Recombinant strain for efficiently expressing xanthine oxidase as well as preparation and application of recombinant strain

Abstract

The invention discloses a recombinant strain for efficiently expressing xanthine oxidase as well as preparation and application of the recombinant strain, and belongs to the technical field of enzyme engineering. According to the recombinant strain, four kinds of recombinant Pseudomonas putida strains are designed, and the strains can be used for efficiently expressing xanthine oxidase. The recombinant strain has the advantages of high expression quantity, simple affinity purification process flow, high purification yield and low production cost, and the recombinant xanthine oxidase has the specific activity similar to that of xanthine oxidase sold in the market at present and is suitable for various applications. The recombinant strain can realize high-efficiency expression of xanthine oxidase, and high-efficiency expression of xanthine oxidase is realized in P.putida through a gene recombination technology; the expressions are induced by adding an inducer, so that the maximum expression quantity of the xanthine oxidase is realized.

Description

Technical Field

[0001] The invention belongs to the technical field of enzyme engineering, and particularly relates to a recombinant strain for efficiently expressing xanthine oxidase, and a preparation and application thereof. Background Art

[0002] Xanthine oxidase (XOD) is widely present in organisms and is a key enzyme in the purine metabolic pathway. It catalyzes the oxidation of hypoxanthine to xanthine, which is further oxidized to uric acid. Currently, XOD is widely used in medical diagnostics, primarily for the detection of purine compounds such as xanthine, hypoxanthine, and inosine (inosine), and as an auxiliary detection for guanine and guanosine. It can also be used to measure the activity of 5'-nucleoside phosphorylase, making it suitable for the detection of hepatobiliary tumors. XOD is also widely used to measure serum inorganic phosphorus levels (hyperphosphatemia) and superoxide dismutase (SOD) activity.

[0003] In short, XOD is a crucial enzyme in the diagnostic testing industry. It also has widespread applications in disease treatment, food testing, industrial catalysis, and environmental protection. Conservative estimates suggest XOD sales in the Chinese market will reach 200 million yuan by 2023.

[0004] Due to a lack of fundamental research results on XOD, there are very few biological sources for large-scale production of this enzyme. Traditionally, XOD is extracted primarily from milk, a single source that is very expensive and significantly affected by milk quality. Furthermore, attempts to express XOD in E. coli have encountered significant difficulties due to the complexity of its gene structure and post-translational processing.

[0005] The host for commercial recombinant XOD is Rhodococcus, a bacterium with slow growth and expensive expression inducers. The primary source of recombinant XOD enzyme genes is Cellulosimicrobium cellulans, whose genome has been sequenced and the XOD gene cluster has been identified. The XOD gene cluster in this microorganism consists of three genes: XodB and XodA, which encode the B and A subunits of XOD, respectively. XodC is a processing protein whose primary function is to complete the processing of the XOD coenzyme system.

[0006] Therefore, further research and development of XOD preparation methods is urgent. An economical and efficient preparation method has great market value. Summary of the Invention

[0007] Based on the technical issues of low and difficult recombinant xanthine oxidase expression in the prior art, the first object of the present invention is to provide a recombinant strain for efficiently expressing xanthine oxidase. The recombinant strains are designed to be four recombinant Pseudomonas putida strains capable of efficiently expressing xanthine oxidase. These recombinant strains exhibit high expression levels, a simple affinity purification process, high purification yields, low production costs, and recombinant xanthine oxidases with a specific activity similar to currently commercially available xanthine oxidases, making them suitable for a variety of applications.

[0008] A second objective of the present invention is to provide a xanthine oxidase that can achieve high-efficiency expression. This xanthine oxidase is obtained by cloning four xanthine oxidase gene clusters into a plasmid vector and then expressing them in a P. putida strain. Using genetic recombination technology, high-efficiency expression of xanthine oxidase is achieved in P. putida; this expression is induced by adding an inducer to achieve maximum expression of the xanthine oxidase.

