Preparation method of WRN / Terc double-gene knockout non-human animal model

Abstract

The invention relates to a preparation method of a gRNA and WRN / Terc double-gene knockout non-human animal model of a targeted non-human animal WRN / Terc gene. The preparation method of the WRN / Terc double-gene knockout non-human animal model comprises the following steps: non-human animal WRN and Terc genes are destroyed by using a gene editing technology, gRNA for targeting the non-human animal WRN gene comprises one or more than two of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, and gRNA for targeting the non-human animal Terc gene comprises one or more than two of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7. The obtained WRN / Terc double-gene knockout non-human animal model can be used for providing help for studying the senescence mechanism and the relationship between DNA repair defects and diseases.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a method for preparing a WRN / Terc double gene knockout non-human animal model. Background Art

[0002] Aging is a complex process, and the study of aging mouse models is of great significance. It can not only help researchers clarify the mechanisms of aging and the functions of these mechanisms on tissues and organs, but also the aging mouse model is an ideal tool for screening and evaluating anti-aging drugs. Researchers can not only understand the complex mechanisms of aging more quickly and effectively, but also provide a scientific basis for the development of anti-aging treatment strategies.

[0003] Currently, aging models on the market primarily focus on naturally aging mouse models. These naturally aging mice require a long construction cycle, are expensive to maintain, exhibit significant variability in aging symptoms, exhibit inconsistent symptoms within the same batch of mice, exhibit significant individual variability, and exhibit poor reproducibility. Naturally aging mouse models limit research on the mechanisms of aging-related diseases and drug development, making the search and development of animal aging models extremely necessary and urgent. Currently, there are many methods and approaches for modeling aging in mice, such as D-galactose aging mice, accelerated aging mice, and genetically engineered aging mice. Genes currently under investigation in genetically engineered aging mice include the SIRT gene family, the FOXO family, the p53 gene, the mTOR signaling pathway, AMPK (AMP-activated protein kinase), Klotho, Telomerase, IGF-1 (insulin-like growth factor-1), the WRN gene, and the p16INK4a gene. Research primarily focuses on single-gene aging models, and research on multi-gene aging mouse models is lacking.

[0004] In view of this, the present invention is proposed. Summary of the Invention

[0005] The object of the present invention is to provide a method for preparing a WRN / Terc double gene knockout non-human animal model, which can be used to prepare a WRN / Terc double gene knockout non-human animal model.

[0006] In the first aspect of the present invention, a gRNA targeting the WRN / Terc gene of a non-human animal is provided, comprising: a gRNA targeting the WRN gene of a non-human animal and a gRNA targeting the Terc gene of a non-human animal; the gRNA targeting the WRN gene of a non-human animal comprises a nucleotide sequence complementary to the third exon region of the WRN gene of a non-human animal, and the gRNA targeting the Terc gene of a non-human animal comprises a nucleotide sequence complementary to the Terc gene of a non-human animal.

[0007] Preferably, the nucleotide sequence of the gRNA targeting the WRN gene of a non-human animal includes one or more of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.

[0008] Preferably, the gRNA targeting the Terc gene of non-human animals includes one or more of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:7.

[0009] Specifically, the non-human animal WRN gene is shown as SEQ ID NO:8.

[0010] Specifically, the non-human animal Terc gene is shown in SEQ ID NO:9.

[0011] The second aspect of the present invention provides a method for preparing a WRN / Terc double gene knockout non-human animal model, comprising the following steps: using gene editing technology to destroy the WRN and Terc genes of non-human animals, the gRNA used to target the WRN gene of non-human animals includes one or more of those shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, and the gRNA used to target the Terc gene of non-human animals includes one or more of those shown in SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7.

[0012] Preferably, the gene editing technology adopts: any one of zinc finger nuclease-based gene editing technology, TALEN gene editing technology or CRISPR / Cas9 gene editing technology; more preferably, the gene editing technology is CRISPR / Cas9 gene editing technology.

[0013] Those skilled in the art will understand that, after knowing the efficient gene editing region (in this application, the non-human animal WRN gene and Terc gene), those skilled in the art can use any gene editing method, such as zinc finger nuclease-based gene editing technology, TALEN gene editing technology and CRISPR / Cas (such as CRISPR / Cas9) gene editing technology, as well as other gene editing methods discovered in the future, to edit the known efficient gene editing region, optimize the gene editing conditions, and achieve the purpose of efficient editing. Therefore, this application covers the technical solution of knocking out the non-human animal WRN gene and Terc gene identified in this application by any available gene editing method.

[0014] Preferably, the gRNA for targeting the WRN gene of a non-human animal is selected from any one of the following groups:

[0015] (A) SEQ ID NO:1 and SEQ ID NO:3;

[0016] (B) SEQ ID NO:2 and SEQ ID NO:3;

[0017] The gRNA for targeting the non-human animal Terc gene is selected from any one of the following groups:

[0018] (C) SEQ ID NO: 4 and SEQ ID NO: 6;

[0019] (D) SEQ ID NO:4 and SEQ ID NO:7;

[0020] (E) SEQ ID NO:5 and SEQ ID NO:6;

[0021] (F) SEQ ID NO:5 and SEQ ID NO:7.

