invention will be described in part in the following description and, in part, will be apparent to those skilled in the art upon examination of the following description or may be learned from practice of the present invention. The objects and other advantages of the present invention may be realized and obtained through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention will be described in detail below with reference to the accompanying drawings, in which: Figure 1Schematic diagram of the self-assembly process of polyarginine-DNA nanotubes loaded with p65 siRNA and its application in treating acute lung injury; Figure 2 PAGE images of dimeric (A), trimeric (B), and octameric (C) arginine-DNA nanotubes; PAGE images of DNA nanotubes mediated by dimeric (D), trimeric (E), and octameric (F) arginine at different concentrations; Figure 3 The particle size detection results of dimeric (A), trimeric (B), and octameric (C) arginine-DNA nanotubes; Figure 4 PAGE images of the thermal stability of dimeric (A), trimeric (B), and octameric (C) arginine-DNA nanotubes; Figure 5 (A) Cytotoxicity of dimer, trimer, and octa-arginine-DNA nanotubes (nanotube concentration was 900 nM); Figure 5 (B) PAGE image of tri-arginine-DNA nanotubes carrying p65 siRNA; Figure 6 Laser confocal microscopy observation of cellular uptake of polyarginine-DNA nanotubes (A) and flow cytometry qualitative and quantitative results (B); Figure 7 The results show the effects of arginine with different polymerization degrees on the gene expression of inflammatory factors IL-Iβ (A) and IL-6 (B) in macrophages RAW 264.7; the effects of arginine-DNA nanotubes with different polymerization degrees on the gene expression of inflammatory factors IL-Iβ (C) and IL-6 (D) in macrophages RAW 264.7; the effects of tri-arginine-DNA nanotubes loaded with p65 siRNA on the phosphorylated p65 protein (E) and the gene expression of inflammatory factors IL-Iβ (F) and IL-6 (G) in macrophages RAW 264.7. Figure 8 Imaging results of the distribution of tri-arginine-DNA nanotubes loaded with p65 siRNA in mouse heart, liver, spleen, lung, and kidney tissues at different time points (A); Imaging results of tri-arginine-DNA nanotubes loaded with p65 siRNA in mouse lung tissue at different time points (B) and fluorescence intensity statistics (C); Figure 9 Schematic diagram of the treatment of acute lung injury in mice with tri-arginine-DNA nanotubes loaded with p65 siRNA (A); detection results of inflammatory factors IL-Iβ (B), IL-6 (C) and protein concentration (D) in alveolar lavage fluid; detection results of peak expiratory flow (E) and airway resistance (F) in mice; detection results of wet weight and dry weight ratio of mouse lung tissue (G); HE staining results of mouse lung tissue (H). DETAILED DESCRIPTION

[0010] The following describes the embodiments of the present invention by means of specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the illustrations provided in the following embodiments are only schematic illustrations of the basic concept of the present invention, and the following embodiments and features in the embodiments can be combined with each other without conflict.

[0011] Among them, the accompanying drawings are only for illustrative purposes and represent only schematic diagrams rather than actual pictures, and should not be understood as limiting the present invention. In order to better illustrate the embodiments of the present invention, some parts of the accompanying drawings may be omitted, enlarged or reduced, and do not represent the dimensions of actual products. For those skilled in the art, it is understandable that some well-known structures and their descriptions may be omitted in the accompanying drawings.

[0012] The same or similar numbers in the drawings of the embodiments of the present invention correspond to the same or similar parts; in the description of the present invention, it should be understood that if there are terms such as "upper", "lower", "left", "right", "front", "back", etc. indicating directions or positional relationships, they are based on the directions or positional relationships shown in the drawings. They are only for the convenience of describing the present invention and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific direction, be constructed and operate in a specific direction. Therefore, the terms describing the positional relationship in the drawings are only used for illustrative purposes and cannot be understood as limiting the present invention. For ordinary technicians in this field, the specific meanings of the above terms can be understood according to specific circumstances.

[0013] The materials used in the embodiments of the present invention are as follows: Y1: GTAGGTTTTTTCAACCGAGGCACCATCGTAGGTTTTTTCTTCCGAGGCACCATC GTAGGTTTTTTCTTGCCACCGACCATC (SEQ ID NO:1); Y2: AATCCAGACCAACAATAATTTGCAAGCCTACGATGGACACGGTAACGAC (SEQ ID NO: 2); Y3:ACCGTGTGGAAGCTAGTCGTT (SEQ ID NO:3); Y4: TAGCAACCTCCGTG (SEQ ID NO: 4) was synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0014] p65 siRNA: TTATTGTTGGTCTGGATTCGCTT (SEQ ID NO: 5) strand was synthesized by GeneFilm Technology Co., Ltd.

[0015] Arginine was purchased from Shanghai Shenggong Biological Co., Ltd.

