Composite fermentation inoculant for increasing relative content of ethyl decanoate in roxburgh rose fruit wine and application of composite fermentation inoculant

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to a compound fermentation inoculant for increasing the relative content of ethyl decanoate in roxburgh rose fruit wine and application. According to the present invention, two saccharomycetes are separated from a wild rosa roxburghii fermentation broth, i.e., a Starmerella bacillus and a Saccharomyces cerevisiae, and are compounded to obtain the composite fermentation bacterial agent, and the bacterial agent can produce ethyl decanoate at high yield and is applied to rosa roxburghii fruit wine brewing, such that the relative content of ethyl decanoate in the rosa roxburghii fruit wine is increased, and the yield of the rosa roxburghii fruit wine is increased; the flavor quality of the roxburgh rose fruit wine is improved, and technical support is provided for industrial development of the roxburgh rose fruit wine. When the composite microbial agent is used for fermenting the rosa roxburghii tratt fruit wine, the flavor and taste of the rosa roxburghii tratt fruit wine can be remarkably improved, the relative content of ester substances in volatile flavor substances of the rosa roxburghii tratt fruit wine is increased by 68.527% in total, and the highest relative content of ethyl decanoate is 26.551%. In addition, the relative content of ethyl laurate and the relative content of ethyl caprylate are increased to 14.228% and 11.335% respectively.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and relates to a composite fermentation bacterial agent for increasing the relative content of ethyl caprate in roxburghii fruit wine and an application thereof. Background Art

[0002] Rosa roxburghii (Roxburghii trait) is a deciduous shrub of the genus Rosa in the Rosaceae family. Its fruit, the roxburghii fruit, is a traditional Chinese fruit used for both medicinal and edible purposes. Roxburghii is widely distributed in the subtropical mountainous and hilly regions of southwestern and central my country, mostly at altitudes of 1,000-1,600 meters. Guizhou Province is particularly rich in roxburghii resources. Roxburghii is a highly nutritious and valuable health fruit. Research has shown that roxburghii contains bioactive nutrients such as vitamins, dietary fiber, polysaccharides, carotene, and functional enzymes. Fresh roxburghii fruit contains as high as 1,300-3,500 mg / 100 g of vitamin C, 60-130 mg / g of vitamin P, and 1,700-10,000 IU / g of tissue, respectively, earning it the nickname "Three King Fruits." Furthermore, fresh roxburghii fruit boasts a comprehensive range of amino acids, a high proportion of beneficial trace elements, and a high content of pentacyclic triterpenoid acids. Sea buckthorn also has many pharmacological effects such as delaying aging, enhancing the body's immunity, lowering the three highs, anti-inflammatory and analgesic, preventing and fighting cancer, and reducing heavy metal load.

[0003] In recent years, brewing fruit wine using sea buckthorn as a raw material has gradually become a research hotspot. However, the brewing process of sea buckthorn wine still faces several technical bottlenecks. For example, the brewing bacteria for sea buckthorn wine are mostly not derived from the sea buckthorn itself, and exogenous strains are difficult to fully release the aroma and nutrients of sea buckthorn. Fermentation with a single bacterial strain is also difficult to meet the demand for diverse flavors of sea buckthorn wine, affecting the aroma quality of the wine. Ethyl caprate is one of the key components affecting the aroma and flavor of wine. It has a unique fruity and floral aroma and can enhance the flavor quality of fruit wine. The quality of sea buckthorn wine can be improved by increasing the relative content of ethyl caprate. Currently, there are no microorganisms or bacterial agents that can increase the relative content of ethyl caprate during the fermentation process of sea buckthorn wine.

[0004] Therefore, finding new microorganisms or fermentation agents that can be used to ferment and increase the relative content of ethyl decanoate in wine and applying them to the brewing of sea buckthorn wine is of great significance for improving the quality of sea buckthorn wine and promoting the development of the sea buckthorn industry. Summary of the Invention

[0005] In view of the shortcomings of the existing technology, the present invention provides a composite fermentation agent and its application for increasing the relative content of ethyl decanoate in roxburghii wine. The specific contents are as follows:

[0006] The applicant isolated two yeast strains from the fermentation broth of wild sea buckthorn: a strain of Starmerella bacillaris and a strain of Saccharomyces cerevisiae, and compounded them to obtain a composite fermentation agent. The agent can produce high yields of ethyl caprate and is used in the brewing of sea buckthorn wine, thereby increasing the relative content of ethyl caprate in the sea buckthorn wine and improving the flavor quality of the sea buckthorn wine, providing technical support for the industrial development of sea buckthorn wine.

[0007] A brewer's yeast is deposited in the China Center for Type Culture Collection with the accession number CCTCC M 2025923 and the deposit date April 27, 2025. The yeast is classified and named Saccharomyces cerevisiae C6.

[0008] The brewer's yeast can be applied to winemaking, especially to fermenting roxburghii fruit wine.

[0009] The ITS sequence of the above-mentioned Saccharomyces cerevisiae C6 strain is shown in SEQ ID NO: 1.

