Application of small molecule compound in preparation of product for inhibiting 3C-like cysteine protease

Abstract

The invention provides application of a small molecule compound in preparation of a product for inhibiting 3C-like cysteine protease, and belongs to the technical field of biological medicine. The small molecule compound is one or more of Gedatolisib, EGFR-IN-8, Akt inhibitor VIII, Bavlogalutamide, lifrafenib, TAM-IN-2, GSK1904529A and IKK 16, and the molecular weight of the small molecule compound is more than or equal to 100,000, the molecular weight of the small molecule compound is more than or equal to 100,000, the molecular weight of the small molecule compound is more than or equal to 100,000, the molecular weight of the small molecule compound is more than or equal to 100,000, and the molecular weight of the small molecule compound is more than or equal to 100,000. The small molecule compound provided by the invention has a remarkable inhibition effect on 3C-like cysteine protease, provides more choices for preparing a 3C-like cysteine protease inhibitor, and also provides a thought for developing antiviral drugs in the future.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to the use of a small molecule compound in the preparation of a product for inhibiting 3C-like cysteine ​​protease. Background Art

[0002] Human norovirus (Caliviridae, Norovirus genus) is the leading cause of acute gastroenteritis worldwide. It is estimated that norovirus is associated with a number of diarrheal cases worldwide each year. Severe cases can cause death in children, the elderly, and some immunocompromised patients. The rapid spread of norovirus is generally due to its low infectious dose, high genetic diversity, and short incubation period. Due to its high contagiousness, outbreaks in crowded places such as schools and hospitals pose a serious public health concern, necessitating the development of effective preventive and therapeutic agents.

[0003] The norovirus genus is subdivided into seven genogroups, G1 to GVII. Genotype 4 (GII.4) strains within genogroup II have been responsible for global outbreaks of human norovirus (HuNov) disease. The viral genome contains three open reading frames (ORFs). ORF1 encodes a nonstructural polyprotein that is cleaved into multiple nonstructural proteins, including the 3C-like cysteine ​​protease (3CLpro) and the viral RNA-dependent RNA polymerase (RdRp). Currently, there are no effective vaccines or selective drugs approved by the US Food and Drug Administration (FDA) for the treatment of norovirus.

[0004] Because polyprotein processing is crucial for viral replication, norovirus 3CLpro has been identified as a target for the discovery of small-molecule anti-norovirus drugs. 3CLpro has a chymotrypsin-like fold and is primarily composed of two domains: an N-terminal antiparallel β-sheet domain and a C-terminal β-barrel domain. Its catalytic site, His30 / Cys139 / Glu54, is located in a cleft between these two domains. Therefore, providing a small-molecule compound to inhibit norovirus 3CLpro is a pressing technical challenge. Summary of the Invention

[0005] In view of this, the object of the present invention is to provide an application of a small molecule compound in the preparation of a product for inhibiting 3C-like cysteine ​​proteases.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides an application of a small molecule compound in the preparation of a product for inhibiting 3C-like cysteine ​​proteases, wherein the small molecule compound is one or more of Gedatolisib, EGFR-IN-8, Akt inhibitor VIII, Bavdegalutamide, lifirafenib, TAM-IN-2, GSK1904529A and IKK 16.

[0008] Preferably, the 3C-like cysteine ​​protease is derived from norovirus.

[0009] Preferably, the IC values ​​of Gedatolisib, EGFR-IN-8, Akt inhibitor VIII, Bavdegalutamide, lifirafenib, TAM-IN-2, GSK1904529A and IKK 16 for 3C-like cysteine ​​proteases are 50 They were 0.06±0.01μM, 0.29±0.09μM, 0.59±0.12μM, 0.97±0.24μM, 1.02±1.23μM, 1.22±0.44μM, 3.94±0.23μM and 5.09±0.16μM respectively.

[0010] Preferably, the small molecule compound is Gedatolisib; the residue that Gedatolisib interacts with 3C-like cysteine ​​protease is Val82.

[0011] Preferably, the product comprises a medicine or a reagent.

[0012] The present invention provides a method for screening drugs for inhibiting 3C-like cysteine ​​proteases, comprising the following steps:

[0013] Detect whether the test drug binds to the catalytic site in 3C-like cysteine ​​protease, wherein the catalytic site is one or more of Val82, Asn165, Arg100, Ser125 and Met130.

[0014] Preferably, if the test drug binds to the catalytic site in 3C-like cysteine ​​protease, it indicates that the test drug inhibits 3C-like cysteine ​​protease;

[0015] If the test drug does not bind to the catalytic site in 3C-like cysteine ​​protease, it indicates that the test drug has no effect of inhibiting 3C-like cysteine ​​protease.

[0016] The present invention provides a drug for inhibiting 3C-like cysteine ​​protease, comprising the above-mentioned small molecule compound and pharmaceutically acceptable excipients.

[0017] The present invention provides a method for screening antiviral drugs, comprising the following steps: performing mixed incubation treatment on viruses using the above-mentioned small molecule compounds.

