Identification of molecular markers in five species of Chimonanthus and their application

Abstract

The application discloses the technical field of molecular identification of plant species, and discloses molecular markers for identifying five species of Chimonanthus and application of the molecular markers. The application develops specific molecular markers (cox2i691 and nad4i1399) based on variable regions between mitochondrial genomes of Chimonanthus praecox and Chimonanthus nitens, and effectively distinguishes the five species of Chimonanthus, i.e. Chimonanthus praecox, Chimonanthus nitens, Chimonanthus salicifolius, Chimonanthus zhejiangensis and Chimonanthus oblongus. The application is beneficial to conveniently and accurately identifying the species of Chimonanthus, and provides important information for analyzing evolution of the Chimonanthus and analyzing a forming mechanism of biochemical properties in the future, and is also beneficial to classification of the species of Chimonanthus, evolution research of mitochondrial genomes, and product discrimination of the Chimonanthus species.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular identification of plant species, and particularly relates to molecular markers for identifying five Chimonanthus plants and application thereof. BACKGROUND

[0002] Calycanthaceae belongs to Magnoliidae and is classified into six families together with other six families. The family contains Calycanthus, Chimonanthus and Idiospermum. Among them, Chimonanthus contains six endemic species, including Chimonanthus nitens, Chimonanthus praecox, Chimonanthus salicifolius, Chimonanthus campanulatus, Chimonanthus grammatus and Chimonanthus zhejiangensis.

[0003] Chimonanthus nitens, as a kind of evergreen shrubs, is highly valued for its ornamental value and application in traditional Chinese medicine. The tender leaves of Chimonanthus nitens are used to make a traditional tea drink called “golden” or “fragrant wind”, and in Chinese patent medicines, the leaves are made into granules to relieve symptoms such as influenza, heatstroke, chronic bronchitis and chest tightness. However, Chimonanthus nitens currently lacks available omics data, including genome, mitochondrial genome and transcriptome, which limits the research on Chimonanthus nitens variety improvement and shape formation mechanism.

[0004] In addition to Chimonanthus praecox, other plants in Chimonanthus, especially Chimonanthus nitens, Chimonanthus salicifolius, Chimonanthus zhejiangensis and Chimonanthus grammatus, are easily confused due to similar morphology and unclear taxonomic characteristics. Therefore, how to effectively identify these Chimonanthus plants is a problem to be solved in the art. SUMMARY

[0005] The present application provides molecular markers for identifying five Chimonanthus plants and application thereof, which solves the technical problem that Chimonanthus plants are similar in morphology and unclear in taxonomic characteristics, are easily confused, and lack effective identification means.

[0006] The present application achieves the above-mentioned purpose through the following technical solutions:

[0007] As a first aspect of the present application, molecular markers for identifying five Chimonanthus plants are provided, and the five Chimonanthus plants are Chimonanthus zhejiangensis, Chimonanthus salicifolius, Chimonanthus nitens, Chimonanthus praecox and Chimonanthus grammatus.

[0008] The molecular marker is cox2i691 and nad4i1399;

[0009] The cox2i691 nucleotide sequence of W. fortunei, W. uliginosa, W. zhejiangensis, W. tomentosa and W. henryi is respectively shown as SEQ ID NO. 5-9;

[0010] The nad4i1399 nucleotide sequence of W. fortunei, W. uliginosa, W. zhejiangensis, W. tomentosa and W. henryi is respectively shown as SEQ ID NO. 10-14.

[0011] As a second aspect of the present application, a primer pair for amplifying the molecular marker for identifying five Wintersweet plants as described above is also provided, and the primer pair for amplifying the molecular marker cox2i691 is:

[0012] The upstream primer cox2i691-F is shown as SEQ ID NO. 1: TAGTGGACGTTATTTCTGCTG;

[0013] The downstream primer cox2i691-R is shown as SEQ ID NO. 2: CATAGGTGAAATCCAATCCC;

[0014] The primer pair for amplifying the molecular marker nad4i1399 is:

[0015] The upstream primer nad4i1399-F is shown as SEQ ID NO. 3: CCACGCACCCTGGAAACA;

[0016] The downstream primer nad4i1399-R is shown as SEQ ID NO. 4: TGTGCGTGCGTGAGTTGG.