[0010] SEQ ID NO: 1 ITS sequence of Saccharomyces cerevisiae C6 strain:

[0011] TGCCTATCCCCAAACGGAGGAAAAGAAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCC TTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA ACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCAT CAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGCCCGTCTTGACCCCCGGGACCA

[0012] A Candida zemplina yeast is deposited in the China Center for Type Culture Collection with the accession number CCTCCM2025924 and the preservation date April 27, 2025. The classification name is Starmerella bacillaris C18.

[0013] The Candida zemplina can be applied to winemaking, especially to fermentation of roxburghii fruit wine.

[0014] The ITS sequence of the Candida zemplina C18 strain is shown in SEQ ID NO: 2.

[0015] SEQ ID NO: 2 ITS sequence of Candida zemplina C18 strain:

[0016]

[0017] A composite fermentation agent for increasing the relative content of ethyl caprate in roxburghii wine contains any one or more of the above-mentioned yeast Saccharomyces cerevisiae and Candida zemplina mixed in any proportion.

[0018] Furthermore, the ratio of Saccharomyces cerevisiae to Candida zemplina is (1-3):1.

[0019] The composite fermentation agent for increasing the relative content of ethyl caprate in roxburghii wine can be applied to winemaking, especially to fermenting roxburghii wine.

[0020] A fermentation method for sea buckthorn fruit wine adopts the above-mentioned fermentation bacterial agent, has a fermentation temperature of 18-24 DEG C, a fermentation time of 10 days, and an initial fermentation sugar content of 26°BX.

[0021] Beneficial effects of the present invention:

[0022] 1. The applicant isolated two yeast strains from wild sea buckthorn fermentation broth: a Starmerella bacillaris and a Saccharomyces cerevisiae, and compounded them to obtain a composite fermentation agent, which can produce high-yield ethyl caprylate and is applied to sea buckthorn wine brewing, thereby increasing the relative content of ethyl caprylate in sea buckthorn wine and improving the flavor quality of sea buckthorn wine, providing technical support for the industrial development of sea buckthorn wine.

[0023] 2. The brewer's yeast of the present invention is deposited in the China Center for Type Culture Collection with the accession number CCTCCM2025923 and the deposit date April 27, 2025. The rosa roxburghii fruit wine fermented by the strain contains 39 volatile substances, of which esters have the highest relative content (45.819%), acids have 33.727%, and ethers have 15.246%. The highest relative content is n-capric acid (14.996%), followed by caprylic acid (11.654%) and capric acid ethyl ester (11.359%).

[0024] 3. The Candida zemplina of the present invention is deposited in the China Center for Type Culture Collection with the accession number: CCTCC M 2025924 and the deposit date: April 27, 2025.

[0025] 4. The composite bacterial agent of the present invention is used to ferment the roxburghii fruit wine, which can significantly improve the flavor and taste of the roxburghii fruit wine. The relative content of ester substances in the volatile flavor substances of the roxburghii fruit wine is increased by a total of 68.527%, among which the relative content of ethyl caprate is the highest at 26.551%. In addition, the relative contents of ethyl laurate and ethyl caprylate are also increased to 14.228% and 11.335%, respectively. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Figure 1 shows the colony morphology of strains C6 and C18. Note: Figure A shows the colony morphology of strain C6 on a YPD plate; Figure B shows the colony morphology of strain C18 on a YPD plate; Figure C shows the microstructure of strain C6; and Figure D shows the microstructure of strain C18.

[0027] Figure 2 This is the phylogenetic tree of strains C6 and C18.

[0028] Figure 3 This is the growth status of C6 and C18 strains in different glucose concentrations.

[0029] Figure 4 This is the growth status of C6 and C18 strains in culture medium with different ethanol addition amounts.

[0030] Figure 5 This is the growth condition of C6 and C18 strains in culture medium containing different concentrations of SO2.

[0031] Figure 6 This is the growth status of C6 and C18 strains in different pH culture media.

[0032] Figure 7 This is the growth status of C6 and C18 strains at different culture temperatures.

[0033] Figure 8 These are the growth curves of strains C6 and C18.

[0034] Figure 9 This is an analysis chart of volatile aroma substances in sea buckthorn wine fermented by different strains.

[0035] Figure 10 The effect of different inoculation times of C18 strain on sea buckthorn wine.

[0036] Figure 11 The effect of different inoculation times of C18 strain on the relative content of ethyl caprate in sea buckthorn wine.

[0037] Figure 12 The effect of different inoculation ratios of C6 and C18 on sea buckthorn wine.

[0038] Figure 13 The study is about the effect of different inoculation ratios of C6 and C18 on the relative content of ethyl caprate in sea buckthorn wine.

[0039] Figure 14 The effect of different fermentation temperatures on sea buckthorn wine.

[0040] Figure 15The effect of different fermentation temperatures on the relative content of ethyl caprate in sea buckthorn wine.

[0041] Figure 16 The effect of different fermentation times on sea buckthorn wine.

[0042] Figure 17 The effect of different fermentation times on the relative content of ethyl caprate in sea buckthorn wine.

[0043] Figure 18 The effect of different initial fermentation sugar content on sea buckthorn wine.

