Engineering flora for synthesizing starch as well as construction method and application of engineering flora

Abstract

The invention relates to an engineering flora for exocytosis synthesis of starch and a construction method and application thereof. The engineering bacteria comprise sucrose synthesis engineering bacteria and / or starch synthesis engineering bacteria, and the sucrose synthesis engineering bacteria over-express SUF1, SPP and SPS genes; the starch synthesis engineering bacteria overexpress at least one of AMS genes or BASPP and alpha GP genes. A brand new strategy for synthesizing starch by microorganisms is designed, a sucrose synthesis path is introduced and further strengthened to obtain the sucrose synthesis engineering bacteria, and a cheap and low-carbon raw material can be converted into sucrose; by introducing a starch synthesis path, a starch synthesis engineering bacterium is obtained, and cane sugar can be converted into extracellular starch. By utilizing double-bacterium synergy of sucrose synthesis engineering bacteria and starch synthesis engineering bacteria, extracellular secretion synthesis of starch is realized by utilizing a cheap carbon source in microorganisms, and a low-cost, safe and efficient starch production method is created.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and relates to an engineering bacterial group for synthesizing starch, a construction method thereof and an application thereof. Background Art

[0002] Carbohydrates, such as glucose, sucrose, and starch, are the most abundant and widespread organic substances in nature; they are also the fundamental building blocks of all living organisms. Starch is a fundamental food for life and also provides a key raw material for bio-industries such as papermaking and biodegradable materials, primarily derived from plant sources.

[0003] Starch biosynthesis involves the fixation of CO2, followed by the synthesis of triose phosphate (TP) through a series of enzymatic reactions. TP is then transported to the chloroplast to synthesize fructose 6-phosphate (F6P), which is then converted into glucose 6-phosphate (G6P) and glucose 1-phosphate (G1P). Subsequently, G1P is converted to adenosine diphosphate glucose (ADPG) catalyzed by ADP-glucose pyrophosphorylase (AGPase). ADPG is then converted into amylose and amylopectin through the catalysis of starch synthase (SS), branching enzyme (BE), and debranching enzyme (DBE). In addition, alpha-glucan phosphorylase (αGP) can synthesize amylose using G1P as a substrate. In addition to G6P being converted into G1P, disaccharides such as sucrose, cellobiose and trehalose can also be broken down to obtain G1P.

[0004] Currently, low-carbon compounds (C n≦3 ) has attracted widespread attention in the synthesis of carbohydrates. 1-3 Compounds can provide a sustainable solution for synthesizing starch, which can reduce production costs and improve production capacity. Therefore, the development and utilization of microorganisms to synthesize starch with low-carbon compounds is of great significance to the production and application of starch. Summary of the Invention

[0005] In response to the deficiencies of the existing technology and actual needs, the present invention provides an engineered bacterial community for synthesizing starch, a construction method thereof, and an application thereof, and designs a new biosynthetic strategy in order to achieve the synthesis of starch using inexpensive substrates.

[0006] To achieve this object, the present invention adopts the following technical solutions:

[0007] In a first aspect, the present invention provides an engineered bacterial population for extracellular secretion of synthesized starch, wherein the engineered bacterial population includes sucrose-synthesizing engineered bacteria and / or starch-synthesizing engineered bacteria, wherein the sucrose-synthesizing engineered bacteria overexpress SUF1, SPP, and SPS genes; and the starch-synthesizing engineered bacteria overexpress a starch synthesis pathway, wherein the starch synthesis pathway includes: (1) the AMS gene (pathway 1) or (2) the BASPP and αGP genes (pathway 2).

[0008] The present invention designs a synthesis pathway for extracellular starch, synthesizes extracellular starch using low-carbon compounds (such as methanol) through a mixed bacteria system, and develops a safe and efficient method for synthesizing extracellular starch.

[0009] Preferably, the copy number of the SUF1, SPP and SPS genes is 2.

[0010] Preferably, the sucrose-synthesizing engineered bacteria also overexpress UGP1, DAS1 and CAT1 genes.

[0011] Preferably, the sucrose-synthesizing engineered bacteria further express fused fructose 1,6-bisphosphatase (FBP) and sucrose phosphate synthase (SPS).

[0012] Preferably, the starting strain of the sucrose synthesis engineering bacteria includes at least one of Pichia pastoris and Saccharomyces cerevisiae.

[0013] Preferably, the starch-synthesizing engineered bacteria overexpress secretory AMS (pathway 1) or BASPP, αGP (pathway 2).

[0014] Preferably, the starting strain of the starch-synthesizing engineered bacteria includes at least one of Escherichia coli, Pichia pastoris or Saccharomyces cerevisiae.

[0015] Preferably, the nucleic acid sequence of the SUF1 gene includes the sequence shown in SEQ ID NO.1.

[0016] Preferably, the nucleic acid sequence of the SPP gene includes the sequence shown in SEQ ID NO.2.

[0017] Preferably, the nucleic acid sequence of the SPS gene includes the sequence shown in SEQ ID NO.3.

[0018] Preferably, the nucleic acid sequence of the AMS gene includes any one of the sequences shown in SEQ ID NO.4 to SEQ ID NO.14.

[0019] Preferably, the nucleic acid sequence of the BASPP gene includes the sequence shown in SEQ ID NO.15 and / or SEQ ID NO.16.