[0009] The present invention is achieved through the following technical solutions:

[0010] A recombinant strain for efficiently expressing xanthine oxidase, wherein multiple groups of xanthine oxidase gene clusters are cloned into strain vectors to obtain multiple groups of recombinant expression vectors containing xanthine oxidase expression cassettes;

[0011] Transforming the multiple groups of recombinant expression vectors containing xanthine oxidase expression cassettes into a host strain, and obtaining a recombinant strain through fermentation culture and induction expression;

[0012] The multiple groups of recombinant expression vectors containing xanthine oxidase expression cassettes are pUCP18CcXodCBA, pUCP18CcXodBA, pUCP18CcXodCBAopt and pUCP18CcXodBAopt.

[0013] Preferably, the xanthine oxidase gene clusters are CcXodCBAopt and CcXodBAopt or synonymous mutants thereof, and their nucleotide sequences are shown in SEQ ID NO.1-4.

[0014] Preferably, the strain vector is a pUCP18 vector;

[0015] The host strain is Pseudomonas putida strain.

[0016] Preferably, the xanthine oxidase expression cassette consists of a promoter and a xanthine oxidase gene cluster connected downstream of the promoter.

[0017] A recombinant strain for efficiently expressing xanthine oxidase is used in the preparation of xanthine oxidase and / or hypoxanthine oxidase.

[0018] A xanthine oxidase that can be expressed efficiently is obtained by expressing the recombinant strain.

[0019] The invention discloses an application of a xanthine oxidase that can be expressed efficiently in the preparation of a reagent for detecting the concentration of xanthine and / or hypoxanthine.

[0020] A method for detecting xanthine or hypoxanthine in a solution, comprising:

[0021] S1. Add the highly expressed xanthine oxidase according to claim 6 to the solution to be tested, and incubate at 37° C. for 15 minutes to obtain a preliminary incubation solution;

[0022] S2, mixing the initial incubation solution, TMB solution, acetic acid solution, and NiPt NPs solution, and incubating at 37°C for 30 minutes to obtain an incubation solution;

[0023] S3, using colorimetry to determine the maximum absorbance of the incubation solution at 652 nm;

[0024] S4. Substituting the UV absorption standard curve of xanthine or hypoxanthine into the standard curve, the concentration of xanthine or hypoxanthine in the test solution sample is calculated.

[0025] Preferably, the temperature of the oxidation solution is 30° C.-45° C., and the pH is 6.0-9.0.

[0026] Compared with the prior art, the present invention has at least the following technical effects:

[0027] The present invention provides a recombinant strain for efficiently expressing xanthine oxidase. Four recombinant Pseudomonas putida strains are designed for efficient expression of xanthine oxidase. These recombinant strains exhibit high expression levels, a simple affinity purification process, a high purification yield, and low production costs. The recombinant xanthine oxidase has a specific activity similar to that of currently commercially available xanthine oxidase, making it suitable for a variety of applications.

[0028] The present invention provides a xanthine oxidase that can achieve efficient expression. The xanthine oxidase is obtained by cloning four xanthine oxidase gene clusters into a plasmid vector and then expressing them in a P. putida strain. Using genetic recombination technology, efficient expression of the xanthine oxidase is achieved in P. putida; this expression is induced by adding an inducer to achieve maximum expression of the xanthine oxidase. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1It is a schematic diagram of the structure of the xanthine oxidase gene cluster in the background technology;

[0030] Figure 2 Schematic diagram of electrophoresis of amplification of relevant genes and plasmids in Example 1;

[0031] Figure 3 Schematic diagram of the expression of different constructed genes in Example 6 in P. putida. DETAILED DESCRIPTION

[0032] The embodiments of the present invention will be described in detail below with reference to the examples. However, those skilled in the art will understand that the following examples are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention. Specific conditions not specified in the examples are carried out according to conventional conditions or conditions recommended by the manufacturer. Reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially.

[0033] The technical solution of a specific embodiment of the present invention is:

[0034] In order to solve the problems of lack of XOD preparation sources and low production efficiency, the present invention provides a method for preparing xanthine oxidase by using a recombinant strain for efficiently expressing xanthine oxidase.

[0035] The method involves introducing four different xanthine oxidase gene clusters into a Pseudomonas putida (P. putida) strain for expression, followed by further purification and concentration using affinity chromatography.

[0036] This method has the advantages of short cell growth cycle, high expression level, simple purification process, high purification yield and low production cost.