[0017] As a third aspect of the present application, the application further provides the use of the molecular marker as described above or the primer pair as described above in identifying W. zhejiangensis, W. uliginosa, W. henryi, W. fortunei and W. tomentosa.

[0018] As a fourth aspect of the present application, a kit for identifying W. zhejiangensis, W. uliginosa, W. henryi, W. fortunei and W. tomentosa is also provided, which comprises the primer pair as described above.

[0019] As a fifth aspect of the present application, a method for identifying W. zhejiangensis, W. uliginosa, W. henryi, W. fortunei and W. tomentosa is also provided, which comprises the following steps:

[0020] (1) taking a plant sample to be tested, extracting total DNA;

[0021] (2) using the total DNA extracted in step (1) as a template, performing amplification using the primer pair as described above, and obtaining an amplification product;

[0022] (3) sequencing the amplification product obtained in step (2), and identifying Winterswax, Winterswax, Winterswax, Winterswax and Winterswax according to the sequencing results.

[0023] As a further optimization scheme of the present application, the PCR amplification reaction system is as follows: the total reaction volume is 20.0 μL, containing 2.0 μL of template DNA, 0.5 μL of forward primer and reverse primer, 10.0 μL of 2x Taq PCR Master Mix and 7.0 μL of ddH2O.

[0024] As a further optimization scheme of the present application, the PCR amplification reaction conditions are as follows: denaturation at 94 ℃ for 5 min, followed by 35 cycles, each cycle including 94 ℃ for 30 seconds, 58 ℃ for 30 seconds and 72 ℃ for 60 seconds, and finally extension at 72 ℃ for 5 minutes.

[0025] The present application has the following beneficial effects:

[0026] Firstly, the present application uses Oxford Nanopore and illumina sequencing technology to complete the assembly of high-quality mitochondrial genome of Winterswax; through comparative analysis with the mitochondrial genome of Winterswax, the present application comprehensively characterizes the structural features and sequence variations of the mitochondrial genome of Winterswax;

[0027] Secondly, based on the variable regions between the mitochondrial genomes of Winterswax and Winterswax, the present application develops specific molecular markers (cox2i691 and nad4i1399) to effectively distinguish the five species of Winterswax, i.e. Winterswax, Winterswax, Winterswax, Winterswax and Winterswax;

[0028] Finally, the present application is beneficial to conveniently and accurately identify the species of Winterswax, providing essential information for future evolutionary analysis and biochemical trait formation mechanism analysis of Winterswax, and is also beneficial to the classification of Winterswax species, mitochondrial genome evolution research and product discrimination derived from Winterswax species. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1The figure shows the assembly results of the mitochondrial genome of *Chimonanthus praecox* provided in Example 2 of this invention. The Unitig diagram depicts chr1 (A) and chr2 (B) of the *Chimonanthus praecox* mitochondrial genome, and C1 to C13 represent Contig 1 to Contig 13. The sequences are displayed as color bars, with numbers reflecting their length and relative sequencing depth, and black lines indicating connections between sequences.

[0030] Figure 2 The diagram shows the mitochondrial genome structure and gene distribution of *Chimonanthus praecox* provided in Embodiment 2 of the present invention. In the diagram, the genes in the outer circle (chr1) and the lower linear region (chr2) are transcribed counterclockwise, while the genes in the inner circle and the upper linear region are transcribed clockwise. Genes with different functions are distinguished by different colors.

