Use of kaempferol in promoting gene editing

Abstract

The application discloses an application of kaempferol in promoting gene editing and belongs to the field of biological medicines. The application specifically comprises kaempferol as a promoter of CRISPR gene editing and the application of kaempferol in preparing non-virus site-specific integration CAR T cells. It is found that kaempferol can significantly increase the efficiency of CRISPR gene editing, and it is found through cell experiments that kaempferol has a significant promoting effect on the positive rate of CAR T cells after electrotransformation, and greatly improves the tumor killing function of T cells.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biological medicine, and relates to application of kaempferol in promoting gene editing, in particular, to use of kaempferol in preparation of CAR T drugs for treating cancer-related diseases. BACKGROUND

[0002] CAR T (chimeric antigen receptor T) immune cell therapy is a T cell activated by gene engineering technology, which is equipped with a navigation device CAR to specifically recognize disease cells with a specific target antigen. Compared with traditional chemotherapy or targeted therapy, CAR T therapy avoids long-term drug treatment, and is customized according to the patient's own cells, reducing the risk of immune rejection. However, so far, CAR T cell therapy is still limited to the dependence on the introduction of CAR into T cells by viral vectors. Although viral vectors are effective, they can cause gene insertion mutations, increase the risk of tumorigenesis, and are limited in the treatment of autoimmune diseases. In addition, the manufacturing process of clinical-grade viral vectors is complex and the yield is low, which greatly limits the accessibility of CAR T cell treatment drugs.

[0003] Non-viral CAR T cell engineering, such as CRISPR / Cas9 gene editing and the use of Sleeping Beauty transposon, provides a promising alternative that can improve the accessibility and efficiency of CAR T cell therapy. In particular, the CRISPR / Cas9 gene editing technology has the characteristics of precision, high efficiency and flexibility, which can not only reduce the risk of random insertion, but also can knock out the genes of interest at the same time. The Cas9 / sgRNA complex (RNP) and donor DNA are introduced into T cells by electroporation, and the cell genome is modified by homologous directed repair (HDR). Compared with double-stranded DNA and single-stranded DNA, plasmid DNA is easy to prepare and low in price, and is suitable for GMP (Good Manufacturing Practice, drug production quality management standard) production for large-scale clinical application. However, the plasmid structure is complex and the molecular weight is large, which has high toxicity to T cells. The activity of T cells after plasmid electroporation is less than 20%, and due to the low HDR efficiency, the final CAR positive rate is only about 10%, which is difficult to meet the standard of batch production for clinical treatment. Therefore, it is of great significance to find a compound that can improve the activity and CAR positive rate of CAR T cells after plasmid electroporation for non-viral site-specific integration of CAR T cells.

[0004] Kaempferol (KP) is a natural flavonoid compound, which is widely present in plants, and has various biological activities, such as protecting cells from oxidative damage, inducing apoptosis of cancer cells, and inhibiting expression of pro-inflammatory factors. Studies have shown that kaempferol has the potential to inhibit the catalytic subunit of DNA-dependent kinase (DNA-PKcs), which is the core component of non-homologous end joining, and the repair pathway of DNA double-strand breaks includes non-homologous end joining and HDR; kaempferol may promote DNA repair of the HDR pathway by causing cells to be arrested in the G2 / M phase of the cell cycle. SUMMARY

[0005] The purpose of the present application is to overcome the shortcomings of the prior art, provide the application of kaempferol in promoting gene editing, and solve the problems of low cell yield and low integration efficiency caused by plasmid DNA electroporation into T cells during the preparation of CAR T cells.

[0006] To achieve the above-mentioned purpose, the technical scheme adopted by the present application is:

[0007] In a first aspect, the present application provides the application of kaempferol in promoting gene editing, and the application is specifically: a promoter for the preparation of CRISPR-based gene editing.

[0008] The CAS number of the compound is 520-18-3, and its chemical structural formula is as follows:

[0009] .

[0010] Further, the present application also finds that the CAR gene expression efficiency of electroporation transfected cells can be improved by using kaempferol, and is compared with the high-efficiency DNA-PK inhibitor AZD7648 which has been reported to enhance the CAR gene knock-in efficiency.