[0018] Preferably, the virus is norovirus.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention provides an application of a small molecule compound in the preparation of a product for inhibiting 3C-like cysteine ​​proteases. The small molecule compound of the present invention has a significant inhibitory effect on 3C-like cysteine ​​proteases, providing a new option for the preparation of 3C-like cysteine ​​protease inhibitors, and also providing a new idea for the future development of antiviral drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Development of the FlipGFP-3CLpro detection method. A is a schematic diagram of the FlipGFP-3CLpro gene structure; B is a schematic diagram of the FlipGFP-3CLpro detection principle; C is a fluorescence image of HEK293T cells expressing FlipGFP-3CLpro and mutant 3CLpro (C139A) or expressing FlipGFP-3CLpro and wild-type 3CLpro; D is quantification of fluorescence intensity using a high-content cell imaging system; E is a dose-response curve of GC376's inhibitory effect on 3CLpro using the FlipGFP-3CLpro detection method; error bars represent mean ± standard deviation (n = 3), and statistical significance was assessed using a two-sided unpaired Welcht test: ***P ≤ 0.001;

[0022] Figure 2 The structures of 8 hit compounds in the FlipGFP assay and their IC values ​​for their effects on 3CLpro activity 50 Curve A is the structure of the Gedatolisib compound and its IC value for 3CLpro activity 50 Curve B is the structure of EGFR-IN-8 compound and its IC value for 3CLpro activity 50 Curve; C is the structure of Akt inhibitor VIII compound and its IC value for 3CLpro activity 50 Curve; D is the structure of Bavdegalutamide compound and IC activity against 3CLpro 50 Curve; E is the structure of Lifirafenib compound and IC activity against 3CLpro 50 Curve; F is the structure of TAM-IN-2 compound and its IC activity against 3CLpro 50Curve; G is the structure of GSK1904529A compound and its IC value for 3CLpro activity 50 Curve; H is the structure of IKK16 compound and IC of 3CLpro activity 50 curve;

[0023] Figure 3 The structures of 9 other compounds and their IC values ​​for their effects on 3CLpro activity were tested for FlipGFP. 50 Curve A is the structure of Bemcentinib compound and its IC activity against 3CLpro 50 Curve B is the structure of NX-2127 compound and its IC value for 3CLpro activity 50 Curve; C is the structure of MT-802 compound and its IC activity against 3CLpro 50 Curve; D is the structure of XL177A compound and its IC activity against 3CLpro 50 Curve; E is the structure of Rifalazil compound and IC activity against 3CLpro 50 Curve; F is the structure of SC75741 compound and its IC activity against 3CLpro 50 Curve; G is the structure of NPX800 compound and its IC value for 3CLpro activity 50 Curve; H is the structure of MS4078 compound and its IC value for 3CLpro activity 50 Curve I is the structure of compound XY028-140 and its IC value for 3CLpro activity 50 curve;

[0024] Figure 4Figure 1 shows the structural interactions of 8 hit compounds with 3CLpro. A is the 3D visualization of the complex of norovirus 3CLpro and Gedatolisib, highlighting the key interacting residues. B is the 3D visualization of the complex of norovirus 3CLpro and EGFR-IN-8, highlighting the key interacting residues. C is the 3D visualization of the complex of norovirus 3CLpro and Aktinhibitor VIII, highlighting the key interacting residues. D is the 3D visualization of the complex of norovirus 3CLpro and Bavdegalutamide, highlighting the key interacting residues. E is the 3D visualization of the complex of norovirus 3CLpro and Lifirafenib, highlighting the key interacting residues. F is the 3D visualization of the complex of norovirus 3CLpro and TAM-IN-2, highlighting the key interacting residues. G is the 3D visualization of the complex of norovirus 3CLpro and GSK1904529A, highlighting the key interacting residues. H is the 3D visualization of the complex of norovirus 3CLpro and IKK 16, highlighting the key interacting residues.

[0025] Figure 5 Molecular dynamics simulations of eight hit compound-3CLpro complexes. A is the RMSD plot showing the stable trajectories of all eight complexes within 100 ns; B is the Rg plot indicating the compactness of the eight complexes; C is the RMSF plot highlighting the elastic regions, especially residues 165-180 and 345-355; D is the SASA plot showing the stability of the eight complexes during the simulation. DETAILED DESCRIPTION

[0026] The present invention adopts a FlipGFP method to screen potential protease inhibitors of norovirus 3CLpro, wherein the gene structure of FlipGFP of norovirus 3CLpro is composed of: β10-E5-β11-Noro-NSP5 cleavage recognition sequence-K5-T2A-β1-9, named FlipGFP-3CLpro gene, and the gene sequence of FlipGFP of norovirus 3CLpro is shown in SEQ ID NO.1. Among them, green fluorescent protein (GFP) is divided into 11 β-sheets, of which β1-9 form a β-barrel structure, and β10-11 is separated from it. To screen potential 3CLpro protease inhibitors, an amino acid sequence with high cleavage efficiency was selected, and a norovirus 3CLpro-specific recognition cleavage sequence was inserted in the middle of GFP and connected to the heterodimeric coiled coil E5 and heterodimeric coiled coil K5, respectively. Among them, the norovirus 3CLpro-specific recognition cleavage sequence is the Noro-NSP5 cleavage recognition sequence, and the amino acid sequence of the Noro-NSP5 cleavage recognition sequence is DYELQ / GPEDL, and the " / " indicates the cleavage site of norovirus 3CLpro. In the presence of norovirus 3CLpro, the Noro-NSP5 cleavage recognition sequence can be cleaved, allowing β10-11 to be antiparallel and bind to the β1-9 barrel structure, allowing the fluorescent protein to be correctly assembled and expressed, and the fluorescence intensity to be restored.