[0031] Figure 3 , Figure 4 Comparative analysis of shared cis-splicing introns in the mitochondrial genome of wintersweet and wintersweet provided in Example 3 of the present invention;

[0032] Figure 5 The image shows an electrophoresis diagram of PCR products of mitochondrial genome markers provided in Example 3 of the present invention. In the figure, A shows the cox2i691 marker; B shows the nad4i1399F marker; the PCR amplification covers 3-4 individuals from different sources for each species, and the DNA marker is DL2000.

[0033] Figure 6 The Sanger sequencing alignment results of the PCR amplification products provided in Example 4 of this invention are shown in the figure. In the figure, A shows the cox2i691 polymorphic site; B shows the nad4i1399 polymorphic site; all identical nucleotides in the sequence are shown in black, while conserved nucleotides in ≥60% of the sequence are shown in gray, and insertions and deletions are marked with short lines. Detailed Implementation

[0034] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0035] Example 1: Leaf tissue sampling, DNA extraction and sequencing

[0036] 1. Leaf tissue sampling

[0037] Fresh leaves of M. mume, M. wilsonii, M. salicifolium and M. zhejiangense were collected from Lin Forestry Institute of Shangrao, Jiangxi Forestry Academy and Jiangxi Agricultural University, and wild M. robustum leaves were collected from natural populations in Anyuan and Huichang counties of Jiangxi Province. The sample collection information is shown in Table 1.

[0038] The samples were immediately stored in liquid nitrogen after collection. The M. wilsonii samples from Wuyuan County were sent to Nanjing Jisihuixuan Biological Technology Co., Ltd. for mitochondrial genome sequencing, and the remaining samples were stored in a -80 °C refrigerator for later use.

[0039] Table 1 Sample collection information

[0040] Sample No. Species Collection site Species source 1 Wintersweet Nanchang Economic Development Zone, Jiangxi Agricultural University Longquan County 2 Wintersweet Nanchang Economic Development Zone, Jiangxi Agricultural University Kecheng District 3 Wintersweet Nanchang Economic Development Zone, Jiangxi Agricultural University Changshan County 4 Wintersweet Shangrao City, Guangxin District Longquan County 5 Wintersweet Shangrao City, Guangxin District Yushan County 6 Wintersweet Shangrao City, Guangxin District Guangfeng District 7 Wintersweet Shangrao City, Guangxin District Wuyuan County 8 Wintersweet Shangrao City, Guangxin District Yushan County 9 Wintersweet Shangrao City, Guangxin District Jixi County 10 Wintersweet Nanchang Economic Development Zone, Jiangxi Institute of Forestry Unknown 11 Wintersweet Nanchang Economic Development Zone, Jiangxi Institute of Forestry Unknown 12 Wintersweet Nanchang Economic Development Zone, Jiangxi Institute of Forestry Unknown 13 Wintersweet Nanchang Economic Development Zone, Jiangxi Institute of Forestry Unknown 14 Wintersweet Anyuan County, Ge'ao Forest Farm Anyuan County 15 Wintersweet Anyuan County, Ge'ao Forest Farm Anyuan County 16 Wintersweet Huichang County, Qingxi Township Huichang County

[0041] 2. DNA extraction and sequencing

[0042] (1) DNA extraction

[0043] The fresh leaves of M. mume, M. wilsonii, M. salicifolium, M. zhejiangense and M. robustum were extracted using the TianGen Biochemical Plant Genomic DNA Kit (TianGen Biochemical Technology (Beijing) Co., Ltd.) for genomic DNA, and the quality and concentration were evaluated using the NanoDrop 2000 spectrophotometer (Thermo Scientific, USA) and 1.0 % agarose gel electrophoresis. Note that the DNA of different individuals of the same species in Table 1 was extracted separately as a template for single individual PCR amplification experiments, designed as biological replicates of different individuals of the same species.