[0044] Figure 19 The effect of different initial fermentation sugar concentrations on the relative content of ethyl caprate in sea buckthorn wine.

[0045] Figure 20 It is the response surface and contour line of the interaction effect between various factors on the sensory score of sea buckthorn wine.

[0046] Figure 21 This is a radar chart of sensory evaluation of C6-C18 fermented sea buckthorn wine. DETAILED DESCRIPTION

[0047] The present invention will be further described in detail below with reference to specific embodiments, which are intended to explain the present invention rather than to limit it.

[0048] Example

[0049] Test methods

[0050] 1. Strain screening

[0051] 1.1 Strain isolation and purification

[0052] Remove the rotten fruits from fresh sea buckthorn, wash, remove the seeds, mash them and put them into a 200 ml beaker, and ferment them naturally at room temperature in a sealed environment for 2-3 days.

[0053] Pipette the fermentation broth onto a clean bench and dilute it with saline in a gradient pattern. Spread each dilution evenly onto a plate of Red Bengal medium. Incubate inverted in a 30°C incubator for 2 days, repeating three times. Based on morphological observation, select colonies with typical yeast morphology from the culture plate and separate and purify them multiple times on YPD medium plates until a pure single colony is isolated. Store the single colony in a glycerol tube in a -80°C freezer.

[0054] 1.2 Molecular biological identification of strains

[0055] DNA was extracted using a fungal DNA extraction kit. The 26S rDNA gene sequences of the selected strains were amplified and sequenced using universal primers NL1 (5'-GCATATCAATAAGCGGAGGAAAAG-3') and NL4 (5'-GGTCCGTGTTTCAAGACGG-3'). The PCR amplification system (25 μL) consisted of 12 μL of 2× Master Mix, 10 μL of ddH2O, 0.5 μL each of primers NL1 and NL4, and 2 μL of DNA template. Amplification conditions included pre-denaturation at 95°C for 10 min, followed by denaturation at 94°C for 30 min, annealing at 50°C for 45 s, and extension at 72°C for 90 s for 30 cycles, followed by extension at 72°C for 10 min. PCR products were electrophoresed on a 1% dextran gel at 140 V, using DL 2000 as a molecular weight standard. After electrophoresis confirmed the amplification results, sequencing was completed by Sangon Biotech (Shanghai) Co., Ltd. The sequencing results were compared with the NCBI database by BLAST, and the phylogenetic tree was constructed using the neighbor-joining (NJ) method using MEGA11.0 software.

[0056] 2. Strain tolerance testing

[0057] 2.1 Activation of bacterial strains and preparation of seed solution

[0058] Activate the strain: streak the pure strain stored in the glycerol tube in 1.1 onto YPD solid medium and activate it twice. Store the activated strain in a refrigerator at 4°C for later use.

[0059] Seed liquid culture: Inoculate the activated bacteria into YPD liquid medium and culture at 30℃ and 160r / S shaking for 24h. Take samples of the seed liquid under the clean bench and use a microplate reader to measure the OD 600 >1.0 means the seed solution is prepared.

[0060] 2.2 High concentration glucose tolerance test

[0061] The prepared seed solution was inoculated into YPD liquid medium with glucose concentrations of 100 g / L, 150 g / L, 200 g / L, 250 g / L, and 300 g / L at a 1% inoculum rate, and cultured at 30°C for 2 days. 600 Measure its OD value.

[0062] 2.3 Ethanol tolerance test

[0063] The prepared seed solution was inoculated into YPD liquid medium with ethanol concentration of 2%, 4%, 6%, 8% and 10% at an inoculum volume of 1%, and cultured at 30℃ for 2 days. 600 Measure its OD value.

[0064] 2.4 SO2 tolerance test

[0065] The prepared seed solution was inoculated into YPD liquid medium with SO2 concentrations of 40 mg / L, 80 mg / L, 120 mg / L, 160 mg / L, and 200 mg / L at a 1% inoculum rate, and cultured at 30°C for 2 days. 600 Measure its OD value.

[0066] 2.5 pH environmental tolerance test

[0067] The prepared seed solution was inoculated into YPD liquid medium with pH of 2.5, 3, 3.5, 4, and 4.5 at a 1% inoculum rate, and cultured at 30°C for 2 days. 600 Measure its OD value.

[0068] 2.6 Culture temperature tolerance test

[0069] Each bacterial solution was inoculated into YPD liquid culture medium at a 1% inoculum volume and placed in an incubator at 18°C, 21°C, 24°C, 27°C, 30°C, and 33°C, and cultured for 2 days at OD 600 Measure its OD value.

[0070] 3 Application of C6-C18 strain composite fermentation in roxburghii wine

[0071] 3.1 Rosa roxburghii wine fermentation process

[0072] (1) Wash fresh sea buckthorn and remove the bad fruits, and squeeze the juice according to the ratio of sea buckthorn to water = 1:1.5.

[0073] (2) Enzymatic hydrolysis: 100 mg / L potassium metabisulfite + 120 mg / L pectinase at 50°C for 2 h.