[0027] Therefore, the above method was used to screen 166 compounds from 58,836 compounds. These 166 compounds reached a very good binding threshold of -10 kcal / mol with norovirus 3CLpro, and 17 compounds among the top 20 compounds with Max Affinity scores were selected for verification. The results confirmed that only 8 hit compounds could significantly inhibit 3C-like cysteine ​​protease.

[0028] The present invention provides an application of a small molecule compound in the preparation of a product for inhibiting 3C-like cysteine ​​proteases, wherein the small molecule compound is one or more of Gedatolisib, EGFR-IN-8, Akt inhibitor VIII, Bavdegalutamide, lifirafenib, TAM-IN-2, GSK1904529A and IKK 16.

[0029] In the present invention, the 3C-like cysteine ​​protease is derived from norovirus, i.e., the 3C-like cysteine ​​protease of norovirus. The IC values ​​of Gedatolisib, EGFR-IN-8, Akt inhibitor VIII, Bavdegalutamide, lifirafenib, TAM-IN-2, GSK1904529A and IKK 16 for inhibiting 3C-like cysteine ​​protease are as follows: 50 The values ​​were 0.06±0.01μM, 0.29±0.09μM, 0.59±0.12μM, 0.97±0.24μM, 1.02±1.23μM, 1.22±0.44μM, 3.94±0.23μM and 5.09±0.16μM, respectively. Among them, Gedatolisib had the most significant inhibitory activity against 3C-like cysteine ​​proteases.

[0030] The present invention further studies the mechanism of action of Gedatolisib, EGFR-IN-8, Akt inhibitor VIII, Bavdegalutamide, lifirafenib, TAM-IN-2, GSK1904529A and IKK 16 with 3C-like cysteine ​​proteases, and the results show that the residue interacting between Gedatolisib and 3C-like cysteine ​​proteases is Val82; the residues interacting between Bavdegalutamide and 3C-like cysteine ​​proteases are Thr81, Val82, Asn165 and Thr166; the residues interacting between lifirafenib and 3C-like cysteine ​​proteases are Val82, Arg100, Ser125 and Met130; the residues interacting between TAM-IN-2 and 3C-like cysteine ​​proteases are Thr84, Arg100, Ser125 and Met130; and the residues interacting between IKK The residues interacting with 16 and 3C-like cysteine ​​proteases are Thr103; the residues interacting with GSK1904529A and 3C-like cysteine ​​proteases are Arg100, Gly124, Ser125, Asn126, and Met130; the residues interacting with EGFR-IN-8 and 3C-like cysteine ​​proteases are Glu79 and Asn165; and the residues interacting with Akt inhibitor VIII and 3C-like cysteine ​​proteases are Gly119 and Thr166. Through the above-mentioned mechanism studies, the present invention provides research ideas and assistance for drug design and drug reuse for the treatment of norovirus.

[0031] As a preferred embodiment, the small molecule compound is Gedatolisib, and the residue that Gedatolisib interacts with 3C-like cysteine ​​proteases is Val82. The product includes a drug or a reagent.

[0032] The present invention provides a method for screening drugs for inhibiting 3C-like cysteine ​​proteases, comprising the following steps:

[0033] Detect whether the test drug binds to the catalytic site in 3C-like cysteine ​​protease, wherein the catalytic site is one or more of Val82, Asn165, Arg100, Ser125 and Met130.

[0034] In the present invention, if the test drug binds to the catalytic site of the 3C-like cysteine ​​protease, it indicates that the test drug inhibits the 3C-like cysteine ​​protease; if the test drug does not bind to the catalytic site of the 3C-like cysteine ​​protease, it indicates that the test drug has no inhibitory effect on the 3C-like cysteine ​​protease. The binding refers to hydrogen bonding, that is, detecting whether the test drug forms a hydrogen bond with the catalytic site of the 3C-like cysteine ​​protease.

[0035] The present invention provides a drug for inhibiting 3C-like cysteine ​​protease, comprising the above-mentioned small molecule compound and pharmaceutically acceptable excipients.

[0036] In the present invention, the small molecule compound comprises 50% to 90% by mass of the product (e.g., a drug). The product (e.g., a drug) uses the small molecule compound as the active molecule for inhibiting 3C-like cysteine ​​proteases. It can also be used in combination with other compounds that inhibit 3C-like cysteine ​​proteases for inhibiting 3C-like cysteine ​​proteases. The product preferably uses the small molecule compound as the sole active molecule. Excipients include flavoring agents, excipients, antioxidants, or preservatives.