[0044] (2) Sequencing

[0045] For short-read sequencing, high-quality genomic DNA was fragmented to about 350 bp using a Covaris S2 / E210 ultrasonic instrument (Covaris Inc., Woburn, MA, USA), and Illumina library construction was performed according to the standard Illumina method (Illumina, Inc., San Diego, CA, USA), and sequencing was performed on the NovaSeq 6000 platform.

[0046] For long read sequencing, first, high quality genomic DNA was randomly fragmented, enriched and purified by Short Read Eliminator XS kit (Circulomics, Inc., Baltimore, MD, USA), then large fragment DNA was recovered by gel cutting, end repaired and added with adenine A at the end, further connected with SQK-LSK109 ligation kit (Oxford Nanopore Technologies, Cambridge, UK) for connection reaction, and finally the built DNA library was quantitatively detected. After the completion of library construction, a certain concentration and volume of DNA library was added to the flow cell, and the flow cell was transferred to the Oxford Nanopore PromethION sequencer for real-time single molecule sequencing.

[0047] The original Illumina sequencing reads were filtered using fastp software (version 0.20.0, https: / / github.com / OpenGene / fastp) to obtain high-quality reads, remove adapters and low-quality or ambiguous sequences. The original Nanopore sequencing reads were refined using filtlong software (version 0.2.1, https: / / github.com / rrwick / Filtlong) to filter out reads shorter than 1000 bases and with an average quality score lower than 7.

[0048] Example 2 Mitochondrial genome assembly

[0049] In view of the high conservation of PCGs and ribosomal RNA sequences in plant mitochondrial genomes, first, the Nanopore PromethION sequencing reads of Wintersweet were aligned with the plant mitochondrial core gene database (https: / / github.com / xul962464 / plant_mt_ref_gene) using Minimap2 software (version 2.1) to start the assembly work.

[0050] Reads with alignment length exceeding 50 bp were selected as potential candidate sequences, and seed sequences were determined based on the number of aligned genes and alignment quality to ensure comprehensive coverage of core genes. Subsequently, the Nanopore PromethION original reads were re-aligned to these seed sequences using Minimap2, and reads with overlap greater than 1 kb and similarity greater than 70% were selected to join the seed sequences, and all three generations of sequencing reads of the mitochondrial genome were obtained by iterative extension.

[0051] Next, the obtained Nanopore PromethION sequencing reads were corrected using the third-generation assembly software Canu, and the Illumina sequencing reads were aligned to the corrected Nanopore PromethION sequencing reads using Bowtie2 (v2.3.5.1). Subsequently, the aligned Illumina reads and Nanopore PromethION reads were assembled using Unicycler (v0.4.8) with default parameters to obtain contigs.

[0052] Finally, the corrected Nanopore PromethION sequencing reads were re-aligned to the contigs using Minimap2, and the branch directions were manually resolved to complete the assembly. This rigorous approach ensured the accuracy and integrity of the mitochondrial genome assembly.

[0053] The results, as shown in Figure 1 , 37,641,521 clean reads were obtained by Illumina sequencing, with a total length of 11.29 Gb. From the Nanopore platform, 10.36 Gb of clean reads were obtained, with an N50 value of 26,161 bp. Using the Unicycler software for assembly, 13 contigs were obtained. Except for contig 4, the other 12 contigs formed a complex circular structure, with a total length of 916,004 bp, and were named Chromosome 1 (Fig. 1A). Contig 4, with a length of 74,775 bp, independently formed a circular chromosome, designated as Chromosome 2 (Fig. 1B). Figure 1 Figure 1

[0054] The mitochondrial genome of W. davidiana contains 40 PCGs, 19 tRNA genes, and 3 rRNA genes, as shown in Figure 2 . The total length of these PCGs sequences is 42,429 bp, accounting for 4.28% of the mitochondrial genome.