[0011] Further, the gene editing acts on eukaryotic cells, preferably immune cells, and more preferably human peripheral blood-derived T cells.

[0012] In a second aspect, the present application provides a method for preparing non-viral site-specific integration CAR T cells, comprising: co-transfecting CAR expression elements through plasmids and RNP to knock in T cells by homologous recombination, wherein kaempferol is added after the plasmids and RNP are introduced into T cells.

[0013] As a preferred embodiment of the present application, the final concentration of kaempferol is 1-5 μM, and more preferably 5 μM.

[0014] As a preferred embodiment of the present application, the method comprises the following steps:

[0015] (1) Prepare a 10 mM kaempferol stock solution;

[0016] (2) resuscitate, activate and cultivate PBMC cells to obtain expanded T cells;

[0017] (3) incubate Cas9 protein and sgRNA to form RNP complex, add plasmid mixture, and then add T cells resuspended in P3 electroporation buffer;

[0018] (4) transfer the obtained cell suspension to an electroporation cup, use Lonza 4D electroporation equipment to perform electroporation with EO115 program, and cultivate in a medium with a final concentration of 5 μM kaempferol;

[0019] (5) after 24 hours of kaempferol treatment, replace the fresh culture with 37℃, 5% CO2 incubator for continuous culture.

[0020] In one embodiment, the AAVS1 site of the CAR T cell genome is knocked in with an anti-HER2 CAR expression element, which can express an anti-HER2 chimeric antigen receptor.

[0021] In a third aspect, the present application provides a CAR T cell prepared by the method of the second aspect.

[0022] In a fourth aspect, the present application provides use of the CAR T cell of the third aspect in the preparation of a tumor treatment drug.

[0023] Further, the tumor at least includes ovarian cancer.

[0024] The beneficial effects of the present application are as follows:

[0025] The present application co-electrotransfers the donor plasmid and the RNP complex into T cells, avoids the use of viral vectors, simplifies the preparation process of CAR T cells, and improves the safety of CAR T cells. It is found that kaempferol can significantly increase the efficiency of CRISPR gene editing, and through cell experiments, it is found that kaempferol can significantly promote the positive rate of CAR T cells after electroporation, and can greatly improve the function of killing tumor cells and secreting cytokines of T cells. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 is a result graph of flow cytometry detection of the positive rate of each group of CARs in Example 1;

[0027] Figure 2 is a result graph of PCR amplification electrophoresis detection of the positive rate of each group of CARs in Example 1;

[0028] Figure 3 is a result graph of Example 3 in which chemiluminescence method is used to detect luciferase intensity and calculate killing efficiency; wherein, denotes a significant difference and p<0.01; denotes a significant difference and p<0.001;

[0029] Figure 4 Fig. 4 is a graph showing the results of measuring the concentration of the cytokine IFN-γ in each group in Example 4 by ELISA method; wherein, denotes a significant difference and p<0.001. DETAILED DESCRIPTION

[0030] The technical solutions in the embodiments of the present application will be clearly and completely described in combination with the drawings in the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by a person of ordinary skill in the art without creative labor fall within the scope of protection of the present application.

[0031] It should be noted that the features in the following embodiments and implementation manners can be combined with each other without conflict.

[0032] The experimental materials and methods used in the following examples are all conventional materials and methods unless otherwise specified.

[0033] Example 1: Effect of Kaempferol on CAR Knock-in T Cell Efficiency

[0034] Peripheral blood mononuclear cells (PBMCs) cultured in X-VIVO15 medium were activated by adding CD3 / CD28 Dynabeads magnetic beads (Thermo, Cat No. 11131D) at a ratio of 1:1, and T cells were collected after 2-3 days. 0.25 μg of Cas9 protein (Thermo, Cat No. A36499) and 50 pmol of AAVS1 sgRNA: AGAGCTAGCACAGACTAGAG (SEQ ID NO. 1) were incubated at room temperature for 10 min, and then 2 μg of the constructed anti-Her2 CAR plasmid was added and mixed. 20 μL of electroporation solution was used to resuspend 1x10 6 T cells, and the RNP plasmid mixture was added. The Lonza 4D-Nucleofector electroporator was used to select the EO115 program for electroporation, and 1% w / v PBS (PBS group), or 0.5 μM AZD7648 (AZD7648 group), or 5 μM kaempferol (kaempferol group) was added for 24 h, and the concentration was the final concentration. T cells without RNP and plasmid were set as the untreated control group.