[0037] The present invention provides a method for screening antiviral drugs, comprising the following steps: incubating a virus with the aforementioned small molecule compound. In this method, if the small molecule compound exhibits significant inhibitory activity against the virus, the drug is considered an antiviral drug. The small molecule compound is one or more of Gedatolisib, EGFR-IN-8, Akt inhibitor VIII, Bavdegalutamide, lifirafenib, TAM-IN-2, GSK1904529A, and IKK 16. The virus is preferably norovirus.

[0038] In the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.

[0039] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0040] In the following examples, the sequence of Norovirus 3CLpro is referred to the base sequence at positions 3029-3571 in NCBI No. KP784698.1.

[0041] Preparation of a norovirus-3CLpro plasmid involves cloning the norovirus 3CLpro sequence (see NCBI No. KP784698.1, base sequence 3029-3571) into pCMV-myc between EcoRI and NotI to obtain a norovirus-3CLpro-containing plasmid, extracting the target protein, and performing Sanger sequencing verification. Sequencing was commissioned by Beijing Nosai Genomics Research Center Co., Ltd. to confirm the successful preparation of the norovirus-3CLpro-containing plasmid (see NCBI No. KP784698.1, base sequence 3029-3571). pCMV-myc was purchased from Changsha Abiwei Biotechnology Co., Ltd., catalog number HG-VPC0050.

[0042] The preparation of the mutant C139A plasmid includes: using a norovirus-3CLpro plasmid as a template, using a point mutagenesis kit (Novozymes, catalog number: C216-01) to construct a catalytically inactive C139A mutant, i.e., a plasmid containing the mutant C139A, and extracting the target protein, performing Sanger sequencing verification, and entrusting Beijing Nosai Genomics Research Center Co., Ltd. to sequence and verify the successful preparation of the mutant C139A. The nucleotide sequence of the catalytically inactive mutant C139A of norovirus-3CLpro is:

[0043] (SEQ ID NO. 2).

[0044] The preparation of the FlipGFP-3CLpro plasmid includes: cloning the FlipGFP-3CLpro gene sequence into the pFlag-CMV2 (purchased from Changsha Abiwei Biotechnology Co., Ltd., product number: HG-VPS0053) backbone plasmid between EcoRI and XbaI to obtain a plasmid containing FlipGFP-3CLpro, extracting the target protein, performing Sanger sequencing verification, and entrusting Beijing Nosai Genomics Research Center Co., Ltd. to sequence and prove that the FlipGFP-3CLpro plasmid was successfully prepared (the sequenced FlipGFP-3CLpro sequence is shown in SEQ ID NO.1).

[0045] Example 1

[0046] 1.1. Norovirus 3CLpro is a target for anti-norovirus small molecule drugs. This example uses a FlipGFP method to screen for potential norovirus 3CLpro protease inhibitors. The steps are as follows:

[0047] like Figure 1As shown in A, the gene structure of FlipGFP of Norovirus 3CLpro is composed of: β10-E5-β11-Noro-NSP5 cleavage recognition sequence-K5-T2A-β1-9, named FlipGFP-3CLpro gene.

[0048] The nucleotide sequence of the FlipGFP-3CLpro gene is as follows:

[0049] atggacctgcctgacgaccactacctgtccacccagacccatcctgtccaaggacctgaactccggactcagatctg

[0050] gcagcggtctcgagatggaagttagcgctctggaaaaagaagtgtctgcactagagaaagaagtaagtgcccttgagaa

[0051] ggaggtgtccgcactagagaaggaggtcagcgccctggaaaaggaaaagcgagaccatatggttttgcttgagtatgtta

[0052] cagcggctggcattaccgatgcatcagactacgagctacaaggacctgaggaccttaaggtgtccgccctgaaggaaaa

[0053] agtaagcgcactgaaagaaaaggtgagcgcgctgaaggagaaagtgagcgccctgaaagagaaagtctctgcccttaa

[0054] ggaggatatcgagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctggcccaaagcttgccaccat

[0055] gcgcaaaggcgaagaactgtttaccggcattgtgccgattctggtggaactggatggcgatgtgaacggccataaatttttt

[0056] gtgcgcggcgaaggcgaaggcgatgcgaccattggcaaactgagcctgaaatttatttgcaccaccggcaaactgccgg

[0057] tgccgtggccgaccctggtgaccaccctgacctatggcgtgcagtgctttagccgctatccggatcatatgaaacgccatg

[0058] atttttttaaaagcgcgatgccggaaggctatgtgcaggaacgcaccatttattttaaagatgatggcacctataaaacccgc

[0059] gcggaagtgaaatttgaaggcgataccctggtgaaccgcattgaactgaaaggcattgattttaaagaagatggcaacatt

[0060] ctgggccataaactggaatataactttaacagccataaagtgtatattaccgcggataaacagaacaacggcattaaagcg

[0061] aactttaccattcgccataacgtggaagatggcagcgtgcagctggcggatcattatcagcagaacaccccgattggcgat

[0062] ggcccggttcttcttcct (SEQ ID NO. 1).