[0055] Example 3 Results of molecular marker gel electrophoresis

[0056] The intron sequences of all PCGs in the currently available mitochondrial genomes of W. davidiana (Genbank accession number OR811177.1) and W. davidiana var. davidiana were extracted, and sequence alignment analysis was performed using BLAST software (version 2.10.1). Seven indels were found in the introns of four PCGs: nad2 (1), nad4 (3), nad7 (1), and cox2 (2), and the results of the alignment analysis are shown in Figure 3 ,​​Figure 4 The sequences of the highly variable regions in cox2 and nad4 introns are named as cox2i691 and nad4i1399, respectively.

[0057] Primers were designed for the two variable regions of cox2i691 and nad4i1399 using Primer 5.0 software, and the primer information is as follows:

[0058] The primers for molecular marker cox2i691 are as follows:

[0059] The upstream primer cox2i691-F is TAGTGGACGTTATTTCTGCTG (SEQ ID NO. 1);

[0060] The downstream primer cox2i691-R is CATAGGTGAAATCCAATCCC (SEQ ID NO. 2).

[0061] The primers for molecular marker nad4i1399 are as follows:

[0062] The upstream primer nad4i1399-F is CCACGCACCCTGGAAACA (SEQ ID NO. 3);

[0063] The downstream primer nad4i1399-R is TGTGCGTGCGTGAGTTGG (SEQ ID NO. 4).

[0064] The total DNA of W. chrysocephala, W. chrysocephala var. chrysocephala, W. chrysocephala var. chrysocephala, W. chrysocephala var. chrysocephala, and W. chrysocephala var. chrysocephala was extracted and quantified using the Genomic DNA Extraction Kit for Plant (Tiangen Biotech (Beijing) Co., Ltd.), and the total DNA of the five Wintersweet species was used as a template for PCR amplification using the above-mentioned primer pairs, and the cox2i691 nucleotide sequences and nad4i1399 nucleotide sequences of the five Wintersweet species were obtained. The PCR amplification reaction system is as follows:

[0065] The total volume of the reaction was 20.0 µL, containing 2.0 µL of template DNA (50 ng), 0.5 µL of forward and reverse primers, 10.0 µL of 2×Taq PCR Master Mix, and 7.0 µL of ddH2O.

[0066] The PCR amplification reaction conditions are as follows:

[0067] Denaturation at 94 ℃ for 5 min, followed by 35 cycles, each cycle including 94 ℃ for 30 seconds, 58 ℃ for 30 seconds, and 72 ℃ for 60 seconds, and finally extension at 72 °C for 5 minutes.

[0068] 5% agarose gel electrophoresis was used to detect the PCR amplification products, and PCR amplification covered 3-4 individuals from different species sources of each species. The results are shown in Figure 5 , Figure 5 Figure A shows cox2i691 marker, and Figure B shows nad4i1399 marker; the comprehensive DNA expansion band patterns and subsequent sequencing alignment results ( Figure 6 ) can distinguish five species of Wintersweet, i.e. W. bretschneideri, W. ulmifolia, W. delavayi, W. japoica and W. robusta.

[0069] Among them, the cox2i691 nucleotide sequence of Wintersweet is as follows:

[0070] TAGTGGACGTTATTTCTGCTGAAAAACTACGTCATCGCGCCCTAGCGCGCCTTCCTTAATACTGCGCGTTGCGGCGGACTTCCAACACCTGCCGCGTTGCGGCTCCCTTTGGGTCGCCTACACTTGCCGGGTCGCCTACACTTTAGGGTCTAGTAACTTGCCGGGTCGCCTACACTTTAGGGTCGCCTACACTTGCCGGGTCGCCTACACTTTAGGGTCGCCTACACTTGCTGGGGCTTTGAAGCTTTGACTCAGCCCGACGTGCTTGCTGCTTGCTTTCTCGCTTCCGAGAGGCGAAGGGAGCCTGACTTACGGCTTCCAAGCCTGGCGCGAAGCGAAGGGATTGGATTTCACCTATG (SEQ ID NO. 5).