[0037] The preparation method comprises:

[0038] (1) First, the sequences of two xanthine oxidase gene clusters were selected, namely SEQ ID NO.1 (CcXodCBA), SEQ ID NO.2 (CcXodBA), SEQ ID NO.3 (CcXodCBAopt), and SEQ ID NO.4 (CcXodBAopt).

[0039] SEQ ID NO.3 and SEQ ID NO.4 are the optimized expression sequences of SEQ ID NO.1 and SEQ ID NO.2 respectively.

[0040] The main purpose was to optimize the expression of these sequences in P. putida strains.

[0041] (2) The adopted technical solution includes the following steps:

[0042] 2.1 The four xanthine oxidase gene clusters were cloned into the pUCP18 vector to obtain the pUCP18CcXodCBA, pUCP18CcXodBA, pUCP18CcXodCBAopt, and pUCP18CcXodBAopt recombinant expression vectors, respectively.

[0043] 2.2 Transform the recombinant expression vector into the P. putida host strain;

[0044] 2.3 Through fermentation culture and induced expression, a recombinant strain that efficiently expresses xanthine oxidase is obtained.

[0045] Example 1: Cloning of CcXodCBA, CcXodBA, CcXodCBAopt, CcXodBAopt genes and construction of recombinant expression plasmids.

[0046] 1.1 The genes CcXodCBA (original sequence) and CcXodCBAopt (optimized for the P. putida host) were synthesized based on the sequence in GenBank (accession number MN242987.1). Six His residues were added to the ends of each gene. Synthesis was performed by Nanjing GenScript and then constructed into the pUC18 vector, resulting in pUC18CcXodCBA and pUC18CcXodCBAopt.

[0047] 1.2 Design primers and perform PCR amplification. The PCR primers are as follows (F, upstream; R, downstream);

[0048] XodCBA amplification: (using pUC18CcXodCBA as template)

[0049] SEQ ID NO.5:

[0050] XodCBA-F,

[0051] ATAACAATTTCACACAGGAAACAGCTATGCTCCACATCGTCGACCGGCT

[0052] SEQ ID NO.6: XodCBA-R,

[0053] CGTTGTAAAACGACGGCCAGTGCCCTAGTGATGGTGATGGTGATGGCG

[0054] SEQ ID NO.7: XodBA-F,

[0055] ATAACAATTTCACACAGGAAACAGCTATGGACCTGGGCACCGTC

[0056] SEQ ID NO.8: XodBA-R,

[0057] CGTTGTAAAACGACGGCCAGTGCCCTAGTGATGGTGATGGTGATGGCG

[0058] Amplification of XodCBAopt: (using pUCCc18XodCBAopt as template)

[0059] SEQ ID NO.9:

[0060] XodCBAopt-F,

[0061] ATAACAATTTCACACAGGAAACAGCTATGCTGCACATCGTCGACCG

[0062] SEQ ID NO.10: XodCBAopt-R,

[0063] CGTTGTAAAACGACGGCCAGTGCCTTAGTGGTGATGATGGTGGTGGCG

[0064] SEQ ID NO.11:

[0065] XodBAopt-F,

[0066] ATAACAATTTCACACAGGAAACAGCTATGGACCTCGGGACTGTAA

[0067] SEQ ID NO.12: XodBAopt-R,

[0068] CGTTGTAAAACGACGGCCAGTGCCTTAGTGGTGATGATGGTGGTGGCG<00,00144>

[0069] Amplification of plasmid pUCP18:

[0070] SEQ ID NO.13: pU F, TAGGGCACTGGCCGTCGTTTTA

[0071] SEQ ID NO.14: pU R, AGCTGTTTCCTGTGTGAAATTGT

[0072] 1.3 PCR was performed according to conventional methods. To a sterile 200 μl centrifuge tube, 5 μl of Taq buffer (10×), 5 μl of dNTPs, 2.5 μl of F primer (10 pmol / μl), 2.5 μl of R primer (10 pmol / μl), and 1–10 ng of template DNA were added in sequence. The volume was then made up to 50 μl with sterile water. The mixture was mixed and placed in an Eppendorf PCR amplifier. The PCR cycle parameters were denaturation at 94°C for 30–40 s, annealing at 55°C for 1 min, and extension at 72°C for 5 min. The number of cycles was 30–35. The reaction was then stored at 10°C.