[0063] Among them, in the sequence shown in SEQ ID NO.1, positions 1 to 60 are the nucleotide sequence of β10, positions 61 to 90 are the nucleotide sequence of linker, positions 91 to 198 are the nucleotide sequence of E5, positions 199 to 261 are the nucleotide sequence of β11, positions 262 to 291 are the Noro-NSP5 cleavage recognition sequence, positions 292 to 396 are the K5 nucleotide sequence, positions 403 to 456 are the T2A nucleotide sequence, and positions 469 to 1056 are the nucleotide sequence of β1-9.

[0064] like Figure 1As shown in Figure B, green fluorescent protein (GFP) is divided into 11 β-sheets, of which β1-9 form a β-barrel structure, from which β10-11 is separated. To screen for potential 3CLpro protease inhibitors, an amino acid sequence with high cleavage efficiency was selected. A norovirus 3CLpro-specific recognition cleavage sequence was inserted into the middle of GFP and linked to the heterodimeric coiled-coil E5 and heterodimeric coiled-coil K5, respectively. The norovirus 3CLpro-specific recognition cleavage sequence is the Noro-NSP5 cleavage recognition sequence, and the amino acid sequence of the Noro-NSP5 cleavage recognition sequence is DYELQ / GPEDL, with " / " indicating the cleavage site of norovirus 3CLpro. In the presence of norovirus 3CLpro, the Noro-NSP5 cleavage recognition sequence can be cleaved, allowing β10-11 to bind antiparallel to the β1-9 barrel structure, allowing the fluorescent protein to be correctly assembled and expressed, and the fluorescence intensity to be restored.

[0065] like Figure 1 As shown in B, after the protease inhibitor was added, the fluorescence intensity gradually returned to the initial level.

[0066] HEK293T cells were then transfected with FLIPGFP-3CLpro fluorescent protein and norovirus-3CLpro as the experimental group (referred to as 3CLpro(WT)). Meanwhile, cells were co-transfected with FLIPGFP-3CLpro fluorescent protein and the catalytically inactive mutant C139A of norovirus-3CLpro (referred to as mutant C139A) as the control group (referred to as 3CLpro(C139A)). The method is as follows:

[0067] Control transfection: Human embryonic kidney cells (HEK293T, ATCC: CRL-11268) were cultured in Dulbecco's Modified Eagle's Medium (DMEM; 12491015, gbico) supplemented with 10% (v / v) fetal bovine serum (FBS; FSP500, ExCell) in a cell culture incubator containing 5% CO2 at 37°C. Cell number and viability were quantified using an automated cell counter (TC20TM, Bio-Rad). Transfection experiments were then performed. 24 hours prior to transfection, 1.5 × 10 cells were plated per well. 5 Cells were seeded into 24-well plates at a density of 100 cells / well. The transfection mixture per well consisted of 250 ng of the FLIPGFP-3CLpro plasmid and 250 ng of the C139A mutant plasmid, dissolved in 50 μL of serum-free DMEM with 1500 ng of polyethyleneimine. After incubating the transfection mixture at room temperature for 20 minutes, the mixture was added dropwise to the cells and incubated for an additional 6 hours.

[0068] The transfection method of the experimental group was the same as that of the control group, with the following differences: the transfection mixture in each well of the 24-well plate of the experimental group consisted of 250 ng of FLIPGFP-3CLpro plasmid and 250 ng of norovirus-3CLpro plasmid.

[0069] from Figure 1 As shown in Figure C, only in the presence of FLIPGFP-3CLpro and the mutant C139A, the specific sequence cannot be cleaved, resulting in weak or even no fluorescence of the fluorescent protein. In the presence of norovirus-3CLpro, the fluorescent protein is correctly expressed, producing strong fluorescence. This demonstrates that it is the norovirus-3CLpro protease, not the mutant C139A, that recognizes and cleaves the inserted amino acid sequence.

[0070] The fluorescence intensity was then detected and analyzed using a high-content cell imaging system.

[0071] Figure 1 The results in Figure D showed that there was a significant difference in the increase in fluorescence intensity after the addition of norovirus-3CLpro compared with the control group, which was consistent with the fluorescence graph results.

[0072] The inhibitory effect of GC376 on 3CLpro was determined using the FlipGFP assay using a known protease inhibitor of norovirus 3CLpro: human embryonic kidney cells (HEK293T, ATCC: CRL-11268) were cultured in Dulbecco's Modified Eagle's Medium (DMEM; 12491015, gbico) supplemented with 10% (v / v) fetal bovine serum (FBS; FSP500, ExCell) in a cell culture incubator containing 5% CO2 and a temperature of 37°C. Cell number and viability were quantified using an automated cell counter (TC20TM, Bio-Rad). Transfection experiments were then performed, with 1.5 × 10 cells per well 24 hours before transfection. 5 HEK293T cells were seeded into 24-well plates at a density of 10 cells / well to obtain cultured HEK293T cells. The transfection mixture per well of the 24-well plate consisted of 250 ng of the FLIPGFP-3CLpro plasmid, 250 ng of the norovirus-3CLpro plasmid, and 1500 ng of polyethyleneimine dissolved in 50 μL of FBS-free DMEM. After incubation at room temperature for 20 minutes, the transfection mixture was added dropwise to the cultured HEK293T cells and incubated for an additional 6 hours. Compound GC376 was then added at final concentrations of 0.01, 0.1, 1, 10, 50, and 100 μM, respectively. After transfection continued for 18 hours, fluorescence intensity was analyzed using a high-content cytometry system.