[0071] The cox2i691 nucleotide sequence of Wintersweet is as follows:

[0072] TAGTGGACGTTATTTCTGCTGAAAAACTACGTCATCGCGCCCTAGCGCGCCTTCCTTAATACTGCGCGTTGCGGCGGACTTCCAACACCTGCCGCGTTGCGGCTCCCTTTGGGTCGCCTACACTTGCCGGGTCGCCGTAACTTTAGGGTCGCCGTAACTTGCTGGGGCTTTGAAGCTTTGATTCAGCCCGACGTGCTTGCTGCTTGCTTTCTCGCTTCCGAGAGGCGAAGGGAGCCTGACTTACGGCTTCCAAGCCTGGCGCGAAGCGAAGGGATTGGATTTCACCTATG (SEQ ID NO. 6).

[0073] The nucleotide sequence of Zhejiang Wintersweet cox2i691 is as follows:

[0074] TAGTGGACGTTATTTCTGCTGAAAAACTACGTCATCGCGCCCTAGCGCGCCTTCCTTAATACTGCGCGTTGCGGCGGACTTCCAACACCTGCCGCGTTGCGGCTCCCTTTGGGTCGCCTACACTTGCCGGGTCGCCGTAACTTTAGGGTCGCCGTAACTTGCTGGGGCTTTGAAGCTTTGACTCAGCCCGACGTGCTTGCTGCTTGCTTTCTCGCTTCCGAGAGGCGAAGGGAGCCTGACTTACGGCTTCCAAGCCTGGCGCGAAGCGAAGGGATTGGATTTCACCTATG (SEQ ID NO. 7).

[0075] The nucleotide sequence of Tuo-to Wintersweet cox2i691 is as follows:

[0076] TAGTGGACGTTATTTCTGCTGAAAAACTACGTCATCGCGCCCTAGCGCGCCTTCCTTAATACTGCGCGTTGCGGCGGACTTCCAACACCTGCCGCGTTGCGGCTCCCTTTGGGTCGCCTACACTTGCCGGGTCTAGTAACTTGCCGGGTCGCCGTAACTTGCCGGGTCGCCGTAACTTTAGGGTCTAGTAACTTTAGGGTCTAGTAACTTTAGGGTCGCCTACACTTGCTGGGGCTTTGAAGCTTTGACTCAGCCCGACGTGCTTGCTGCTTGCTTTCTCGCTTCCGAGAGGCGAAGGGAGCCTGACTTACGGCTTCCAAGCCTGGCGCGAAGCGAAGGGATTGGATTTCACCTATG (SEQ ID NO. 8).

[0077] The nucleotide sequence of the Cox2i691 of Rhododendron simsii is shown below;

[0078] TAGTGGACGTTATTTCTGCTGAAAAACTACGTCATCGCGCCCTAGCGCGCCTTCCTTAATACTGCGCGTTGCGGCGGACTTCCAACACCTGCCGCGTTGCGGCTCCCTTTGGGTCGCCTACACTTGCCGGGTCTAGTAACTTGCCGGGTCGCCGTAACTTGCTGGGGCTTTGAAGCTTTGACTCAGCCCGACGTGCTTGCTGCTTGCTTTCTCGCTTCCGAGAGGCGAAGGGAGCCTGACTTACGGCTTCCAAGCCTGGCGCGAAGCGAAGGGATTGGATTTCACCTATG (SEQ ID NO. 8).

[0079] The nucleotide sequence of the Cox2i691 of Rhododendron simsii is shown below;

[0080] CCACGCACCCTGGAAACATACTGCGCGTTGCGGCTCCCTTCCAACACCTGCCGCGTTGCGGCGGACTTCCAACACCTGCCGCGTTGCGGCTCCCTTTGGGTCGCCTACACTTGCCGGGTCTAGTAACTTGCCGGGTCGCCTACACTTGCTGGGGCCGGAAGATCTCAGTTGTCCTGGACTGGACAAGTACGTAGAGATCTTCGTGGGACCGGGGAGGGAGTATCAATCGATCTTTTCTAGGATTCCAACTCACGCACGCACA (SEQ ID NO. 10).