[0016] Fetal bovine serum and phosphate-buffered saline (PBS) were purchased from Hyclone, USA. LPS was purchased from Sigma, USA.

[0017] RAW264.7 cells were purchased from the American Type Culture Institute; DMEM medium was a product of Gibco.

[0018] TRIzol reagent was purchased from Thermo Fisher Scientific (China) Co., Ltd.

[0019] IL-1β and IL-6 ELISA kits were purchased from Shanghai Sangon Biotechnology Co., Ltd.

[0020] Example 1 Self-assembly of DNA nanotubes mediated by polyarginine of different polymerization degrees DNA single strands Y1, Y2, Y3, and Y4 were diluted separately using sterile enzyme-free deionized water, and their concentrations were quantified using Nanodrop. They were then added to sterile enzyme-free centrifuge tubes at a molar concentration ratio of 1:3:3:3, and then certain concentrations of dimer, trimer, and octameric arginine were added. The final volume of the system was 50 μL. They were then annealed as follows: 95 °C for 5 min, 65 °C for 30 min, 50 °C for 30 min, 37 °C for 30 min, and then 22 °C for 30 min. The polyarginine-DNA nanotube preparations mediated by dimerization, trimerization, and octameric arginine self-assembly were electrophoresed in a 6% non-denaturing PAGE gel, and the images were scanned by a scanner. The results showed that dimerization (2R), trimerization (3R), and octameric (8R) arginine can all be well synthesized into nanotubes (such as Figure 2 The particle size of the prepared nanotube preparation was analyzed using a nanoparticle size and Zeta potential analyzer. 2R , NT 3R , NT 8R There is no significant difference in particle size (e.g. Figure 3 ), because the size of the synthesized nanoparticles is mainly determined by the length of the DNA chain, and the molecular weight of 2R, 3R, and 8R is small and has no obvious effect on the particle size.

[0021] Example 2 Study on the Thermal Stability of Polyarginine-DNA Nanotubes Arginine-mediated assembly of DNA nanotubes with different polymerization degrees and TAE-Mg 2+The mediated DNA nanotube preparations were mixed with 10% FBS (fetal bovine serum) at a volume ratio of 1:9 and then placed in 37 °C electrophoresis buffer for electrophoresis. The images were scanned by a scanner. The results showed that at 37 °C (such as Figure 4 ), the synthesized nanotubes have good thermal stability.

[0022] Example 3 Study on the Cytotoxicity of Polyarginine-DNA Nanotubes Mouse mononuclear macrophage leukemia cells RAW 264.7 were seeded in 24-well plates at 1×10 5 Cells were cultured overnight at 37°C in a 5% CO2 incubator. Polyarginine-DNA nanotubes assembled with dimerization, trimerization, and octa-arginine were then added to each well, with three replicates per group. The cells were cultured for 24 hours. Cell proliferation was assessed using MTS reagent, and the cytotoxicity of the nanotubes was evaluated. The results showed that polyarginine-DNA nanotubes had no significant cytotoxicity (e.g., Figure 5 A).

[0023] Example 4 Preparation of p65 siRNA-loaded polyarginine-DNA nanotubes The single-stranded DNA Y1, Y2, Y3, and Y4 solutions were added to a sterile, enzyme-free centrifuge tube at a molar concentration ratio of 1:3:3:3, and then a certain concentration of tri-arginine was added. The final volume of the system was 50 μL. It was then annealed as follows: 95 °C for 5 min, 65 °C for 30 min, 50 °C for 30 min, 37 °C for 30 min, and then 22 °C for 30 min. Subsequently, p65 siRNA was added to the above system so that the ratio of Y1:Y2:Y3:Y4:p65 siRNA was 1:3:3:3:3. After being placed at 37 °C for 30 min, a polyarginine-DNA nanotube preparation loaded with p65 siRNA was obtained. PAGE gel results showed that the molecular weight of the polyarginine-DNA nanotube loaded with p65 siRNA increased and the electrophoretic shift shortened (e.g., Figure 5 B).

[0024] Example 5 Study on the Cellular Uptake Behavior of Polyarginine-DNA Nanotubes Mouse mononuclear macrophage leukemia cells RAW 264.7 were seeded in 24-well plates at 1×10 5Cells were cultured overnight at 37 °C in a 5% CO2 cell culture incubator. Cy5 fluorescently labeled dimer, trimer, and octa-arginine-mediated polyarginine-DNA nanotube preparations were then added to each well of cells and cultured in a 37 °C, 5% CO2 cell culture incubator for 6 h. RAW 264.7 cells without any treatment and treated with arginine were used as control groups. After washing with PBS, the fluorescence of each group of cells was observed using a confocal fluorescence microscope. At the same time, the fluorescence intensity of each group of cells was detected using a cell flow cytometer and quantitative statistics were performed. The results show (as shown in Figure 2). Figure 6 ) The cellular uptake of DNA nanotubes assembled by macrophages mediated by octa-arginine is greater than that by DNA nanotubes assembled by tri-arginine and di-arginine. The reason is that octa-arginine is a membrane-penetrating peptide that has a good effect in promoting cellular uptake.