[0073] Figure 1 The results in Figure E showed that GC376 could inhibit 3CLpro using the FlipGFP assay. The IC 50 The protein level of GC376 was 2.28±0.17 μM, which was consistent with the reported level of GC376 inhibiting norovirus 3CLpro protease, indicating that the FlipGFP method can successfully screen potential norovirus 3CLpro protease inhibitors.

[0074] 1.2. Screening of protease inhibitors

[0075] 1.2.1 Molecular docking

[0076] In order to obtain the protease structure as a molecular docking target, the NV-3CLPro model was downloaded from the PDB library. 58,836 compounds were combined into a total compound library for molecular docking. Afterwards, the files of these compound libraries were extracted and the compounds were converted into pdbqt format using OpenBabel. The downloaded NV 3CLPro crystal structure file (PDB number of 3CLpro is 8U1V) was then used to set up the Vina docking box for the target and perform docking. To improve the accuracy of the final screening results, AutoDockVina software was used to continuously adjust the docking parameters (exhaustiveness = 1, 8, 16) for a total of three screenings. The first high-throughput screening aimed to quickly screen out potential compounds that interact with the target protein. The high efficiency of AutodockVina high-throughput screening made it possible to perform preliminary screening in large-scale data sets. Based on the MaxAffinity score, a total of 30,688 small molecule compounds were successfully screened from the total compound library.

[0077] Small molecule compounds with the top 10% MaxAffinity values ​​from the first high-throughput screening were selected for the second round of virtual screening. Building on this initial high-throughput screening, Vina's docking accuracy was further improved to more effectively identify compounds with excellent stability and strong affinity, ultimately identifying 3,031 compounds with strong affinity. In the final refinement screening step, small molecule compounds with the top 10% MaxAffinity values ​​from the second screening were selected and subjected to refined molecular docking using NeuralPlexer. This final round of screening ultimately identified 303 small molecule compounds. Based on AutoDock Vina's four-step scoring scale, the first is very good binding (high affinity binding), with a score of -10 kcal / mol or lower; good affinity binding, typically between -7 and greater than -10 kcal / mol; moderate affinity binding, typically between -5 and -7 kcal / mol; and weak affinity binding, typically greater than -5 kcal / mol. The final results of the 303 AutodockVina refined screenings conducted in this study showed that 166 compounds achieved a very good binding threshold of -10 kcal / mol with the bait protein. In particular, Bavdegalutamide achieved a very good binding threshold of over -12 kcal / mol with the protein (see Table 1).

[0078] The top 20 compounds with the highest MaxAffinity scores were selected, and a total of 17 small molecule compounds were ultimately purchased for experimental verification. The product purchase information of the 17 small molecule compounds and their maximum affinity to norovirus 3CLpro are shown in Table 1.

[0079] Table 1 Maximum affinity of 117 small molecule compounds to norovirus 3CLpro and product information

[0080] Compound name Maximum affinity (kcal / mol) cas number company Bavdegalutamide -12.41 2222112-77-6 Targetmol Bemcentinib -11.74 1037624-75-1 Targetmol NX-2127 -11.72 2416131-46-7 Targetmol MT-802 -11.53 2231744-29-7 Targetmol XL177A -11.43 2417089-74-6 Targetmol Gedatolisib -11.41 1197160-78-3 Targetmol Rifalazil -11.28 129791-92-0 Targetmol SC75741 -11.18 913822-46-5 Targetmol lifirafenib -11.15 1446090-79-4 Targetmol TAM-IN-2 -11.13 2135642-56-5 Targetmol IKK16 -11.12 873225-46-8 Targetmol NPX800 -11.11 1693734-80-3 Targetmol GSK1904529A -11.08 1089283-49-7 Targetmol MS4078 -11.08 2229036-62-6 Targetmol EGFR-IN-8 -11.07 2407957-87-1 Targetmol AktinhibitorVIII -11.06 612847-09-3 Targetmol XY028-140 -11.04 2229974-83-6 Targetmol

[0081] 1.2.2 Compound Verification

[0082] In order to further confirm the inhibitory effect of the 17 compounds (see Table 1) on NV-3CLpro protease, the above-constructed FlipGFP method was used to verify it in HEK293T cells. As with the method for verifying GC376, the 17 candidate compounds were added six hours after transfection, and the fluorescence intensity was detected and analyzed using a high-content cell imaging system 24 hours after transfection. Finally, the IC values ​​of the compounds were plotted. 50The specific method is as follows:

[0083] The 17 candidate compounds (see Table 1) were diluted with DMSO to 10 mM stock solutions (mother solutions), and then the mother solutions of each candidate compound were diluted with DMEM to contain final concentrations of 0.001, 0.01, 0.1, 1, 10 and 100 μM.