[0035] After 5-7 days of electroporation, the cells were washed once with FACS buffer, incubated with PE-anti-G4S Linker antibody (diluted 1:20 v / v, Selleck, Cat# XY-Ab001-100T-PE) for 30 minutes, washed twice with FACS buffer, and then detected by flow cytometry for fluorescence intensity to obtain the CAR positive rate, as shown in Table 1.

[0036] After 5-7 days of electroporation, 5 x 10 5 T cells were centrifuged to remove the medium, and genomic DNA was extracted using a DNA extraction kit (Shanghai Biotech, Cat# B518251) according to the instructions. The specific upstream primer sequence for detecting the efficiency of knocking Her2-CAR expression elements into the AAVS1 site was AGAAAGGTGAAGAGCCAAAGTTAG (SEQ ID NO. 2), and the downstream primer sequence was GGAACTCTGCCCTCTAACGCTG (SEQ ID NO. 3). The primers (0.4 μM), 50 ng of DNA, and 1 x Phanta DNA polymerase mixture (Novagen, Cat# P525) were mixed to a final concentration, denatured at 95°C for 3 minutes, then cycled 35 times at 95°C for 30 seconds, 64°C for 15 seconds, and 72°C for 3 minutes, and finally extended at 72°C for 5 minutes to obtain the PCR product. 200 ng of the product was added to each well of a 1% (w / v) agarose gel and electrophoresed at 100 V for 45 minutes. The gel was imaged and the bands were analyzed to detect the Her2-CAR gene level, as shown in Table 2.

[0037] Table 1: Statistical table of the effect of kaempferol on T cell Her2 antibody expression

[0038]

[0039] Table 2: Statistical table of the effect of kaempferol on T cell Her2-CAR gene level

[0040]

[0041] The results showed that kaempferol can significantly increase the CAR positive rate, and the antibody expression is 2 times that of the PBS treatment group, while the positive control AZD7648 group is 2.5 times that of the PBS treatment group, as shown in Figure 1 . The Her2-CAR gene level of the kaempferol group is about 2 times that of the PBS group, and the AZD7648 group is about 3.4 times that of the PBS group, as shown in Figure 2 .

[0042] Example 2: Effect of kaempferol on T cell viability.

[0043] After T cells were electroporated with CAR plasmid (as in Example 1), 1% w / v PBS or 0.5 mM AZD7648 or 5 mM Kaempferol (final concentration) was added for 24h, and the number of viable cells was counted by trypan blue staining, and the T cell viability was calculated, as shown in Table 3. The medium was changed every two days, and the number of viable cells was counted by trypan blue staining after 6 days, as shown in Table 4.

[0044] Table 3: Statistical table of the effect of Kaempferol treatment for 24h on T cell viability

[0045]

[0046] Table 4: Statistical table of T cell number after Kaempferol treatment for 6 days

[0047]

[0048] The results show that Kaempferol has less effect on the number of viable cells than the highly selective inhibitor AZD7648, and the number of viable cells after Kaempferol treatment for 6 days is about 2 times that of the AZD7648 treatment group, and the number of CAR-positive viable cells is about 1.6 times that of the AZD7648 treatment group; after Kaempferol treatment for 6 days, the number of CAR-positive viable cells is about 1.7 times that of the PBS treatment group, as shown in Table 4.

[0049] Example 3: Effect of Kaempferol on the function of CAR T cells in killing ovarian cancer cells SK-OV-3