[0074] (3) After enzymatic hydrolysis, filter the solution through four layers of gauze and adjust the initial fermentation sugar content and pH to 3-3.5.

[0075] (4) Packaging: Pack the sea buckthorn juice into 200 mL / bottle and pasteurize at 65°C for 30 min.

[0076] (5) Inoculation: Inoculate the seed solution (see 2.1) at a rate of 4% into the roxburghii fermentation solution. Ferment at a suitable temperature.

[0077] (6) Aging: After fermentation, filter the wine and age it in a refrigerator at 4°C for 15-30 days.

[0078] 3.2 Effects of fermentation of different strains on roxburghii wine

[0079] To fully illustrate the effect of the C6-C18 strain composite fermentation of roxburghii wine, the inventors fermented roxburghii wine with the C6-C18 composite bacterial agent, C6 strain, C18 strain, and Angel Wine Yeast-SY bacterial agent, respectively. The fermentation process was referenced to 3.1. After fermentation, the physical and chemical indicators of the four treated roxburghii wines were measured and the volatile aroma substances were analyzed.

[0080] Angel wine yeast-SY agent was purchased from Angel Yeast Co., Ltd. The C6 and C18 strains were selected by the present inventors.

[0081] 3.2.1 Determination of physical and chemical indicators of roxburghii wine

[0082] Soluble solids (fermentation sugar content) were measured using a handheld sugar meter. The total acid and total sugar contents of the rosa roxburghii wine were measured according to GB / T 15038-2006 General Methods for Analysis of Grape Wine and Fruit Wine. The alcohol content was measured according to the alcoholometer method in GB / T 5009.225-2023. The reducing sugar content was measured according to DB34 / T 2264-2014. The sensory evaluation is shown in Table 1.

[0083] Table 1 Reference table for sensory evaluation of roxburghii fruit wine

[0084]

[0085]

[0086] 3.2.2 Analysis of aroma compounds in roxburghii wine

[0087] (1) Sample pretreatment: Accurately weigh 5-10 ml of sea buckthorn wine sample and place it in a 20 mL headspace injection vial. Weigh 1-5 g of sodium chloride and use amyl acetate (concentration 0.3546 μg / mL) as the internal standard. Seal the vial. Incubate at 60°C for 10 min, shake at 450 rpm, and extract for 50 min.

[0088] (2) Instrument reference conditions

[0089] GC conditions:

[0090] Chromatographic column: HP-5ms Ultra Inert capillary column (30m×0.25mm, 0.25μm);

[0091] Heating program: 40 °C for 3 min, then increase to 150 °C at 6 °C / min, hold for 3 min, then increase to 210 °C at 8 °C / min, and hold at this temperature for 3 min;

[0092] Carrier gas: helium, flow rate 0.8 mL / min;

[0093] Inlet temperature: 250℃.

[0094] MS conditions:

[0095] The electron impact ionization (EI) energy was 70 eV, the ion source temperature was 230°C, the quadrupole temperature was 150°C, and EI mass spectra were recorded in the range of 30 to 550 AMU.

[0096] The test results were processed using Agilent MassHunterWorkstation, and the components were retrieved through the NIST20.L mass spectrometry database. The peak area normalization method was used for quantification, and the relative content was expressed as the ratio of the peak area of ​​each component to the total peak area of ​​the chromatogram.

[0097] Optimization of 4C6-C18 combined fermentation process for roxburghii fruit wine

[0098] 4.1 Single factor experiment to optimize production process

[0099] The quality of fruit wine can be greatly improved by combining brewer's yeast with non-brewer's yeast for fermentation. This experiment used strains C6 and C18 for combined fermentation, and conducted five single-factor experiments with different C18 inoculation time intervals, different inoculation ratios, different fermentation days, different fermentation temperatures, and different initial sugar concentrations, in order to explore the effects of different fermentation conditions on sea buckthorn fruit wine and screen the most suitable fermentation conditions. The fermentation process refers to 3.1, and the inoculation amount of C6-C18 in sea buckthorn fruit wine fermentation liquid is 4%. The specific scheme is as follows, see Table 2:

[0100] Factor 1: C18 inoculation time experiment at different intervals: initial sugar content 24°BX, fermentation time 25 days, fermentation temperature 24℃, C6:C18 inoculation ratio 1:1.

[0101] Interval time: First inoculate C6 and then inoculate C18 strain on 0 days, 4 days, 8 days, 12 days, and 16 days

[0102] Factor 2: Experiments with different inoculation ratios of C6 and C18 strains: initial sugar content 24°BX, fermentation time 25 days, and fermentation temperature 24℃.

[0103] Inoculation ratio: C6:C18 is 1:1, 1.5:1, 2:1, 2.5:1, 3:1

[0104] Factor 3: Fermentation temperature test: initial sugar content 24°BX, fermentation time 25 days, C6:C18 inoculation ratio 1:1.

[0105] Fermentation temperature: 18℃, 21℃, 24℃, 27℃, 30℃.

[0106] Factor 4: Fermentation time test: initial sugar content 24°BX, fermentation temperature 24℃, C6:C18 inoculation ratio 1:1.