[0084] Human embryonic kidney cells (HEK293T, ATCC: CRL-11268) were cultured in DMEM medium (DMEM; 12491015, gbico) supplemented with 10% (v / v) fetal bovine serum (FBS; FSP500, ExCell) in a cell culture incubator containing 5% CO2 at 37°C. Cell number and viability were quantified using an automated cell counter (TC20TM, Bio-Rad). Transfection experiments were then performed. 24 hours before transfection, 1.5 × 10 cells were plated per well. 5 HEK293T cells were cultured by seeding cells at a density of 100 cells / well into 24-well plates. The transfection mixture for each well of the 24-well plate consisted of 250 ng of a FLIPGFP-3CLpro plasmid, 250 ng of a norovirus-3CLpro plasmid, and 1500 ng of polyethyleneimine dissolved in 50 μL of FBS-free DMEM. After incubation at room temperature for 20 minutes, the transfection mixture was added dropwise to the cultured HEK293T cells. The cells were then incubated for an additional 6 hours. Seventeen compounds were then added at final concentrations of 0.001, 0.01, 0.1, 1, 10, and 100 μM. After transfection continued for 18 hours, fluorescence intensity was measured and analyzed using a high-content cytometry system. Each experiment was repeated three times in parallel for each group.

[0085] According to the principle of FLIPGFP detection method: if the compound has an inhibitory effect on protease, the fluorescence intensity will gradually decrease with the increase of compound concentration, and will be dose-dependent within a certain concentration range. 50 The curve is drawn as a relatively smooth inverted S curve.

[0086] Figure 2 and Figure 3 The results showed that the following compounds were finally determined to have inhibitory effects on NV-3CLpro: Gedatolisib, EGFR-IN-8, Aktinhibitor VIII, Bavdegalutamide, lifirafenib, TAM-IN-2, GSK1904529A and IKK 16, with IC 50were 0.06±0.01μM, 0.29±0.09μM, 0.59±0.12μM, 0.97±0.24μM, 1.02±1.23μM, 1.22±0.44μM, 3.94±0.23μM and 5.09±0.16μM (see Figure 2 Among them, Gedatolisib ranked second in docking score with norovirus 3CLpro protease, with a MaxAffinity of -11.41 kcal / mol, indicating the best inhibitory effect.

[0087] For the other nine compounds, namely Bemcentinib, NX-2127, MT-802, XL177A, Rifalazil, SC75741, NPX800, MS4078, and XY028-140, the fluorescence intensity increased rather than decreased with the increase of compound concentration, or showed an irregular effect, and the IC 50 curve, Bemcentinib, NX-2127, MT-802, XL177A, Rifalazil, SC75741, NPX800, MS4078 and XY028-140 had no inhibitory effect on norovirus 3CLpro protease (see Figure 3 ).

[0088] 1.2.3 Crystal structure of the screened protease inhibitor-protease complex

[0089] In order to further explore the inhibitory mechanism of the above eight compounds (Gedatolisib, EGFR-IN-8, Akt inhibitor VIII, Bavdegalutamide, lifirafenib, TAM-IN-2, GSK1904529A and IKK 16) on Norovirus 3CLpro protease, the crystal structures of these compounds were combined with Norovirus 3CLpro to analyze the interacting residues between the two.

[0090] Table 2 Physicochemical properties, Max affinity scores, and hydrogen-bonding residues of the complexes between 3CLpro and eight compounds

[0091] Compound name Maximum affinity (kcal / mol) Hydrogen bonding residues Bavdegalutamide -12.41 Thr81, Val82, Asn165, and Thr166 Gedatolisib -11.41 Val82 lifirafenib -11.15 Val82, Arg100, Ser125, and Met130 TAM-IN-2 -11.13 Thr84, Arg100, Ser125, and Met130 IKK16 -11.12 Thr103 GSK1904529A -11.08 Arg100, Gly124, Ser125, Asn126, and Met130 EGFR-IN-8 -11.07 Glu79 and Asn165 AktinhibitorVIII -11.06 Gly119 and Thr166

[0092] Figure 4The results shown in Table 2 indicate that in the structures of the eight compounds complexed with Norovirus 3CLpro, all occupy the central cavity of the norovirus protease, forming hydrogen bonds and other van der Waals chemical bonds with multiple residues, which appear to be key to their inhibitory activity. Furthermore, different compounds share common residues with the target protein, indicating the importance of these residues in target protein activity. For example, Gedatolisib, Bavdegalutamide, and Lifirafenib, which exhibit relatively high inhibitory activity, all form hydrogen bonds with Val82, with MaxAffinities of -11.41, -12.41, and -11.15 kcal / mol, respectively. This result suggests that Val82 may be an important target beyond the three known catalytic sites (His30, Cys139, and Glu54), and this key residue warrants attention in the future design of new anti-norovirus drugs. Furthermore, EGFR-IN-8 and Bavdegalutamide also form hydrogen bonds with Asn165. Lifirafenib and TAM-IN-2 not only share common interaction residues Ser125 and Met130 with GSK1904529A, but also share a common interaction residue Arg100, which means that Asn165, Arg100, Ser125 and Met130 residues are also important points that cannot be ignored in the design of future anti-norovirus drugs.