[0073] 1.4 After PCR is completed, perform electrophoresis and take a small amount of sample for DNA electrophoresis.

[0074] like Figure 2 Shown is a schematic diagram of electrophoresis for amplification of related genes and plasmids.

[0075] above Figure 2 The results showed that the construction process of the expression vector was successfully completed.

[0076] Amplified fragments were recovered using a DNA recovery kit (Qingke DNA Recovery Kit). The recovered gene fragments were then Gibson ligated with the pUCP18 fragment (using the Gibson ligation kit from Nanjing Novozymes). After ligation, E. coli JM109 cells were transformed and selected with gentamicin. The resulting recombinant plasmids, pUCPCc18XodCBA, pUCPCc18XodBA, pUCP18CcXodCBAopt, and pUCP18CcXodBAopt, were obtained. These plasmids were amplified in E. coli DH5a and prepared using a Qingke Plasmid Extraction Kit.

[0077] Example 2: Electrotransformation and expression of pUCP18CcXodCBA recombinant plasmid in P. putida

[0078] P. putida was cultured in LB medium to an OD600 nm of 0.6–0.75. The cultured cells were collected by centrifugation at 5000 rpm for 10 minutes at 4°C. The cells were washed three times with ice-cold 3 mmol / L HEPES buffer (pH 7.0). The pellet was resuspended in ice-cold 3 mmol / L HEPES buffer and concentrated 300-fold.

[0079] After adding 1 μL of the constructed pUCP18CcXodCBA plasmid to 50 μL of concentrated competent cell suspension, electroporation was performed using a Bio-Rad Gene-Pulser II electroporator with a 1 mm cuvette. The electroporation conditions were set to 2.5 kV, 200 Ω, and 25 μF.

[0080] Immediately after electroporation, 1 mL of SOC medium was added, followed by incubation at 30°C for 2 hours. Gentamicin-resistant LB medium plates were then spread and incubated at 30°C for 18 hours.

[0081] After colonies grew on the plate, single colonies were picked out and inoculated into 5 ml of LB medium for overnight culture at 30°C. Subsequently, the colonies were inoculated into 100 ml of LB medium and cultured at 30°C. After 6 hours, IPTG was added at a final concentration of 0.5 mM for induction. The culture was continued at 30°C for 18 hours, and the cells were collected by centrifugation (4°C, 5000 g, 15 min).

[0082] Example 3: Electrotransformation and expression of pUCP18CcXodBA recombinant plasmid in P. putida

[0083] P. putida was cultured in LB medium to an OD600 nm of 0.5. The cultured cells were harvested by centrifugation at 5000 rpm for 10 minutes at 4°C. The cells were washed three times with ice-cold 10% glycerol. The pellet was resuspended in ice-cold 10% glycerol and concentrated 200-fold.

[0084] After adding 2 μL of the constructed pUCP18CcXodBA plasmid to 50 μL of concentrated competent cell suspension, electroporation was performed using a Bio-Rad Gene-Pulser II electroporator with a 2 mm cuvette at 3.0 kV and 5.6 ms. Immediately after electroporation, 1 mL of SOC medium was added and the cells were incubated at 30°C for 1 hour. Gentamicin-resistant LB medium plates were then plated and incubated at 30°C for 15 hours.

[0085] After colonies grew on the plate, single colonies were picked and inoculated into 5 ml of LB medium for overnight culture at 30°C. Subsequently, 100 ml of LB medium was incubated at 30°C. After 10 hours, IPTG was added to a final concentration of 1.0 mM for induction. Culture was continued at 30°C for 18 hours, and then the cells were collected by centrifugation (4°C, 5000 g, 15 minutes).

[0086] Example 4: Electrotransformation and expression of pUCP18CcXodCBAopt recombinant plasmid in P. putida

[0087] P. putida was cultured in LB medium to an OD600 nm of 0.4. The cultured cells were centrifuged at 5000 rpm for 10 minutes at 4°C to collect the cells. The cells were washed three times with ice-cold 10% sucrose solution. The pellet was resuspended in ice-cold 10% sucrose solution and concentrated 100-fold.