[0107] Fermentation time: 10d, 15d, 20d, 25d, 30d.

[0108] Factor 5: Initial sugar content test of fermentation: fermentation temperature 24℃, fermentation time 25d, C6:C18 inoculation ratio 1:1.

[0109] Initial sugar content: 18°BX, 20°BX, 22°BX, 24°BX, 26°BX.

[0110] Table 2 Three single-factor experimental schemes for C6-C18 combined fermentation

[0111]

[0112]

[0113] 4.2 Response surface experiment of C6-C18 combined fermentation of roxburghii fruit wine

[0114] The fermentation process is described in 3.1 above, and the physical and chemical index testing is described in 3.2.2 above.

[0115] Based on the results of the single factor experiment, a response surface optimization experiment for C6-C18 combined fermentation was developed. The response surface optimization experiment factor level conditions are shown in Table 3, and the response surface optimization experiment plan is shown in Table 4:

[0116] Table 3 Factors and levels of response surface optimization experiment

[0117] level A. Fermentation temperature (℃) B. Fermentation time (d) C Initial sugar content (°BX) -1 18 8 24 0 21 10 26 1 24 12 28

[0118] Table 4 Response surface optimization experiment plan

[0119]

[0120]

[0121] 5 Data Processing

[0122] The phylogenetic tree was drawn using mega 11, and analysis and drawing were performed using EXCEL 2012, SPSS25.0, and Origin 2024 software. The response surface experiment data were analyzed using Design Expert 13.

[0123] Results and Analysis

[0124] 1. Strain screening results

[0125] 1.1 Colony morphology

[0126] After separation and purification, two strains C6 and C18 were obtained. Their colony morphology and microscopic morphology are as follows Figure 1 As shown, both strains exhibit typical yeast morphology on YPD plates, with a milky white, moist, smooth, shiny surface that is easily lifted. Microscopic examination revealed that the cells of strains C6 and C18 are spherical and reproduce by budding, but the cell diameter of strain C6 is larger than that of strain C18.

[0127] 1.2 Molecular Biological Identification

[0128] After PCR cloning and DNA sequencing, BLAST comparison was performed on the NCBI database and the tree was constructed using MEGA 11 software. Figure 2 As shown: C6 is Saccharomyces cerevisiae, C18 is Starmerella bacillaris.

[0129] The ITS sequence of the above-mentioned Saccharomyces cerevisiae C6 strain is shown in SEQ ID NO: 1.

[0130] SEQ ID NO: 1 ITS sequence of Saccharomyces cerevisiae C6 strain:

[0131] TGCCTATCCCCAAACGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCC TTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA ACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGAATCTCGCATTTCACTGGGCCAGCAT CAGTTTTGGTGGCAGGATAATCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGCCCGTCTTGACCCCCGGGACCA

[0132] The C18 portfolio of the C18 or ITS portfolio is SEQ ID NO:2.

[0133] SEQ ID NO:2 Connector C18 Contact ITS:

[0134]

[0135] 2 strain tolerance results

[0136] 2.1 High concentration glucose tolerance test

[0137] In the process of fruit wine brewing, the sugar content of the initial fermentation liquid is generally high, so it is necessary to examine the strain's tolerance to glucose. In the strain tolerance test to different concentrations of glucose, such as Figure 3 As shown, although the C18 strain had an OD of 600 The growth of strains C6 and C18 was good in the range of 10% to 30% glucose concentration. The bacterial solution concentration OD 600 >1.0.

[0138] 2.2 Ethanol tolerance test

[0139] During the fermentation of fruit wine, ethanol is produced, which has a certain impact on the growth of the strain. Therefore, the strain used for fruit wine fermentation must have a certain tolerance to alcohol. Figure 4 As shown, the growth of strain C6 was optimal when the alcohol addition rate was 2%-8% (OD 600 >1.0), and the growth was poor when the alcohol concentration was 10% (OD 600 <1.0); C18 strain had the best growth condition when the alcohol addition amount was 2% (OD 600 >1.0), and worse when the addition amount is 4%-8% (OD 600 >0.45), and almost no growth (OD 600 <0.3).

[0140] 2.3SO2 tolerance test

[0141] In the fermentation of fruit wine, adding a certain amount of SO2 can inhibit the growth of harmful microorganisms and protect the color. The results of this experiment show that ( Figure 5 ): C6 and C18 strains grew well in the culture medium with different amounts of SO2 added (40 mg / L-200 mg / L) (OD 600 >1.0).

[0142] 2.4 pH environmental tolerance test

[0143] The appropriate pH value plays a good role in promoting the brewing of fruit wine. In most cases, the pH value of the brewing environment of fruit wine is acidic. The results of this test are as follows Figure 6As shown in the figure, the C6 strain grows well in an environment with a pH value of 2.5 to 3.5, and the C18 strain grows best at a pH value of 3. This result is also consistent with the growth of yeast.