[0020] Preferably, the nucleic acid sequence of the αGP gene includes the sequence shown in SEQ ID NO.17 and / or SEQ ID NO.18.

[0021] In a second aspect, the present invention provides a method for constructing an engineered bacterial colony for synthesizing starch according to the first aspect, the method comprising:

[0022] Overexpressing SUF1, SPP and SPS genes in the starting strain to obtain the sucrose-synthesizing engineered bacteria;

[0023] The starch-synthesizing engineered bacteria are obtained by overexpressing the AMS gene (path 1) or the BASPP and αGP genes (path 2) in the starting strain.

[0024] It is understood that based on the genetic modification strategy designed in the present invention, the corresponding engineered bacteria can be prepared using genetic modification methods commonly used in the art.

[0025] In a third aspect, the present invention provides use of the engineered bacterial colony for synthesizing starch described in the first aspect in producing starch.

[0026] In a fourth aspect, the present invention provides a method for producing starch, comprising:

[0027] Cultivate the engineered bacteria for synthesizing starch described in the first aspect.

[0028] Preferably, the culture method includes any one of the following:

[0029] (1) using the sucrose synthesis engineering bacteria and starch synthesis engineering bacteria for mixed culture;

[0030] (2) using the sucrose-synthesizing engineered bacteria to mix and culture with any bacterial strain that can synthesize starch from sucrose;

[0031] (3) Using any strain capable of synthesizing sucrose to mix and culture with the starch synthesis engineering bacteria.

[0032] In addition, for the starch synthesis process, AMS (pathway 1) or BASPP, αGP (pathway 2) enzymes are used to achieve extracellular synthesis of starch. Engineered bacteria of AMS (pathway 1) or BASPP, αGP (pathway 2) enzymes can be used, or the corresponding enzymes can be directly added to the culture medium.

[0033] Compared with the prior art, the present invention has at least the following beneficial effects:

[0034] The present invention designs a novel strategy for microbial starch synthesis. Using strain 1 as the starting strain, which can utilize an inexpensive carbon source, the sucrose synthesis pathway is introduced and further enhanced to produce an engineered sucrose-synthesizing bacterium, capable of converting inexpensive, low-carbon feedstocks into sucrose. Using strain 2 as the starting strain, which can utilize sucrose, starch synthesis pathways 1 or 2 are introduced to produce an engineered starch-synthesizing bacterium, capable of converting sucrose into extracellular starch. By utilizing the synergistic effects of the sucrose-synthesizing and starch-synthesizing bacteria, the extracellular secretion synthesis of starch is achieved in microorganisms using an inexpensive carbon source, creating a low-cost, safe, and efficient starch production method. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 Schematic diagram of the strategy for secreting and synthesizing starch by microorganisms of the present invention.

[0036] Figure 2 Schematic diagram of the pathway for Pichia pastoris to synthesize sucrose using methanol as raw material.

[0037] Figure 3 This is the sucrose production result of the Pichia pastoris strain with modified sucrose synthesis pathway.

[0038] Figure 4 This is the test result of Escherichia coli expressing AMS from different species using sucrose as raw material to synthesize starch.

[0039] Figure 5 This is a graph showing the activity test results of AMS wild-type protein and mutants.

[0040] Figure 6 This figure shows the results of secreted AMS wild-type protein and mutants synthesizing starch using sucrose as raw material.

[0041] Figure 7 This is a diagram showing the results of the secretory BASPP-αGP pathway synthesizing starch using sucrose as raw material.

[0042] Figure 8 The results of testing different IPTG concentrations for induction of the secretory BASPP-αGP pathway.

[0043] Figure 9 This is the result of synthesizing starch by mixing MB406 strain and AMS-R226N expression strain with methanol as carbon source. DETAILED DESCRIPTION

[0044] The technical solution of the present invention will be further described below with reference to the accompanying drawings and through specific embodiments. However, the following examples are merely simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0045] If no specific techniques or conditions are specified in the examples, the experiments were carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0046] The present invention designs a new strategy for synthesizing starch by microorganisms, the schematic diagram of which is shown in FIG. Figure 1 As shown, a strain (such as Pichia pastoris) that can utilize cheap carbon sources (such as methanol, formic acid, ethanol, acetic acid, glycerol and other low-carbon chain chemicals) is used as a starting strain, and a sucrose synthesis pathway is introduced into it (overexpression of SUF1, SPP and SPS genes), and the sucrose synthesis pathway is further strengthened (fusion expression of FBP and SPS, further introduction of a copy of SUF1, SPS, SPP genes, overexpression of UGP1, overexpression of DAS1 and CAT1) to obtain sucrose-synthesizing bacteria; using Escherichia coli as a starting strain, AMS or BASPP and αGP are overexpressed to obtain starch-synthesizing bacteria, which can synthesize starch from sucrose; using the synergistic effect of the two bacteria, the microbial extracellular secretion synthesis of starch is realized in microorganisms using cheap carbon sources, creating a low-cost, safe and efficient starch production method.

[0047] Example 1

[0048] In this example, an engineered strain of Pichia pastoris was constructed.

[0049] (1) The sucrose synthesis pathway was introduced into Pichia pastoris to synthesize sucrose using methanol as raw material.