[0022] More preferably, the gRNA used to target the WRN gene of non-human animals is SEQ ID NO: 2 and SEQ ID NO: 3; the gRNA used to target the Terc gene of non-human animals is SEQ ID NO: 4 and SEQ ID NO: 6.

[0023] Preferably, the method for preparing a WRN / Terc double gene knockout non-human animal model comprises the following steps:

[0024] preparing a WRN gene editing solution comprising Cas9 and a gRNA for targeting the WRN gene of a non-human animal, and a Terc gene editing solution comprising Cas9 and a gRNA for targeting the Terc gene of a non-human animal;

[0025] Delivering the WRN gene editing solution and the Terc gene editing solution into different fertilized eggs of non-human animals respectively;

[0026] The delivered fertilized eggs were cultured and then transplanted into pseudo-pregnant mice to obtain WRN gene knockout non-human animal models and Terc gene knockout non-human animal models;

[0027] The WRN gene knockout non-human animal model and the Terc gene knockout non-human animal model were passaged separately to obtain a homozygous WRN gene knockout non-human animal model and a homozygous Terc gene knockout non-human animal model;

[0028] The homozygous WRN gene knockout non-human animal model and the homozygous Terc gene knockout non-human animal model were mated to obtain the WRN / Terc double gene knockout non-human animal model.

[0029] Preferably, the delivered fertilized eggs are cultured until they reach two cells and then transplanted into pseudo-pregnant mice.

[0030] Preferably, the gene editing solution is delivered into the fertilized egg of a non-human animal by electrofection. The specific operation of electrofection is known in the art.

[0031] Specifically, the gene editing fluid can be prepared by various methods known in the art.

[0032] Preferably, the molar ratio of Cas9 and gRNA in the gene editing solution is (2-3): (2-5), for example, it can be 1:1, 2:2.5, 2:3, 2:3.5, 1:2, 2:4.5, 2:5, 2.5:2, 2.5:3, 2.5:3.5, 2.5:4, 2.5:4.5, 3:2, 3:2.5, 3:3.5, 3:4, 3:4.5, 3:5, etc.

[0033] Preferably, the gRNA for targeting the WRN gene of a non-human animal and the gRNA for targeting the Terc gene of a non-human animal are gRNAs obtained after screening and confirmation of knockout efficiency.

[0034] Preferably, the screening of knockout efficiency includes the following steps: constructing the designed gRNA into a vector backbone, delivering it to the recipient cell, and then screening to obtain gRNA with high knockout efficiency.

[0035] Preferably, the drug is delivered to the recipient cells by liposome transfection.

[0036] Preferably, the vector backbone comprises any one of PX459, PX330, PX260, PX334, PX335, PX458, PX461, PX462, PX551 and PX552; more preferably, the vector backbone is PX459.

[0037] In a third aspect, the present invention provides a WRN / Terc double gene knockout non-human animal model, which is obtained using the above-mentioned method for preparing the WRN / Terc double gene knockout non-human animal model.

[0038] Preferably, the non-human animal in the present invention is a mouse.

[0039] In a fourth aspect of the present invention, a method for preparing a WRN / Terc double gene knockout mouse model is provided, wherein CRISPR / Cas9 gene editing technology is used to destroy the mouse WRN and Terc genes, and the gRNA used to target the mouse WRN gene includes one or more of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, and the gRNA used to target the mouse Terc gene includes one or more of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7.

[0040] Preferably, the gRNA for targeting the mouse WRN gene is selected from any one of the following groups:

[0041] (A) SEQ ID NO:1 and SEQ ID NO:3;

[0042] (B) SEQ ID NO:2 and SEQ ID NO:3;

[0043] The gRNA for targeting the mouse Terc gene is selected from any one of the following groups:

[0044] (C) SEQ ID NO: 4 and SEQ ID NO: 6;

[0045] (D) SEQ ID NO:4 and SEQ ID NO:7;

[0046] (E) SEQ ID NO:5 and SEQ ID NO:6;

[0047] (F) SEQ ID NO:5 and SEQ ID NO:7.

[0048] In a specific embodiment, the gRNA used to target the mouse WRN gene is SEQ ID NO: 2 and SEQ ID NO: 3; the gRNA used to target the mouse Terc gene is SEQ ID NO: 4 and SEQ ID NO: 6.

[0049] In one specific embodiment, the mouse is a C57BL / 6J mouse.