[0144] 2.5 Culture temperature tolerance test

[0145] Culture temperature is one of the important factors affecting yeast growth. High temperature will cause yeast death, and low temperature will inhibit yeast growth. Therefore, yeast tolerance to culture temperature is very important. The results of this experiment are as follows: Figure 7 As shown: C6 strain can tolerate the culture temperature of 18℃~30℃, and its OD 600 >1.0. C18 strain at 21℃-30℃, OD 600 >1.0, but at 18℃, the growth condition was slightly worse.

[0146] 3. Strain growth curve and safety

[0147] The growth of the strain Figure 8 As shown: Both strains have typical microbial growth characteristics: C6 strain has strong growth activity, is in the logarithmic growth phase from 5 to 13 hours, and is in the stable phase after 13 hours; the growth curve of C18 strain is significantly different from that of C6 strain, entering the logarithmic growth phase later, with a delay phase from 0 to 20 hours and a logarithmic growth phase from 20 to 31 hours.

[0148] The results of the H2S production test of the C6 and C18 strains showed that the C6 strain did not produce H2S, and the C18 strain produced a very small amount of H2S, indicating that the C6 and C18 strains are suitable for fruit wine production; the antibacterial test of the C6 and C18 strains against Escherichia coli and Staphylococcus aureus was carried out using Oxford cups, and the results showed that both strains had no inhibitory effect on Escherichia coli and Staphylococcus aureus; the hemolysis test of the C6 and C18 strains was carried out using blood agar plates, and the results showed that both strains had no hemolytic effect, indicating that the C6 and C18 strains can be safely used in food production.

[0149] Application of 4C6-C18 strain complex fermentation in roxburghii fruit wine

[0150] This experiment compared the fermentation of roxburghii wine using a combination of C6 and C18, a single C18 strain, a single C6 strain, and an Angel Wine Yeast-SY fermentation. Physical and chemical indicators and volatile aroma components were measured for each treatment.

[0151] 4.1 Determination of physical and chemical indicators of roxburghii wine fermented by different strains

[0152] The results of various physical and chemical indicators showed (Table 5) that the sea buckthorn wines obtained by the three treatments all met the requirements for fruit wine in the "Green Food Fruit Wine" (NY / T1508-2017).

[0153] Table 5 Physical and chemical index determination of roxburghii wine fermented by different strains

[0154]

[0155] 4.2 Analysis of volatile aroma compounds in roxburghii wine fermented by different strains

[0156] The GCMS analysis results are shown in Table 6. Figure 9 The results showed that the rosa roxburghii wine fermented by the strain C18 contained 27 volatile compounds, of which the relative content of alcohols was the highest at 47.967%, followed by esters at 38.970%, and other compounds at 13.063%. Among them, the relative content of phenylethanol was the highest at 33.452%, followed by isopentanol at 10.292% and ethyl laurate at 8.771%. The rosa roxburghii wine fermented by the strain C6 contained 39 volatile compounds, of which the relative content of esters was the highest at 45.819%, followed by acids at 33.727% and ethers at 15.246%. Among them, the relative content of n-decanoic acid was the highest at 14.996%, followed by octanoic acid at 11.654% and ethyl decanoate at 11. 359%; the sea buckthorn wine fermented by Angel-SY strain has a total of 38 volatile substances, with the largest relative content of acids (40.188%), esters 36.479%, and alcohols 14.679%, of which the largest relative content is n-decanoic acid 20.836%, followed by octanoic acid 14.869% and ethyl decanoate 13.168%; the sea buckthorn wine fermented by C6-C18 composite bacteria has a total of 30 volatile substances, with the largest relative content of esters (68.527%), acids 17.333%, and ethers 10.584%, of which the largest relative content is ethyl decanoate 26.551%, followed by ethyl laurate 14.228% and ethyl octanoate 11.335%.

[0157] Esters are one of the most important aroma components in fruit wine, playing a decisive role in its aroma characteristics, flavor complexity, and sensory quality. High-quality fruit wines are usually rich in esters, which can bring a pleasant aroma and taste. Among the four differently treated sea buckthorn wines, the one fermented with the C6-C18 composite inoculant had the highest relative content of esters (68.527%), and the highest relative content of all volatile substances was ethyl decanoate, accounting for 26.551%. The relative content of ethyl decanoate in the sea buckthorn wine fermented with the C6 strain was 11.359%, the relative content of ethyl decanoate in the sea buckthorn wine fermented with the C18 strain was 6.425%, and the relative content of ethyl decanoate in the sea buckthorn wine fermented with the Angel-SY strain was 13.168%.

[0158] Table 6 Summary of volatile aroma substances in roxburghii wine fermented by different strains

[0159]

[0160]

[0161] Optimization of production process of roxburghii wine fermented with 5C6-C18 composite inoculant

[0162] 5.1 Optimization of single factor experiment process for roxburghii wine

[0163] 5.1.1 Effects of different C18 inoculation times on alcohol content, sensory evaluation, and ethyl decanoate content in roxburghii wine

[0164] During the fermentation process of sea buckthorn wine, since brewing yeast produces a large amount of alcohol, some non-brewing yeast may be inactivated at high alcohol concentrations, affecting the overall quality of the wine. This patent uses non-brewing yeast C18 inoculated at different fermentation times to test the effects of different C18 inoculation times on sea buckthorn wine. The results are as follows: Figure 10 、 Figure 11 As shown in the figure, the alcohol content and sensory evaluation of the roxburghii wine were the best when C6 and C18 were inoculated simultaneously into the roxburghii fermentation liquid. As the interval between the inoculation of C18 increased, the alcohol content and sensory evaluation scores decreased. At the same time, the relative content of ethyl caprate in the roxburghii wine inoculated with both C6 and C18 was the highest.