[0050] Using the genome of Pichia pastoris GS115 as a template, primers 1-1 and 1-2, primers 1-3 and 1-4, primers 1-5 and 1-6, primers 1-7 and 1-8, primers 1-9 and 1-10, primers 1-11 and 1-12, primers 1-13 and 1-14, and primers 1-15 and 1-16 were used to amplify the II-4 upstream homology arm, promoter PGI1p, terminator GAS1t, promoter ADH2t, promoter GAP1p, promoter TEF1p, terminator PMP20t and II-4 downstream homology arm, respectively, for a total of 8 fragments. Then, the codon-optimized synthesized SUF1 (SEQ ID NO.1), sucrose phosphate phosphatase SPP (SEQ ID NO.2), and sucrose phosphate synthase SPS (SEQ ID NO.3) sequences were used as templates, and primers 1-17 and 1-18, primers 1-19 and 1-20, and primers 1-21 and 1-22 were used to obtain SUF1, SPP, and SPS, respectively, by PCR. The above 8 fragments were fused with SUF1, SPP, and SPS by PCR to obtain insert fragments, wherein the PCR amplification conditions were 2× Max Master Mix enzyme, pre-denaturation at 95°C for 30s, denaturation at 95°C for 15s, annealing at 56°C for 15s, extension at 72°C for 3min, 35 cycles from denaturation to extension, and final extension at 72°C for 5min.

[0051] A single clone of wild-type yeast (Lab001, derived from Pichia pastoris GS115, genotype, GS115:ΔKu70::Rad52, RAD59 (P.pas), GS115 was purchased and preserved in the laboratory) was cultured in 2 mL YPD liquid medium and placed in a shaker at 30°C at 250 rpm for 12 h to activate the strain. The activated strain was transferred to 40 mL YPD liquid medium to a starting OD of 0. 600 The culture medium was placed in a shaker at 30°C and cultured at 200 rpm for 4-6 hours until the OD 6000.6-1.0; centrifuge at 3000 rpm for 5 min, remove the supernatant; add 40 mL of pure water, centrifuge at 3000 rpm for 5 min, remove the supernatant; add 4.5 mL of BEDS solution (containing 10 mM N, N-hydroxyethylglycine-sodium hydroxide, 3% (v / v) ethylene glycol, 5% (v / v) DMSO, 1 M sorbitol, pH 8.3) and 0.5 mL of dithiothreitol (DTT, 1 M) and resuspend, incubate on a shaker at 30°C for 5 min, centrifuge at 3000 rpm for 5 min, remove the supernatant; add 1 mL BEDS: Aliquot 100 μL of the prepared Saccharomyces cerevisiae competent cells into a 1.5 mL centrifuge tube. Add 1 μg of the recombinant plasmid containing the II-4 site and the insert fragment, perform electroporation (1800 V, 5 ms), add 1 mL of YPD:sorbitol (1:1) resuscitation solution, and culture at 30°C for 1 hour. Then, spread evenly on YPD+Hyg (hygromycin) solid medium and finally culture at 30°C for 72 hours to obtain the recombinant strain. Single colonies were picked and cultured overnight in 1 mL of YPD liquid medium. The genome was extracted and verified by PCR using primers 1-25 and 1-26 to obtain the recombinant Pichia pastoris strain MB002 containing the sucrose biosynthesis pathway.

[0052] Table 1 Primer list

[0053]

[0054]

[0055] (2) Strengthening the sucrose synthesis pathway in Pichia pastoris and improving the conversion rate of sucrose to methanol

[0056] Modular transformation was carried out on genes related to the sucrose synthesis pathway, including: a. Strengthening the expression of terminal heterologous enzymes; b. Strengthening the synthesis of the precursor uridine diphosphate glucose (UDPG); c. Strengthening the synthesis of the precursor fructose 6-phosphate (F6P).

[0057] Starting with the aforementioned MB002 strain, a fusion expression of fructose 1,6-bisphosphatase (FBP) and sucrose phosphate synthase (SPS) was constructed, using (G4S)4 as an intermediate linker. Using the yeast genome as a template, PCR was performed using primers 2-1 and 2-2, primers 2-3 and 2-4, primers 2-5 and 2-6, primers 2-7 and 2-8, and primers 2-9 and 2-10, respectively, to generate the upstream homology arm II-6-up, downstream homology arm II-6-down, promoter GAP, terminator ADH, and FBP gene fragments. PCR was then performed using primers 2-11 and 2-12, using the SPS (SEQ ID NO. 3) sequence as a template, to generate the SPS gene fragment. These six fragments were then subjected to fusion PCR to generate the insert. PCR amplification conditions were the same as those described in the experimental steps above. Gene insertion and verification: The recombinant plasmid containing the II-6 site and the inserted fragment were used to transform Pichia pastoris MB002. The experimental steps were the same as above. Primers 2-13 and 2-14 were used for verification to obtain the recombinant Pichia pastoris strain MB118 expressing the fusion of FBP and SPS.