[0081] The nucleotide sequence of the nad4i1399 of Lonicera nitida is as follows:

[0082] CCACGCACCCTGGAAACATACTGCGCGTTGCGGCTCCCTTCCAACACCTGCCGCGTTGCGGCGGACTTCCAACACCTGCCGCGTTGCGGCTCCCTTTGGGTCGCCTACACTTGCCGGGTCTAGTAACTTGCCGGGTCGCCTACACTTGCTGGGGCCGGAAGATCTCAGTTGTCCTGGACTGGACAAGTACGTAGAGATCTTCGTGGGACCGGGGAGGGAGTATCAATCGATCTTTTCTAGGATTCCAACTCACGCACGCACA (SEQ ID NO. 10).

[0083] The nucleotide sequence of the nad4i1399 of Lonicera nitida is as follows:

[0084] CCACGCACCCTGGAAACATACTGCGCGTTGCGGCTCCCTTCCAACACCTGCCGCGTTGCGGCGGACTTCCAACACCTGCCGCGTTGCGGCTCCCTTTGGGTCGCCTACACTTGCCGGGTCGCCGTAACTTGCCGGGTCGCCGTAACTTGCTGGGGCCGGAAGATCTCAGTTGTCCTGGACTGGACAAGTACGTAGAGATCTTCGTGGGACCGGGGAGGGAGTATCAATCGATCTTTTCTAGGATTCCAACTCACGCACGCACA (SEQ ID NO. 12).

[0085] The nucleotide sequence of the nad4i1399 of T. truncatum is as follows:

[0086] CCACGCACCCTGGAAACATACTGCGCGTTGCGGCTCCCTTCCAACACCTGCCGCGTTGCGGCTCCCTTCCAACACCTGCCGCGTTGCGGCTCCCTTCCAACACCTGCCGCGTTGCGGCTCCCTTCCAACACCTGCCGCGTTGCGGCTCCCTTTGGGTCGCCTACACTTGCCGGGTCTAGTAACTTGCCGGGTCTAGTAACTTTAGGGTCGCCTACACTTGCTGGGGCCGGAAGATCTCAGTTGTCCTGGACTGGACAAGTACGTAGAGATCTTCGTGGGACCGGGGAGGGAGTATCAATCGATCTTTTCTAGGATTCCAACTCACGCACGCACA (SEQ ID NO. 13).

[0087] The nucleotide sequence of the nad4i1399 of T. truncatum is as follows:

[0088] CCACGCACCCTGGAAACATACTGCGCGTTGCGGCTCCCTTCCAACACCTGCCGCGTTGCGGCGGACTTCCAACACCTGCCGCGTTGCGGCTCCCTTTGGGTCGCCTACACTTGCCGGGTCTAGTAACTTGCCGGGTCGCCGTAACTTGCTGGGGCCGGAAGATCTCAGTTGTCCTGGACTGGACAAGTACGTAGAGATCTTCGTGGGACCGGGGAGGGAGTATCAATCGATCTTTTCTAGGATTCCAACTCACGCACGCACA (SEQ ID NO. 14).

[0089] Example 4 Sequencing alignment of molecular markers

[0090] According to the method described in Example 3, the cox2i691 and nad4i1399 nucleotide sequences of five species of Wintersweet were amplified by PCR respectively, and the PCR products were purified and cloned into pMD18-T vector (Takara), transformed into TOP10 E. coli competent cells (Shanghai Biotech), and positive clones were screened. The target sequence was determined by Sanger sequencing, and the alignment results were visualized using Chromas software (version 2.6.6), as shown in Table 1. Figure 5

[0091] The sequencing alignment results of cox2i691 and nad4i1399 markers revealed rich sequence polymorphisms among Wintersweet, Wintersweet, Wintersweet, Wintersweet, and Wintersweet. It is particularly noteworthy that the cox2i691 marker shows a 106 bp deletion in Wintersweet and Wintersweet, while the nad4i1399 marker shows 28 bp and 25 bp insertions in Wintersweet and Wintersweet, which confirms the high reliability of cox2i691 and nad4i1399 as molecular markers for accurate identification of Wintersweet species.