[0165] 5.1.2 Effects of different inoculation ratios of C6 and C18 on alcohol content, sensory evaluation, and ethyl decanoate content in roxburghii wine

[0166] Different inoculation ratios of composite bacteria in the process of fruit wine fermentation will also have an important impact on the wine body. This patent tests the effects of different inoculation ratios on sea buckthorn fruit wine. Figure 12 、 Figure 13As shown in the results: there was no significant difference in the alcohol content of the sea buckthorn wine obtained with the five different inoculation ratios; 1:1 was the best in sensory evaluation, and there was no significant difference between 2:1, 2.5:1, and 3:1; the relative content of ethyl caprate in the sea buckthorn wine was the most significant when the inoculation ratio was 1:1.

[0167] 5.1.3 Effect of fermentation temperature on alcohol content, sensory evaluation and ethyl caprate content in roxburghii wine

[0168] The fermentation temperature of fruit wine is one of the important factors affecting the quality of fruit wine. The results of the fermentation of roxburghii fruit wine at different temperature gradients are as follows: Figure 14 Figure 15 As shown, the sensory evaluation scores of sea buckthorn wine fermented at 18-24°C were the highest, all ≥90 points, while those at 27°C and 30°C were lower. This indicates that the higher the fermentation temperature, the lower the sensory evaluation of the sea buckthorn wine. As the temperature increases, the alcohol content of the wine also increases. The sensory evaluation was optimal at 21°C, where the alcohol content reached 7.9% vol. The sea buckthorn wine fermented at 18°C ​​had the highest ethyl decanoate content, followed by that at 21°C.

[0169] 5.1.4 Effect of fermentation time on alcohol content, sensory evaluation and ethyl decanoate content in roxburghii wine

[0170] The different fermentation times of fruit wine will determine the quality and taste of the wine. If the fermentation time is too long, the wine will become sour, and if the time is too short, the alcohol content will be too low. Therefore, it is essential to determine the optimal fermentation time for the wine. Figure 16 、 Figure 17 It can be seen that the best sensory evaluation of sea buckthorn wine at 10 days of fermentation is 90.7 points. As the fermentation time increases, the sensory evaluation becomes lower and lower; the alcohol content becomes higher and higher as the fermentation time increases; the relative content of ethyl caprate in the wine also increases as the fermentation time increases.

[0171] 5.1.5 Effect of initial fermentation sugar content on alcohol content, sensory evaluation, and ethyl decanoate content in roxburghii wine

[0172] The effects of different initial fermentation concentrations on the effect of roxburghii wine are shown in the following table: Figure 18 、 Figure 19 As shown in the figure, as the initial sugar content increases, the alcohol content of the roxburghii wine increases, the sensory evaluation score also increases, and the relative content of ethyl caprate increases. When the initial sugar content is 26°BX, the sensory evaluation score is the highest, with 94 points and an alcohol content of 8.8%vol.

[0173] 5.2 Response surface experiment for optimization of roxburghii wine fermentation process

[0174] 5.2.1 Response surface test results and variance analysis of roxburghii wine

[0175] On the basis of the results of the single-factor experiment, the inoculation ratio of C6 to C18 was set to 1:1, and C6 and C18 were inoculated simultaneously. Fermentation temperature (A), fermentation time (B), and initial sugar content (C) were selected as independent variables, and sensory score (Y) was used as the response value. A three-factor three-level response surface experiment was conducted. The Box-Behnken experimental design and results are shown in Table 7, and the variance analysis results are shown in Table 8.

[0176] The data in Table 7 were fitted with a quadratic multinomial regression using Design Expert 13.0 software, and the quadratic multinomial regression equation between the sensory score of the compound roxburghii wine and the three factors was obtained as follows:

[0177] Y=90.72-4.62A+0.9875B+1.91C-1.55AB+4.90AC+3.43BC+0.3025A 2 -5.37B 2 -4.07C 2

[0178] As shown in Table 8, the regression model is extremely significant (P = 0.0026 < 0.01), the lack of fit term is not significant (P > 0.05), and the coefficient of determination R 2 =0.9311, adjusted coefficient of determination R 2 Adj =0.8426, indicating that the regression model has a good fit and a significant linear relationship between the independent variable and the response value, which can be used to predict the fermentation process of sea buckthorn wine with the C6-C18 composite strain.

[0179] From the P value, we can see that the linear term A, the interaction term AC and the quadratic term B 2 The effect on Y value is extremely significant (P<0.01), the interaction term BC, the quadratic term C 2 The influence on Y value was significant (P<0.05). According to the F value, the order of influence of each factor on the result was: fermentation temperature>initial sugar content>fermentation days.