[0093] 1.2.4 MD simulation study of the complex between eight compounds and norovirus-3CLpro

[0094] For further analysis, molecular dynamics simulations were performed on the docked eight compounds (Gedatolisib, EGFR-IN-8, Akt inhibitor VIII, Bavdegalutamide, lifirafenib, TAM-IN-2, GSK1904529A, and IKK 16) in complex with norovirus-3CLpro to investigate the structural stability of each complex.

[0095] like Figure 5 As shown in Figure A, the RMSDs of the eight complexes all showed a uniform steady-state trend in the 100ns simulation, while Gedatolisib, EGFR-IN-8, and Bavdegalutamide compounds all fluctuated in the range of 0.25 to 0.30 nm, maintaining good stability, further demonstrating that they can continue to bind to norovirus-3CLpro and continuously inhibit the activity of viral protease.

[0096] To evaluate the folding and compactness of the complex, the Rg maps were then examined.

[0097] like Figure 5 The results shown in Figure B demonstrate the stability of the complexes during the simulation. The fluctuations in the size of all complexes did not exceed 0.05 nm. In particular, the Gedatolisib-norovirus-3CLpro complex exhibited fluctuations of less than 0.02 nm within 20–100 ns, indicating a tight binding to norovirus-3CLpro and a robust inhibition of 3CLpro protease activity, consistent with the results from the cell-based experiments.

[0098] To understand the flexibility of the amino acid regions of the eight compounds in complex with the target protein, their RMSFs were calculated.

[0099] like Figure 5 As shown in Figure 3C, the large fluctuations are mostly concentrated between residues 165-180 and 345-355. The Akt inhibitor VIII compound exhibits greater fluctuations than the other complexes. This result suggests that the complex between Akt inhibitor VIII and the target protein is less stable and more flexible in these two regions compared to the other complexes.

[0100] Figure 5 The results in Figure D demonstrate changes in the solvent-accessible surface area of ​​the complexes, as assessed by SASA plot analysis. The eight complexes exhibited similar SASA trends with minimal fluctuations throughout the simulation, indicating that the surface area of ​​these complexes exposed to the solvent remained largely unchanged. Overall, molecular dynamics simulations explored the structural stability of the complexes between the eight hit compounds and the target protein, further demonstrating their potential as anti-norovirus drugs.

[0101] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. The use of a small molecule compound in the preparation of a product for inhibiting 3C-like cysteine ​​proteases, characterized in that: The small molecule compound is one or more of Gedatolisib, EGFR-IN-8, Akt inhibitor VIII, Bavdegalutamide, lifirafenib, TAM-IN-2, GSK1904529A and IKK 16.

2. The use according to claim 1, characterized in that The 3C-like cysteine ​​protease is derived from norovirus.

3. The use according to claim 1 or 2, characterized in that IC of 3C-like caspases inhibited by gedatolisib, EGFR-IN-8, Aktinhibitor VIII, Bavdegalutamide, lifirafenib, TAM-IN-2, GSK1904529A, and IKK16 50 They were 0.06±0.01μM, 0.29±0.09μM, 0.59±0.12μM, 0.97±0.24μM, 1.02±1.23μM, 1.22±0.44μM, 3.94±0.23μM and 5.09±0.16μM respectively.

4. The use according to claim 3, characterized in that The small molecule compound is Gedatolisib; the residue that interacts between Gedatolisib and 3C-like cysteine ​​protease is Val82.

5. The use according to claim 3, characterized in that The product includes a drug or a reagent.

6. A method for screening drugs that inhibit 3C-like cysteine ​​proteases, characterized in that: The following steps are involved: Detect whether the test drug binds to the catalytic site in 3C-like cysteine ​​protease, wherein the catalytic site is one or more of Val82, Asn165, Arg100, Ser125 and Met130.

7. The method according to claim 6, characterized in that If the test drug binds to the catalytic site in 3C-like cysteine ​​protease, it indicates that the test drug inhibits 3C-like cysteine ​​protease; If the test drug does not bind to the catalytic site in 3C-like cysteine ​​protease, it indicates that the test drug has no effect of inhibiting 3C-like cysteine ​​protease.

8. A drug for inhibiting 3C-like cysteine ​​protease, characterized in that The invention comprises the small molecule compound described in claim 1 and pharmaceutically acceptable excipients.

9. A method for screening antiviral drugs, characterized in that: The following steps are involved: The virus is mixed and incubated with the small molecule compound described in claim 1.

10. The method according to claim 9, characterized in that The virus is norovirus.

Images