[0088] After adding 3 μL of the constructed pUCP18CcXodCBAopt plasmid to 50 μL of concentrated competent cell suspension, electroporation was performed using a Bio-Rad Gene-Pulser II electroporator with a 1 mm cuvette at 1.5 kV, 200 Ω, and 25 μF. Immediately after electroporation, 1 mL of SOC medium was added, followed by incubation at 30°C for 3 hours. Gentamicin-resistant LB medium plates were then plated and incubated at 30°C for 18 hours.

[0089] After colonies grew on the plate, single colonies were picked and inoculated into 5 ml of LB medium for overnight culture at 30°C. Subsequently, the colonies were inoculated into 100 ml of LB medium and cultured at 30°C. After 2 hours, IPTG was added at a final concentration of 0.2 mM for induction. The culture was continued at 30°C for 18 hours, and the cells were collected by centrifugation (4°C, 5000 g, 15 min).

[0090] Example 5: Electrotransformation and expression of pUCP18CcXodBAopt recombinant plasmid in P. putida

[0091] P. putida was cultured in LB medium to an OD600 nm of 0.5. The cultured cells were centrifuged at 5000 rpm for 10 minutes at 4°C to collect the cells. The cells were washed three times with ice-cold 10% glucose solution. The pellet was resuspended in ice-cold 10% glucose solution and concentrated 200-fold.

[0092] After adding 2 μL of the constructed pUCP18CcXodBAopt plasmid to 50 μL of concentrated competent cell suspension, electroporation was performed using a Bio-Rad Gene-Pulser II electroporator with a 2 mm cuvette at 3.0 kV and 5.6 ms. Immediately after electroporation, 1 mL of SOC medium was added and the cells were incubated at 30°C for 1 hour. Gentamicin-resistant LB medium plates were then plated and incubated at 30°C for 18 hours.

[0093] After colonies grew on the plate, single colonies were picked and inoculated into 5 ml of LB medium for overnight culture at 30°C. Subsequently, 100 ml of LB medium was incubated at 30°C. After 10 hours, IPTG was added to a final concentration of 1.0 mM for induction. Culture was continued at 30°C for 18 hours, and then the cells were collected by centrifugation (4°C, 5000 g, 15 minutes).

[0094] Example 6: Purification of gene expression products

[0095] Resuspend the cells in PBS buffer and disrupt the cells by ultrasound (Ningbo Xinzhi, power 200W, disruption for 3 seconds, rest for 3 seconds) to release the intracellular proteins. Centrifuge the lysate (4°C, 10,000 rpm, 30 minutes) and collect the supernatant.

[0096] Prepare the purification buffer according to the following recipe:

[0097] Binding buffer: 20 mM sodium phosphate buffer, 0.1 M sodium chloride, 20-40 mM imidazole, pH 7.4;

[0098] Elution buffer: 20 mM sodium phosphate buffer, 0.1 M sodium chloride, 500 mM imidazole, pH 7.4. After the buffer is prepared, it needs to be filtered and ultrasonicated to remove bubbles.

[0099] Affinity chromatography purification was performed on GE's AKTA using GE's Histrap pre-packed columns. First, equilibrate the column with 5 column volumes of binding buffer and add the sample supernatant using a sample pump. Wash with binding buffer for at least 10-15 column volumes until the absorption peak reaches a stable baseline or no substance flows out of the effluent. Use elution buffer for one-step elution or linear gradient elution (change the imidazole concentration gradient). Elute 5 column volumes in one step. After the eluate is recovered, it is dialyzed with a dialysis bag, and the replacement elution buffer is 20mM TrisHCl buffer (20mM, pH7.0). The obtained enzyme solution is frozen at -20°C or freeze-dried and placed at -20°C for use. The purified sample was subjected to SDS-PAGE protein electrophoresis analysis, and the results showed that ( Figure 3 ), the purified sample contained the expressed target bands, namely 105 kDa and 31 kDa proteins, proving that the gene XodBA was successfully expressed.

[0100] like Figure 3 Shown is the expression of different constructed genes in P. putida.

[0101] 1.pUCP18CcXodCBAopt, 2.pUCP18CcXodCBA, 3.pUCP18CcXodBAopt, 4.pUCP18CcXodBA.