[0025] Example 6 Study on the Effect of Polyarginine-DNA Nanotubes on Cellular Inflammation Levels Mouse mononuclear macrophage leukemia cells RAW 264.7 were seeded in 24-well plates at 1×10 5 Cells were cultured overnight at 37°C in a 5% CO2 incubator. Dimeric, trimeric, and octameric arginine-mediated polyarginine-DNA nanotube preparations were then added to RAW 264.7 cells. Untreated cells served as a control group and were cultured for 24 hours. After rinsing with PBS, 1 μg mL-1 LPS was added and cultured for 6 hours. Untreated cells and cells treated with LPS alone served as controls. After washing three times with PBS, RNA was extracted using TRIzol reagent. Real-time quantitative PCR was then used to measure the mRNA expression levels of the pro-inflammatory cytokines IL-1β, IL-6, and p65 in RAW264.7 cells under different conditions. The primer sequences for GAPDH, IL-1β, IL-6, and p65 are as follows: GAPDH: Forward: AGGTCGGTGTGAACGGATTTG (SEQ ID NO: 6), Reverse: GGGGTCGTTGATGGCAACA (SEQ ID NO:7); IL-1β: Forward: TCGCAGCAAAGATCCACACAG (SEQ ID NO:8), Reverse: ATCTTTTGGGGTCCGTC AACT (SEQ ID NO:9); IL-6: Forward: CTCCCAACAGACCTGTCTATAC (SEQ ID NO:10), Reverse: CCATTGCACAACTCTTTTCCA (SEQ ID NO:11); p65: Forward: AGGCTTCTGGGCCTTATGTG (SEQ ID NO:12), Reverse: TGCTTCTCTCGCCAGGAATAC (SEQ ID NO: 13).

[0026] The results show (such as Figure 7 As the aggregate size increases, the anti-inflammatory effect increases. However, there is no significant difference in the anti-inflammatory effects between octa-arginine and tri-arginine. Adding p65 siRNA can downregulate p65 mRNA expression, further synergizing with tri-arginine to reduce pro-inflammatory cytokines.

[0027] Example 7 Study on the biodistribution of polyarginine-DNA nanotubes in mice 50 μL LPS (5 mg / kg) was injected into anesthetized mice via the trachea. 2 hours later, tri-arginine-DNA nanotube preparations loaded with p65 siRNA (the concentrations of injected tri-arginine and p65 siRNA were 3.6 mg / kg and 2.5 mg / kg, respectively) were injected into the mice via the trachea. At 0.5 h, 1 h, 3 h, 6 h, 12 h, and 24 h, four parallel samples were collected from each group. The heart, liver, spleen, lung, kidney and other major organs of the mice were collected, and a multi-mode animal in vivo imaging system was used to image various tissues and organs, focusing on the distribution of the nanotube preparations in the lungs. Imaging results (such as Figure 8 ) showed that the distribution content of tri-arginine-DNA nanotube preparation loaded with p65siRNA was the highest in lung tissue. At the same time, the nanotube preparation stayed in lung tissue for more than 24 hours, which was conducive to the effect of nanomedicine in the lung.

[0028] Example 8 Study on the effect of polyarginine-DNA nanotubes in treating acute lung injury in mice. The mice were randomly divided into 6 groups, namely PBS group, LPS group, TAE-Mg group 2+ Mediating DNA nanotube formation, TAE-Mg 2+Anesthetized mice were treated with the following: the mediated DNA nanotube group (loaded with p65 siRNA), the tri-arginine-DNA nanotube group, and the tri-arginine-DNA nanotube group (loaded with p65 siRNA). 50 μL of LPS (5 mg / kg) was injected intratracheally into the anesthetized mice (the PBS group was not injected with LPS). Two hours later, PBS and the aforementioned preparations were injected into the tail vein of the mice. Twenty-four hours later, under anesthesia, a cannula was inserted into the trachea of ​​the mice. Ventilatory function was assessed using the flexiVent FX system and analyzed using flexiWarev 7.2 software.