[0050] SK-OV-3 cells were plated 1 day in advance. 3 μg of pGL6-CMV-Luc plasmid was transfected into SK-OV-3 cells using jetPRIME transfection reagent (Polyplus, Cat#101000046). 20000 SK-OV-3 cells per well were seeded into 96-well plates. SK-OV-3 cells transfected with pGL6-CMV-Luc plasmid for 2 days were added to untreated control group, PBS group and kaempferol group T cells cultured for 10-14 days after electroporation at the ratio of 1:3, 1:1, 3:1 of effector cells to target cells (E:T) for 16 h. Substrate reagent (Admas, Cat#RA-GL05) was added and incubated at room temperature for 5 min. Chemiluminescence detection of luciferase intensity was performed using a microplate reader. The following controls were also prepared: only SK-OV-3 cells transfected with pGL6-CMV-Luc plasmid were seeded without T cells as a positive control for fluorescence intensity; SK-OV-3 cells transfected with pGL6-CMV-Luc plasmid were seeded with 2% w / v Tween-20 added as a negative control for fluorescence intensity. The killing efficiency of T cells was calculated as shown in Table 5, and the formula was: [(fluorescence intensity of positive control - fluorescence intensity of negative control) - (fluorescence intensity of experimental group - fluorescence intensity of negative control)] / (fluorescence intensity of positive control - fluorescence intensity of negative control) x 100%.

[0051] Table 5: Statistical table of the effect of kaempferol on CAR T cell killing efficiency of SK-OV-3 cells

[0052]

[0053] The results showed that CAR T cells treated with kaempferol had significantly increased function in killing tumor cells SK-OV-3 at the ratio of effector cells to target cells of 1:1 and 3:1, and the killing efficiency was increased by 70% and 50% compared with PBS treated CAR T cells, respectively, as shown in Figure 3 .

[0054] Example 4: Effect of kaempferol on CAR T cell secretion of cytokines.

[0055] SK-OV-3 cells were plated 1 day in advance. 3 μg of pGL6-CMV-Luc plasmid was transfected into SK-OV-3 cells using jetPRIME transfection reagent (Polyplus, Cat#101000046). 20000 SK-OV-3 cells per well were seeded into 96-well plates. SK-OV-3 cells transfected with pGL6-CMV-Luc plasmid for 2 days were added to untreated control group, PBS group and kaempferol group T cells cultured for 10-14 days after electroporation at the ratio of 1:3, 1:1, 3:1 of effector cells to target cells (E:T) for 16 h. Substrate reagent (Admas, Cat#RA-GL05) was added and incubated at room temperature for 5 min. Chemiluminescence detection of luciferase intensity was performed using a microplate reader. The following controls were also prepared: only SK-OV-3 cells transfected with pGL6-CMV-Luc plasmid were seeded without T cells as a positive control for fluorescence intensity; SK-OV-3 cells transfected with pGL6-CMV-Luc plasmid were seeded with 2% w / v Tween-20 added as a negative control for fluorescence intensity. The killing efficiency of T cells was calculated as shown in Table 5, and the formula was: [(fluorescence intensity of positive control - fluorescence intensity of negative control) - (fluorescence intensity of experimental group - fluorescence intensity of negative control)] / (fluorescence intensity of positive control - fluorescence intensity of negative control) x 100%.

[0056] Table 6: Summary of the effect of kaempferol on CAR T cytokine secretion

[0057]

[0058] The results show that, as shown in Table 6, the secretion level of IFN-γ was significantly increased (about 14 times of the PBS group) after the CAR T cells treated with kaempferol were co-cultured with SK-OV-3, see Figure 4 .

[0059] Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. It is intended that the specification and examples be considered as exemplary only. The application is intended to cover any variations, uses or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice in the art to which the application pertains or can relate. The specification and examples are to be regarded as illustrative only.

Claims

1. The application of kaempferol in promoting gene editing, characterized in that, The gene editing is based on homologous recombination knock-in genes, which act on immune cells; the specific application is for preparing a promoter of CRISPR-based homologous recombination knock-in genes; the final concentration of kaempferol is 5 μM.

2. A method for preparing non-viral site-specific integration CAR T cells, characterized in that, The CAR expression element was co-transfected with plasmid and RNP and knocked into T cells via homologous recombination. After the plasmid and RNP were introduced into the T cells, kaempferol was added to make the final concentration of kaempferol 5 μM.

3. The method according to claim 2, characterized in that, The method includes the following steps: Cas9 protein and sgRNA were incubated to form an RNP complex, which was then added to a plasmid and mixed. T cells resuspended in electroporation buffer were then added. The cell suspension was electroporated, and kaempferol was added to the culture medium at a final concentration of 5 μM. After 24 h of kaempferol treatment, the culture medium was changed and culture continued.

Images