[0102] Example 7: Method for determining protein concentration and activity of XOD

[0103] The concentration of the purified XOD protein sample was determined using the BCA method. Bovine serum albumin was used as the standard to make a standard curve and then the sample was measured to determine the total protein content.

[0104] XOD activity was determined using the antipyrine colorimetric method.

[0105] Preparation of the colorimetric solution: In a stoppered test tube, add the following reagents in sequence: 4-aminoantipyrine (AAP), 1 mmol / L phenol (PA), 6 mmol / L phenic acid (PA), 50 mmol / L Tris-HCl buffer (pH adjusted to 8.4), and 7000 U / L horseradish peroxidase (HRP). Mix the colorimetric solution with the sample to be tested, heat at 37°C for 20 minutes, and then boil for 5 minutes to terminate the reaction. Absorbance was measured at 508 nm using a spectrophotometer. XOD positive control (10 U / mg) purchased from Toyobo was used as a standard and assayed simultaneously to determine the activity and specific activity of the samples. Combined with the protein and activity assays, the activity of the purified XOD protein reached 10 U / mg protein (Table 1).

[0106] Table 1 XOD activity and specific activity expressed by different plasmids

[0107] Plasmid vector Vitality (U) Protein content (mg) Specific activity (U / mg) pUCP18CcXodCBA 48.2 4.2 11.5 pUCP18CcXodBA 55.3 5.4 10.2 pUCP18CcXodCBAopt 74.8 6.1 12.2 pUCP18CcXodBAopt 72.0 6.5 11.2

[0108] The nucleotide sequences of SEQ ID NO. 1-4 are as follows:

[0109]

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall be included in the scope of protection of the present invention.

Claims

1. A recombinant strain for efficiently expressing xanthine oxidase, characterized in that: Cloning multiple groups of xanthine oxidase gene clusters into strain vectors to obtain multiple groups of recombinant expression vectors containing xanthine oxidase expression cassettes; Transforming the multiple groups of recombinant expression vectors containing xanthine oxidase expression cassettes into a host strain, and obtaining a recombinant strain through fermentation culture and induction expression; The multiple groups of recombinant expression vectors containing xanthine oxidase expression cassettes are pUCP18CcXodCBA, pUCP18CcXodBA, pUCP18CcXodCBAopt and pUCP18CcXodBAopt.

2. A recombinant strain for efficiently expressing xanthine oxidase according to claim 1, characterized in that: The xanthine oxidase gene clusters are CcXodCBAopt and CcXodBAopt or synonymous mutants thereof, and their nucleotide sequences are shown in SEQ ID NO. 1-4.

3. The recombinant strain for efficiently expressing xanthine oxidase according to claim 1, characterized in that: The strain vector is a pUCP18 vector; The host strain is Pseudomonas putida strain.

4. The recombinant strain for efficiently expressing xanthine oxidase according to claim 1, characterized in that: The xanthine oxidase expression cassette consists of a promoter and a xanthine oxidase gene cluster connected to the downstream of the promoter.

5. Use of the recombinant strain for efficiently expressing xanthine oxidase according to any one of claims 1 to 4 in the preparation of xanthine oxidase and / or hypoxanthine oxidase.

6. A xanthine oxidase that can be expressed efficiently, characterized in that The protein is expressed by the recombinant strain according to any one of claims 1 to 4.

7. Use of the highly expressible xanthine oxidase according to claim 6 in the preparation of a reagent for detecting the concentration of xanthine and / or hypoxanthine.

8. A method for detecting xanthine or hypoxanthine in a solution, characterized in that: include: S1. Add the highly expressed xanthine oxidase according to claim 6 to the solution to be tested, and incubate at 37° C. for 15 minutes to obtain a preliminary incubation solution; S2, mixing the initial incubation solution, TMB solution, acetic acid solution, and NiPt NPs solution, and incubating at 37°C for 30 minutes to obtain an incubation solution; S3, using colorimetry to determine the maximum absorbance of the incubation solution at 652 nm; S4. Substituting the UV absorption standard curve of xanthine or hypoxanthine into the standard curve, the concentration of xanthine or hypoxanthine in the test solution sample is calculated.

9. A method for detecting xanthine or hypoxanthine in a solution according to claim 8, characterized in that: The detection solution has a temperature of 30° C.-45° C. and a pH of 6.0-9.0.

Images