[0029] The mice were randomly divided into 6 groups, namely PBS group, LPS group, TAE-Mg group 2+ Mediating DNA nanotube formation, TAE-Mg 2+ Mediated DNA nanotube group (loaded with p65 siRNA), tri-arginine-DNA nanotube group, tri-arginine-DNA nanotube group (loaded with p65 siRNA). 50 μL LPS (5 mg / kg) was injected into the anesthetized mice through the trachea (the PBS group was not injected with LPS). 2 hours later, PBS and the above preparations were injected into the mice of their respective groups through the tail vein. 24 hours later, the lung tissues of the mice in each group were collected and fixed in 4% paraformaldehyde for 24 hours. After embedding and sectioning, HE staining analysis was performed. The results showed (as shown in Figure 9 ) The tri-arginine-DNA nanotube group (loaded with p65 siRNA) significantly alleviated lung pathological damage.

[0030] The mice were randomly divided into 6 groups, namely PBS group, LPS group, TAE-Mg group 2+ Mediating DNA nanotube formation, TAE-Mg 2+ Mediated DNA nanotube group (loaded with p65 siRNA), tri-arginine-DNA nanotube group, tri-arginine-DNA nanotube group (loaded with p65 siRNA). 50 μL LPS (5 mg / kg) was injected into the anesthetized mice through the trachea (the PBS group was not injected with LPS). 2 hours later, PBS and the above-mentioned preparations were injected into the mice of their respective groups through the tail vein. After 24 hours, the weight of the collected lung tissues of the mice in each group was weighed, and then heated in an oven at 60 ° C for 3 hours. The dried lung tissues were weighed, and the ratio of wet weight to dry weight can be used as an indicator to evaluate the edema of the mouse lung tissue. The results showed (such as Figure 9 G) In the tri-arginine-DNA nanotube group (loaded with p65 siRNA), the ratio of wet weight to dry weight was significantly decreased, indicating that the lung exudation was alleviated.

[0031] To collect alveolar lavage fluid from the mouse lungs, a tracheal intubation needle was inserted into the mouse trachea, and then 500 μL of pre-cooled PBS solution was injected into the mouse trachea. The lungs were gently pressed to withdraw the alveolar lavage fluid. The alveolar lavage fluid was centrifuged, and the supernatant was taken. The protein concentration in the alveolar lavage fluid was detected using the BCA method. The levels of inflammatory factors IL-1β and IL-6 in the alveolar lavage fluid were detected using an ELISA kit. The results showed (as shown in Figure 2). Figure 9 A, B) In the tri-arginine-DNA nanotube group (loaded with p65 siRNA), inflammatory factors were significantly downregulated, indicating that it alleviated lung inflammation.

[0032] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions, which should all be included in the scope of the claims of the present invention.

Claims

1. A polyarginine-DNA nanotube material, characterized by: The nanotube material is assembled from four DNA single strands under the induction of polyarginine, and the nucleic acid sequences of the four DNA single strands: Y1, Y2, Y3, and Y4 are SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, respectively; the molar ratio of the four DNA single strands: Y1, Y2, Y3, and Y4 is 1:3:3:3, and the polyarginine forms any one of a dimer, a trimer, or an octamer.

2. The method for preparing the polyarginine-DNA nanotube material according to claim 1, characterized in that: The steps are as follows: S1: Prepare aqueous solutions of Y1, Y2, Y3, and Y4; S2: Y1, Y2, Y3, and Y4 are complementary paired in a polyarginine solution at a molar concentration ratio of 1:3:3:3, and the polyarginine-DNA nanotube material is prepared after gradient annealing and / or constant temperature annealing.

3. The method for preparing the polyarginine-DNA nanotube material according to claim 2, wherein: The gradient annealing program was as follows: 95°C for 5 min, 65°C for 30 min, 50°C for 30 min, 37°C for 30 min, and finally 22°C for 30 min. The constant temperature annealing procedure is: the single-stranded DNA solution is kept at a constant temperature of 37° C. or 45° C. for 30-90 min, the DNA solution is mixed, and then kept at the same constant temperature of 37° C. or 45° C. for 30-90 min.

4. The method for preparing the polyarginine-DNA nanotube material according to claim 2, wherein: The polymerization degrees of the polyarginine are dimerization, trimerization and octamerization, respectively. The concentration of the dimerization arginine is 100 μM-50 mM, the concentration of the trimerization arginine is 1 μM-1 mM, and the concentration of the octaarginine is 100 μM-10 μM.

5. Use of the polyarginine-DNA nanotube material according to claim 1 in preparing a drug delivery material.

6. Use of the polyarginine-DNA nanotube material according to claim 1 in preparing a pharmaceutical preparation for treating pulmonary inflammation.

7. A pharmaceutical preparation for treating pulmonary inflammation, characterized in that: The pharmaceutical preparation comprises the polyarginine-DNA nanotube material according to claim 1, and further comprises p65 siRNA, and the molar ratio of Y1, Y2, Y3, Y4 to p65 siRNA is 1:3:3:3:

3.

8. The pharmaceutical preparation for treating lung inflammation according to claim 7, wherein The nucleic acid sequence of the p65 siRNA is shown in SEQ ID NO: 5.

Images