[0058] Starting from the MB118 strain, one copy of the SUF1, SPS, and SPP genes was introduced on this basis. Using the genome of GS115 as a template, primers 2-15 and 2-16, primers 2-17 and 2-18, primers 2-19 and 2-20, primers 2-21 and 2-22, primers 2-23 and 2-24, primers 2-25 and 2-26, primers 2-27 and 2-28, and primers 2-29 and 2-30 were used to amplify the II-7 upstream homology arm, promoter GAPp, terminator ADH2t, promoter PGI1p, terminator PMP20t, promoter TEF1p, terminator DAS1t, and II-7 downstream homology arm, respectively, for a total of 8 fragments. Primers 2-31 and 2-32, 2-33 and 2-34, and 2-35 and 2-36 were then used to amplify the SUF1, SPP, and SPS gene fragments, respectively. These 11 fragments were subjected to fusion PCR to obtain inserts. PCR amplification conditions were the same as those described above. Gene insertion and verification: Pichia pastoris MB118 was transformed with the recombinant plasmid containing the II-7 site and the insert fragments, following the same experimental procedures as described above. Verification was performed using primers 2-37 and 2-38, resulting in recombinant Pichia pastoris strain MB210 with one additional copy of the SUF1, SPP, and SPS genes.

[0059] Starting with strain MB210, we overexpressed glucose-1-phosphate uridyltransferase (UGP1). Using the GS115 genome as a template, primers 2-39 and 2-40, 2-41 and 2-42, 2-43 and 2-44, 2-45 and 2-46, and 2-47 and 2-48 amplified the II-5 upstream homology arm, the promoter GAPp, UGP1, ADHt, and the II-5 downstream homology arm, respectively. These five fragments were subjected to fusion PCR to generate the insert. PCR amplification conditions were the same as those described above. Gene insertion and verification: Pichia pastoris MB210 was transformed with the recombinant plasmid containing the II-5 locus and the insert fragment, following the same experimental procedures as described above. Verification was performed using primers 2-49 and 2-50, resulting in the recombinant Pichia pastoris strain MB306 overexpressing the UGP1 gene.

[0060] Starting with strain MB306, dihydroxyacetone synthase (DAS1) and catalase (CAT1) genes were overexpressed. Using the GS115 genome as a template, primers 2-51 and 2-52, 2-53 and 2-54, 2-55 and 2-56, 2-57 and 2-58, 2-59 and 2-60, 2-61 and 2-62, 2-63 and 2-64, and 2-65 and 2-66 were used to amplify the II-9 upstream homology arm, promoter GAPp, DAS1, terminator GAPDHt, promoter GPM1p, CAT1, terminator DAS1t, and II-9 downstream homology arm, respectively. Fusion PCR was performed on these eight fragments to generate the insert. Gene insertion and verification: The recombinant plasmid containing the II-9 site and the insert were transformed into Pichia pastoris MB306 using the same experimental steps as above. Primers 2-67 and 2-68 were used for verification to obtain the recombinant Pichia pastoris strain MB406 overexpressing DAS1 and CAT1.

[0061] Table 2 Primer sequences

[0062]

[0063]

[0064]

[0065] Pea sucrose transporter SUF1 gene, codon-optimized sequence SEQ ID NO.1:

[0066]

[0067] The SPP gene derived from Synechocystis sp, the codon-optimized sequence SEQ ID NO.2:

[0068] ATGAGACAATTGTTGTTGATTTCTGATTTGGATAACACTTGGGTCGGCGATCAACAAGCTTTGGAACATTTGCAAGAATACTTGGGTGACAGAAGAGGTAACTTTTACTTGGCTTACGCTACTGGTAGATCCTACCACTCTGCTAGAGAATTGCAAAAGCAAGTTGGTTTGATGGAACCAGATTACTGGTTGACTGCTGTTGGTTCTGAAATCTATCATCCAGAAGGTTTAGATCAACACTGGGCTGATTACTTGTCCGAACATTGGCAAAGAGATATTTTGCAAGCTATTGCTGATGGTTTTGAAGCCTTGAAGCCACAATCTCCATTAGAACAAAACCCATGGAAAATTTCTTATCACTTAGATCCACAAGCTTGTCCAACCGTTATTGATCAATTGACCGAAATGTTGAAGGAAACTGGTATTCCAGTTCAAGTTATTTTCTCCTCTGGTAAAGATGTTGACTTGTTACCACAACGTTCTAATAAGGGTAACGCTACTCAATACTTGCAACAACATTTGGCTATGGAACCATCTCAAACTTTGGTTTGTGGTGACTCTGGTAACGATATTGGTTTGTTTGAAACTTCTGCTAGAGGTGTTATTGTTAGAAACGCTCAACCAGAATTGTTGCATTGGTACGATCAATGGGGTGACTCTAGACATTACAGAGCTCAATCTTCTCATGCTGGTGCTATCTTGGAAGCTATTGCTCATTTTGATTTCTTGTCTTAA。

[0069] The SPS gene derived from Synechocystis sp, the codon-optimized sequence SEQ ID NO.3:

[0070]

[0071] Example 2

[0072] This example uses the engineered bacteria constructed in the example to synthesize sucrose.

[0073] MB002, MB118, MB210, MB306, and MB406 strains were selected and activated overnight in YPD. The activated bacteria were then inoculated into 20 mL of Delft inorganic salt medium (containing 7.5 g / L (NH4)2SO4, 14.4 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, pH 6.0) containing 2% methanol. The initial OD 600 0.2, 30°C, 200 rpm, incubate for 120 h, take 1 mL sample, centrifuge at 13000 rpm for 10 min, transfer the supernatant to a new microcentrifuge tube (EP tube) for analysis of extracellular sucrose content. After washing the cell pellet twice with water, resuspend the cells in 80% ethanol and incubate at 60°C for 4 h. After centrifugation, the supernatant was collected, dried by N2 blowing, dissolved in water, and used to determine the intracellular sucrose content.