[0092] The above examples only express several embodiments of the present application, and the description is more specific and detailed, but it cannot be understood as a limitation on the scope of the patent of the present application. It should be noted that for ordinary skilled persons in the art, without departing from the concept of the present application, several modifications and improvements can be made, which are within the scope of protection of the present application.​

Claims

1. Molecular markers for identifying five species of the genus *Chimonanthus*, characterized in that... The five species of wintersweet are wintersweet from Zhejiang, wintersweet from willow leaf, wintersweet from the mountain, wintersweet, and wintersweet from Tuto. The molecular markers are cox2i691 and nad4i1399; The cox2i691 nucleotide sequences of wintersweet, willow-leaf wintersweet, Zhejiang wintersweet, tuto wintersweet and mountain wintersweet are respectively shown in SEQ ID NO.5-9; The nucleotide sequences of *Chimonanthus praecox* nad4i1399, *Chimonanthus praecox* nad4i1399, *Chimonanthus zebrina* nad4i1399, *Chimonanthus tututus* nad4i1399, and *Chimonanthus praecox* nad4i1399 are shown in SEQ ID NO. 10-14, respectively.

2. Primer pairs for amplifying the molecular markers for identifying five species of *Chimonanthus* as described in claim 1, characterized in that, The primer pair used to amplify the molecular marker cox2i691 is: The upstream primer cox2i691-F is shown in SEQ ID NO.1: TAGTGGACGTTATTTCTGCTG; The downstream primer cox2i691-R is shown in SEQ ID NO.2: CATAGGTGAAATCCAATCCC; The primer pair used to amplify the molecular marker nad4i1399 is: The upstream primer nad4i1399-F is shown in SEQ ID NO.3: CCACGCACCCTGGAAACA; The downstream primer nad4i1399-R is shown in SEQ ID NO.4: TGTGCGTGCGTGAGTTGG.

3. The application of the molecular marker as described in claim 1 or the primer pair as described in claim 2 in the identification of Chimonanthus zebrina, Chimonanthus praecox, Chimonanthus praecox, Chimonanthus praecox and Chimonanthus praecox.

4. A kit for identifying Zhejiang wintersweet, willow-leaf wintersweet, mountain wintersweet, wintersweet, and tutu wintersweet, characterized in that, Includes the primer pair as described in claim 2.

5. A method for identifying Zhejiang wintersweet, willow-leaf wintersweet, mountain wintersweet, wintersweet, and protruding wintersweet, characterized in that, Includes the following steps: Take plant samples to be tested and extract total DNA; (2) Using the total DNA extracted in step (1) as a template, perform PCR amplification reaction using the primer pair as described in claim 2 to obtain amplification products; (3) Sequencing the amplification products obtained in step (2) and identifying Zhejiang wintersweet, willow-leaf wintersweet, mountain wintersweet, wintersweet and Tuto wintersweet based on the sequencing results.

6. The method according to claim 5, characterized in that, The PCR amplification reaction system is as follows: the total reaction volume is 20.0 µL, containing 2.0 µL template DNA, 0.5 µL each of forward and reverse primers, 10.0 µL 2×Taq PCRMaster Mix and 7.0 µL ddH2O.

7. The method according to claim 5, characterized in that, The PCR amplification reaction conditions are as follows: denaturation at 94 °C for 5 min, followed by 35 cycles, each cycle consisting of 94 °C for 30 seconds, 58 °C for 30 seconds and 72 °C for 60 seconds, and finally extension at 72 °C for 5 minutes.

Images