[0180] Table 7 Box-Behnken experimental design and results of C6-C18 combined fermentation process optimization of roxburghii wine

[0181]

[0182]

[0183] Table 8 Analysis of variance of regression model

[0184] Sources of variance sum of squares degrees of freedom mean square F-number P-value Significance Model 562.59 9 62.51 10.51 0.0026 ** A-Temperature 171.12 1 171.12 28.78 0.0010 ** B-Fermentation days 7.80 1 7.80 1.31 0.2896 C-Sugar 29.26 1 29.26 4.92 0.0620 AB 9.61 1 9.61 1.62 0.2442 AC 96.04 1 96.04 16.15 0.0051 ** BC 46.92 1 46.92 7.89 0.0262 * A2 0.3853 1 0.3853 0.0648 0.8064 B2 121.53 1 121.53 20.44 0.0027 ** C2 69.83 1 69.83 11.75 0.0110 * residual 41.62 7 5.95 Lack of Fit 32.37 3 10.79 4.67 0.0854 Pure error 9.25 4 2.31 Total difference 604.20 16

[0185] “*” indicates a significant effect on the results (P<0.05); “**” indicates an extremely significant effect on the results (P<0.01)

[0186] 5.2.2 Response surface interaction analysis

[0187] The steepness of the response surface and the shape of the contour lines can reflect the effect of the interaction between factors on the sensory score. The response surface and contour lines of the effect of the interaction between factors on the sensory score are shown in Figure 2. Figure 20 .Depend on Figure 20 It can be seen that the slope of the interaction response surface between fermentation time (B) and initial fermentation sugar content (C) is steeper, and the contour line is close to an ellipse, indicating that the interaction between BC factors is strong. This result is consistent with the results of significance and variance analysis.

[0188] 5.2.3 Response surface validation experiment

[0189] Taking the sensory evaluation of sea buckthorn wine as the evaluation index, the optimal fermentation process conditions of sea buckthorn wine were obtained according to the analysis of Design-Expert 11.1.0 software: fermentation temperature (A) 18℃, fermentation time (B) 10.2751 days, and initial sugar content of fermentation 25.3834°BX. The sensory evaluation prediction value of sea buckthorn wine obtained under these process conditions was 96.3 points. Considering the feasibility of actual operation, the optimal fermentation process parameters were revised to fermentation temperature 18℃, initial sugar content 25°BX, and fermentation time 10d. The verification test was carried out according to the revised fermentation conditions, and the average actual value of the sensory evaluation of the test results was 93.2±1.814( Figure 21 ), the error is smaller than the theoretical value predicted by the model. Therefore, it is feasible to use this model to optimize the fermentation process conditions of sea buckthorn wine.

[0190] Table 9 Physical and chemical indicators of verification test

[0191]

[0192] 6. Conclusion

[0193] The applicant isolated two yeast strains from wild sea buckthorn fermentation broth: Starmerella bacillaris and Saccharomyces cerevisiae, and compounded them to obtain a composite fermentation agent. The agent can produce high yields of ethyl caprylate and is used in sea buckthorn wine brewing, thereby increasing the relative content of ethyl caprylate in sea buckthorn wine and improving the flavor quality of sea buckthorn wine, providing technical support for the industrial development of sea buckthorn wine.

[0194] Finally, it should be noted that the above embodiments are merely representative examples of the present invention. Obviously, the technical solutions of the present invention are not limited to the above embodiments and are subject to numerous variations. All variations that can be directly derived or conceived by a person of ordinary skill in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.

Claims

1. A brewer's yeast, characterized in that It is deposited in the China Center for Type Culture Collection with the accession number: CCTCC M2025923 and the deposit date: April 27, 2025.

2. Use of the brewer's yeast according to claim 1 in brewing.

3. The use according to claim 2, characterized in that The winemaking aspect is the fermentation of sea buckthorn fruit wine.

4. A Candida zemplina, characterized in that It is deposited in the China Center for Type Culture Collection with the accession number: CCTCC M 2025924 and the deposit date: April 27, 2025.

5. Use of the Candida zemplina according to claim 4 in winemaking.

6. The use according to claim 5, characterized in that The winemaking aspect is the fermentation of sea buckthorn fruit wine.

7. A composite fermentation agent for increasing the relative content of ethyl caprate in roxburghii wine, characterized in that: The method comprises mixing any one or more of the saccharomyces cerevisiae described in claim 1 and the Candida zemplina described in claim 4 in any proportion.

8. The composite fermentation agent for improving the relative content of ethyl caprate in roxburghii wine according to claim 7, wherein The ratio of the saccharomyces cerevisiae to the Candida zemplina is (1-3):

1.

9. Application of the composite fermentation agent for increasing the relative content of ethyl caprate in roxburghii wine according to claim 7 in winemaking.

10. A fermentation method for roxburghii fruit wine, characterized in that: The fermentation agent according to claim 7 is used, the fermentation temperature is 18-24°C, the fermentation time is 10 days, and the initial sugar content of the fermentation is 26°BX.

Images