[0074] LC-MS detection of sucrose content

[0075] The sample was filtered through a 0.45 μm filter and analyzed by LC-MS (Agilent 1290-6470). The column was an Agilent HILIC-OH5 (2.7 μm, 2.1 x 100 mm). Mobile phase A consisted of water containing 5 mM ammonium formate and 0.1% formic acid, and mobile phase B consisted of 80% acetonitrile containing 5 mM ammonium formate and 0.1% formic acid. The flow rate was 0.3 mL / min, the column temperature was 30°C, and the sample load was 2 μL.

[0076] Example 3

[0077] In this example, recombinant Escherichia coli expressing amylosucrase AMS was constructed.

[0078] The corresponding gene fragments were obtained by PCR using primers 3-1 and 3-2, AMS (SEQ ID NO. 4) and its mutants AMS-R226A (SEQ ID NO. 5) and AMS-R226N (SEQ ID NO. 6) as templates. The corresponding gene fragments were obtained by PCR using primers 3-3 and 3-4, 3-5 and 3-6, 3-7 and 3-8, 3-9 and 3-10, 3-11 and 3-12 as primers, Bit-AMS (SEQ ID NO. 7), Ct-AMS (SEQ ID NO. 8), Cc-AMS (SEQ ID NO. 9), Tr-AMS (SEQ ID NO. 10), Dr-AMS (SEQ ID NO. 11). NO.11) gene as a template, PCR was performed to obtain the corresponding gene fragment, and then the PET22b vector plasmid was used as a template with primers 3-13 and 3-14 to obtain the PET22b vector. The above vector and the gene fragment were ligated by Gibson assembly to obtain the corresponding plasmid, which was transformed into the DH5α strain. Single clones were picked and the plasmids were sequenced and identified. The correct plasmids were transformed into the Escherichia coli BL21 strain to obtain recombinant E. coli containing AMS, AMS-R226A, AMS-R226N, Bit-AMS, Ct-AMS, Cc-AMS, Tr-AMS, and Dr-AMS, respectively.

[0079] Table 3

[0080]

[0081]

[0082] The activity of AMS expression strains was tested by iodine staining and starch kit

[0083] Recombinant BL21 strains containing AMS, AMS-R226A, AMS-R226N, Bit-AMS, Ct-AMS, Cc-AMS, Tr-AMS, and Dr-AMS were picked up respectively and inoculated into 2 mL LB medium for activation overnight. The activated strains were then inoculated into 20 mL LB medium at a ratio of 1:50. The strains were grown to an OD of 600The p-value was 0.6-0.8, 0.2mM IPTG was added for induction, and the expression was carried out at 30°C and 200rpm overnight. 100μL of the bacterial solution expressed overnight was taken, centrifuged, resuspended in 100μL PBS buffer, 20g / L sucrose was added, and the reaction was carried out at 30°C overnight. On the one hand, 10μL iodine solution was added to the system after the reaction for testing. On the other hand, 300μL of anhydrous ethanol was added to the system after the reaction was completed, the produced starch was precipitated and purified, centrifuged at 13000rpm for 5min, the supernatant was removed, the precipitate was dried, and the starch content was quantitatively detected using a starch detection kit. In order to test the activity of the strain, 0.5OD bacterial solution was taken, centrifuged, resuspended in 100μL PBS buffer, 40g / L sucrose was added, and the reaction was carried out. After reacting for 30min and 60min respectively, the purified synthesized starch was quantitatively tested, and the starch synthesis activity value of the corresponding strain was calculated. The wild-type strain BL21 was used as the control (Control).

[0084] AMS gene from Neisseria polysaccharea, codon-optimized sequence SEQ ID NO.4:

[0085]

[0086] AMS-R226A sequence SEQ ID NO.5:

[0087]

[0088] AMS-R226N sequence SEQ ID NO.6:

[0089]

[0090] Bifidobacterium thermophilum-derived AMS (Bit-AMS), codon-optimized sequence SEQ ID NO. 7:

[0091]

[0092] Calidithermus timidus derived AMS (Ct-AMS), codon-optimized sequence SEQ ID NO.8:

[0093]

[0094] Cellulomonus carbonis-derived AMS (Cc-AMS), codon-optimized sequence SEQ ID NO.9:

[0095]

[0096] Truepera radiovictrix derived AMS (Tr-AMS), codon-optimized sequence SEQ ID NO.10:

[0097]

[0098] Deinococcus radiopugans derived AMS (Dr-AMS), codon-optimized sequence SEQ ID NO.11:

[0099]

[0100] Example 4

[0101] In this example, recombinant Escherichia coli that secretes and expresses amylosucrase AMS was constructed.

[0102] Using primers 4-1 and 4-2, and the sequences of AMS (SEQ ID NO. 4) and its mutants AMS-R226A (SEQ ID NO. 5) and AMS-R226N (SEQ ID NO. 6) as templates, PCR was performed to obtain the corresponding gene fragments. Using the sfGFP gene as a template, PCR was performed with primers 4-3 and 4-4 to obtain the sfGFP gene fragment. The PET22b vector plasmid was then used as a template, and primers 4-5 and 4-6 were used to obtain the PET22b vector. The vector and gene fragments were ligated by Gibson assembly to obtain the corresponding plasmids, which were then transformed into DH5α strains. Single clones were selected, extracted, and sequenced for identification. The identified sfGFP and AMS fusion expression plasmids were transformed into BL21 strains to obtain recombinant E. coli containing sfGFP-AMS (SEQ ID NO. 12), sfGFP-AMS-R226A (SEQ ID NO. 13), and sfGFP-AMS-R226N (SEQ ID NO. 14), respectively.

[0103] Table 4 Primer sequences

[0104] Primer number Sequence (5'-3') 4-1 GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTATGCTGACTCCGACTCAACAAGTAG 4-2 CTCAGTGGTGGTGGTGGTGGTGCTCGAGAGCAATCTCTAACCACATAACCTGATAAG 4-3 GTTTAACTTTAAGAAGGAGATATACATATGAGCAAAGGAGAAGAACTTTTCAC 4-4 AGAACCACCACCACCAGAACCACCACCTTTGTAGAGCTCATCCATGCCATG 4-5 GAGCACCACCACCACCACCACTGAG 4-6 CATATGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGG

[0105] The activity of AMS secretion expression strain was tested by iodine staining and starch kit

[0106] Recombinant BL21 strains containing sfGFP-AMS, sfGFP-AMS-R226A, and sfGFP-AMS-R226N were picked up respectively, inoculated into 2 mL LB medium for activation overnight, and then the activated bacteria were inoculated into 20 mL LB medium at a ratio of 1:50. 600 When the expression level was 0.6-0.8, 0.2 mM IPTG was added for induction at 30°C, 200 rpm, and expression was carried out overnight. The iodine staining and starch content test procedures were as described above.

[0107] sfGFP-AMS, SEQ ID NO. 12:

[0108]

[0109] sfGFP-AMS-R226A,SEQ ID NO.13:

[0110]

[0111] sfGFP-AMS-R226N,SEQ ID NO.14:

[0112]

[0113] Example 5

[0114] In this example, recombinant Escherichia coli that secretes and expresses BASPP was constructed.

[0115] Using the synthetic gene of sucrose phosphatase BASPP (SEQ ID NO.15) from Bifidobacterium as a template, primers 5-1 and 5-2 were used to perform PCR to obtain the corresponding gene fragment. Using the sfGFP gene as a template, primers 5-3 and 5-4 were used to perform PCR to obtain the sfGFP gene fragment. Then, using the PET22b vector plasmid as a template, primers 5-5 and 5-6 were used to obtain the PET22b vector. The above vector and gene fragment were connected by Gibson assembly to obtain the corresponding plasmid, which was transformed into the DH5α strain. A single clone was picked and the plasmid was sequenced for identification. The correct sfGFP and BASPP fusion expression plasmid was identified and transformed into the BL21 strain to obtain a recombinant BL21 strain containing sfGFP-BASPP (SEQ ID NO.16).

[0116] Table 5 Primer sequences

[0117]

[0118] The activity of BASPP secretory expression strains was tested by iodine staining and starch kit

[0119] The recombinant BL21 strain containing sfGFP-BASPP was selected and inoculated into 2 mL LB medium for activation overnight. The activated bacteria were then inoculated into 20 mL LB medium at a ratio of 1:50. The strain was grown to an OD of 600 When the mRNA expression level is 0.6-0.8, add 0.2 mM IPTG for induction and express overnight at 30°C, 200 rpm. Centrifuge 100 μL of the overnight expressed bacterial culture, remove 80 μL of the supernatant, resuspend in PBS buffer, and add 20 g / L sucrose and 0.3 mg / mL purified αGP protein to a total volume of 100 μL. Iodine staining and starch content testing procedures are as described above.

[0120] BASPP, codon optimized sequence SEQ ID NO.15:

[0121]

[0122] sfGFP-BASPP, codon-optimized sequence SEQ ID NO.16:

[0123]

[0124] Example 6

[0125] In this example, recombinant Escherichia coli that secretes and expresses αGP was constructed.

[0126] Using the synthetic gene for α-1,4-glucan phosphatase (αGP) from rice as a template, primers 6-1 and 6-2 were used to generate the corresponding gene fragment. Using the sfGFP gene as a template, primers 6-3 and 6-4 were used to generate the sfGFP gene fragment. The PET22b vector plasmid was then used as a template, and primers 6-5 and 6-6 were used to generate the PET22b vector. The vector and gene fragment were ligated by Gibson assembly to generate the corresponding plasmid, which was then transformed into the DH5α strain. Single clones were isolated and sequenced for identification. The identified sfGFP and αGP fusion expression plasmid was transformed into the BL21 strain, generating a recombinant BL21 strain containing sfGFP-αGP (SEQ ID NO. 18).

[0127] Table 6

[0128] Primer number Sequence (5'-3') 6-1 GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTATGGCGACAGCTTCAGCAC 6-2 CTCATGGTGGTGGTGGTGGTGCTCGAGCTCGAGCGGGAGAATAACCG 6-3 GTTTAACTTTAAGAAGGAGATATACATATGAGCAAAGGAGAAGAACTTTTCAC 6-4 AGAACCACCACCACCAGAACCACCACCTTTGTAGAGCTCATCCATGCCATG 6-5 GAGCACCACCACCACCACCACTGAG 6-6 CATATGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGG

[0129] The activity of αGP secretion expression strain was tested by iodine staining and starch kit

[0130] The recombinant BL21 strain containing sfGFP-αGP was selected and inoculated into 2 mL LB medium for activation overnight. The activated bacteria were then inoculated into 20 mL LB medium at a ratio of 1:50. The strain was grown to an OD of 600 The expression of the expression vector was 0.6-0.8, and 0.2 mM IPTG was added for induction. The expression was carried out at 30°C and 200 rpm overnight. 100 μL of the overnight expressed bacterial solution was centrifuged, and 80 μL of the supernatant was resuspended in PBS buffer. 20 g / L G-1-P was added to a total volume of 100 μL. The iodine staining and starch content test steps were as described above.

[0131] αGP, codon-optimized sequence SEQ ID NO.17:

[0132]

[0133] sfGFP-αGP,SEQ ID NO.18:

[0134]

[0135] Example 7

[0136] In this example, an engineered E. coli was constructed that simultaneously secreted and expressed BASPP and αGP.

[0137] Using the BASPP and αGP genes as templates, PCR was performed with primers 7-1 and 7-2, and primers 7-3 and 7-4, to obtain the corresponding gene fragments. Using the sfGFP gene as a template, PCR was performed with primers 7-5 and 7-6 to obtain the sfGFP gene fragment. The Pduet vector plasmid was then used as a template and primers 7-7 and 7-8 to obtain the Pduet vector. The vector and gene fragments were ligated by Gibson assembly to construct a plasmid containing both the sfGFP-BASPP and sfGFP-αGP genes. This plasmid was transformed into the DH5α strain, and single clones were extracted and sequenced for identification. The identified plasmid was then transformed into the BL21 strain to obtain a recombinant BL21 strain containing both sfGFP-BASPP and sfGFP-αGP.

[0138] Table 7

[0139]

[0140] The activity of strains expressing BASPP and αGP was tested by iodine staining and starch kit.

[0141] The recombinant BL21 strain containing sfGFP-αGP was selected and inoculated into 2 mL LB medium for activation overnight. The activated bacteria were then inoculated into 20 mL LB medium at a ratio of 1:50. The strain was grown to an OD of 600 When the mRNA expression level is 0.6-0.8, add 0.2 mM IPTG for induction and incubate at 30°C, 200 rpm, overnight. Centrifuge 100 μL of the overnight expressed bacterial culture. Resuspend 80 μL of the supernatant in 100 μL of PBS buffer and add 20 g / L sucrose to a total volume of 100 μL. Iodine staining and starch content testing procedures are as described above.

[0142] Example 8

[0143] In this example, starch was fermented and synthesized using methanol as a substrate.

[0144] (1) Path 1

[0145] MB406 strain was selected and activated in YPD overnight. The activated MB406 strain was inoculated into 20 mL of Delft inorganic salt medium containing 2% methanol. The initial OD 6000.2, 30°C, 200 rpm, culture for 120 hours, centrifuge and collect the supernatant, and adjust the pH to 7.5. The activated AMS-R226N strain was inoculated into LB medium and induced (IPTG 0.2mM) for expression overnight at 30°C, 200 rpm. The bacterial pellet was collected by centrifugation. The AMS-R226N bacterial pellet was added to the supernatant of the MB406 strain and reacted overnight. The reaction system was iodine stained and starch quantified using the same steps as above. The aforementioned Lab001 strain was used as a control.

[0146] (2) Path 2

[0147] MB406 strain was selected and activated in YPD overnight. The activated MB406 strain was inoculated into 20 mL of Delft inorganic salt medium containing 2% methanol. The initial OD 600 0.2, 30°C, 200 rpm, culture for 120 h, centrifuge and collect the supernatant, and adjust the pH to 7.5. The activated BASPP-αGP co-expressing strain was inoculated into LB medium and induced (IPTG 0.2 mM) overnight at 30°C, 200 rpm. The bacterial pellet was collected by centrifugation. The supernatant of the BASPP-αGP co-expressing strain was added to the supernatant of the MB406 strain and allowed to react overnight. The reaction system was iodine stained and starch quantified using the same procedures as above. The aforementioned Lab001 strain was used as a control.

[0148] Experimental results

[0149] Through the sucrose synthesis pathway ( Figure 2 ) through multiple rounds of metabolic engineering, the sucrose yield was increased from 0.4 g / L in strain MB002 to 1.6 g / L in strain MB406 ( Figure 3 "-" indicates no overexpression, "+" indicates overexpression, and "++" indicates the overexpression copy number is 2). The activity of AMS expression strains was screened. Under 2% sucrose conditions, AMS-R226N had the highest starch yield and conversion rate ( Figure 4 ), and compared with the wild-type protein, the activity of the AMS-R226N mutant was significantly improved ( Figure 5 sfgFP-AMS secretory expression strains can convert sucrose into starch, and the starch yield of the strain expressing the sfGFP-AMS-R226N mutant is the highest ( Figure 6 ). Figure 7In order to test the starch synthesis strains of path 2 (BASPP-αGP), group 1 was a mixed expression of two Escherichia coli (two Escherichia coli expressing BASPP and αGP respectively were mixed in equal proportions and then induced to express); group 2 was a single bacterium expressing BASPP and αGP (BASPP and αGP were constructed into the same plasmid and transferred into BL21, so that BASPP and αGP can be expressed simultaneously by a single bacterium); group 3 was a secretory expression of BASPP and αGP respectively (two secretory expression plasmids were transferred into BL21 respectively, expressing BASPP and αGP respectively), and then the supernatants were mixed for testing; group 4 was a test by adding purified BASPP enzyme to the supernatant of secretory expression of αGP; group 5 was a test by adding purified αGP to the supernatant of secretory expression of BASPP; it can be seen that the strain expressing BASPP and αGP simultaneously can achieve starch synthesis under 2% sucrose conditions. By screening the induction conditions for the expression of BASPP and αGP by single bacteria in the second group, different IPTG concentrations were tested and it was found that the starch yield and conversion rate were the highest under 0.2mM IPTG ( Figure 8 Finally, the sucrose-producing MB406 strain was mixed with recombinant E. coli expressing AMS-R226N and recombinant E. coli expressing BASPP-αGP for fermentation (Example 8). With methanol as the sole carbon source, 0.34 g / L of extracellular starch was synthesized by Pathway 1, and 0.05 g / L of extracellular starch was synthesized by Pathway 2 ( Figure 9 ).

[0150] In summary, the present invention designs a new strategy for microbial starch synthesis, using a starting bacterium that can utilize a cheap carbon source, introducing a sucrose synthesis pathway into it, and further strengthening the sucrose synthesis pathway to obtain a sucrose-synthesizing bacterium, using a strain that can utilize sucrose as a starting strain to obtain a starch-synthesizing bacterium, and using the synergy of the two bacteria to achieve extracellular secretion synthesis of starch using a cheap carbon source in microorganisms, creating a low-cost, safe and efficient starch production method.

[0151] The applicant declares that the above is only a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention fall within the scope of protection and disclosure of the present invention.

Claims

1. An engineered bacterial colony for extracellular secretion of synthetic starch, characterized in that: The engineered bacteria include sucrose-synthesizing engineered bacteria and / or starch-synthesizing engineered bacteria, and the sucrose-synthesizing engineered bacteria overexpress SUF1, SPP, and SPS genes; The starch synthesis engineering bacteria overexpress the starch synthesis pathway, and the starch synthesis pathway includes: (1) AMS gene, or (2) BASPP and / or αGP genes.

2. The engineered bacterial colony for synthesizing starch according to claim 1, characterized in that The sucrose synthesis engineering bacteria also overexpress UGP1, DAS1 and CAT1 genes; Preferably, the sucrose-synthesizing engineered bacteria further express fused fructose 1,6-bisphosphatase and sucrose phosphate synthase.

3. The engineered bacterial colony for synthesizing starch according to claim 1 or 2, characterized in that: The starting strain of the sucrose synthesis engineering bacteria includes at least one of Pichia pastoris and Saccharomyces cerevisiae.

4. The engineered bacterial colony for synthesizing starch according to any one of claims 1 to 3, characterized in that: The starch synthesis engineering bacteria overexpress secretory AMS gene or BASPP and αGP gene.

5. The engineered bacterial colony for synthesizing starch according to any one of claims 1 to 4, characterized in that: The starting strain of the starch synthesis engineering bacteria includes at least one of Escherichia coli, Pichia pastoris or Saccharomyces cerevisiae.

6. The engineered bacterial colony for synthesizing starch according to any one of claims 1 to 5, characterized in that: The nucleic acid sequence of the SUF1 gene includes the sequence shown in SEQ ID NO.1; Preferably, the nucleic acid sequence of the SPP gene includes the sequence shown in SEQ ID NO.2; Preferably, the nucleic acid sequence of the SPS gene includes the sequence shown in SEQ ID NO.3; Preferably, the nucleic acid sequence of the AMS gene includes any one of the sequences shown in SEQ ID NO.4 to SEQ ID NO.14; Preferably, the nucleic acid sequence of the BASPP gene includes the sequence shown in SEQ ID NO.15 and / or SEQ ID NO.16; Preferably, the nucleic acid sequence of the αGP gene includes the sequence shown in SEQ ID NO.17 and / or SEQ ID NO.

18.

7. The method for constructing an engineered bacterial colony for synthesizing starch according to any one of claims 1 to 6, characterized in that: The construction method comprises: Overexpressing SUF1, SPP and SPS genes in the starting strain to obtain the sucrose-synthesizing engineered bacteria; The starch-synthesizing engineered bacteria are obtained by overexpressing the AMS gene or the BASPP and αGP genes in the starting strain.

8. Use of the engineered bacterial colony for synthesizing starch according to any one of claims 1 to 6 in producing starch.

9. A method for producing starch, characterized in that The method comprises: Cultivate the engineered bacterial colony for synthesizing starch according to any one of claims 1 to 6.

10. The method for producing starch according to claim 9, characterized in that The culture method includes any one of the following: (1) using the sucrose synthesis engineering bacteria and starch synthesis engineering bacteria for mixed culture; (2) using the sucrose-synthesizing engineered bacteria to mix and culture with any bacterial strain that can synthesize starch from sucrose; (3) Using any strain capable of synthesizing sucrose to mix and culture with the starch synthesis engineering bacteria.

Images