[0050] Specifically, the method for preparing the WRN / Terc double gene knockout mouse model includes the following steps:

[0051] Preparing a WRN gene editing solution comprising Cas9 and targeting the third exon region of the mouse WRN gene, and a Terc gene editing solution comprising Cas9 and targeting the entire region of the mouse Terc gene;

[0052] The WRN gene editing solution and the Terc gene editing solution were electroporated into different mouse fertilized eggs respectively;

[0053] The electro-transfected fertilized eggs were cultured to two cells and transplanted into pseudo-pregnant mice to obtain WRN gene knockout heterozygous mice F0 WRN and F0 Terc heterozygous knockout mice;

[0054] Based on F0 WRN Screening of homozygous offspring of WRN gene knockout mice based on F0 Terc Screening homozygous offspring of Terc gene knockout mice to obtain homozygous WRN gene knockout mice and homozygous Terc gene knockout mice;

[0055] WRN gene knockout homozygous mice were mated with Terc gene knockout homozygous mice to obtain WRN gene and Terc gene double heterozygous mice, and then WRN gene and Terc gene double homozygous mice were obtained.

[0056] Specifically, preparing a WRN gene editing solution containing Cas9 and a gRNA for targeting the third exon region of the mouse WRN gene includes the following steps: synthesizing a gRNA for targeting the third exon region of the mouse WRN; mixing the gRNA and Cas9 to obtain the WRN gene editing solution.

[0057] In a specific embodiment, synthesizing a gRNA mixture for targeting the third exon region of the mouse WRN gene includes: mixing the gRNAs shown in SEQ ID NO: 2 and SEQ ID NO: 3 in a molar ratio of (1-2): (1-2), which can be 1:1, 1:1.5, 1:2, 1.5:1, 1.5:2, 2:1, 2:1.5, etc., to obtain a gRNA mixture of the WRN gene.

[0058] Specifically, preparing a Terc gene editing solution comprising Cas9 and a gRNA for targeting the entire region of the mouse Terc gene includes the following steps: synthesizing a gRNA for targeting the entire region of the mouse Terc gene; mixing the gRNA and Cas9 to obtain the Terc gene editing solution.

[0059] In one specific embodiment, synthesizing a gRNA mixture for targeting the entire region of the mouse Terc gene includes: mixing the gRNAs shown in SEQ ID NO:4 and SEQ ID NO:6 in a molar ratio of (1-2): (1-2), which can be 1:1, 1:1.5, 1:2, 1.5:1, 1.5:2, 2:1, 2:1.5, etc., to obtain a gRNA mixture of the Terc gene.

[0060] More preferably, the synthesis of a gRNA mixture for targeting the mouse WRN gene and Terc gene includes: mixing the second gRNA and the third gRNA in a molar ratio of (1-2): (1-2) to obtain a WRN gene gRNA mixture, and mixing the fourth gRNA and the sixth gRNA in a molar ratio of (1-2): (1-2) to obtain a Terc gene gRNA mixture, for example, it can be 1:1, 1:1.5, 1:2, 1.5:1, 1.5:2, 2:1, 2:1.5, etc.

[0061] Specifically, the synthesis of the gRNA and Cas9 can be performed by methods known in the art.

[0062] Preferably, the gRNA used to target the mouse WRN and Terc genes is the gRNA of the WRN and Terc genes obtained after screening and confirming the knockout efficiency using mouse cells.

[0063] Preferably, screening the knockout efficiency using mouse cells comprises the following steps:

[0064] The designed gRNA was constructed into the vector backbone PX459 and transfected into mouse cells by liposomes;

[0065] Puromycin was used for screening to obtain gRNA with high knockout efficiency as the gRNA for WRN and Terc genes obtained after screening and confirmation.

[0066] Preferably, the mouse cells are B16 cells (mouse melanoma cells).

[0067] In a fifth aspect, the present invention provides a WRN / Terc double gene knockout mouse model, which is obtained using the above-mentioned method for preparing the WRN / Terc double gene knockout mouse model.

[0068] In a sixth aspect, the present invention provides a vector comprising: a vector skeleton and the above-mentioned gRNA.

[0069] Preferably, the vector backbone comprises any one of PX459, PX330, PX260, PX334, PX335, PX458, PX461, PX462, PX551 and PX552; more preferably, the vector backbone is PX459.

[0070] Specifically, the sequence of the vector backbone PX459 is shown in SEQ ID NO: 28.

[0071] In a seventh aspect, the present invention provides a cell, tissue or organ, wherein the cell, tissue or organ is derived from a non-human animal model obtained by the above-mentioned preparation method.

[0072] In an eighth aspect, the present invention provides the use of the non-human animal model obtained by the above-mentioned method for preparing the WRN / Terc double gene knockout non-human animal model, and the above-mentioned cells, tissues or organs in model systems for pharmacology, neurology, immunology, microbiology and medical research.

[0073] The present invention has at least the following beneficial effects:

[0074] The technical solution of the present invention achieves the purpose of double gene knockout in non-human animals by designing gRNAs that specifically target the WRN and Terc genes in non-human animals and using the Cas9 protein to knock out portions of the WRN and Terc genes. The method of genetic modification of non-human animals of the present invention is simple and easy to implement with a short cycle time. The non-human animal models constructed using this method serve as important tools for studying aging, cell proliferation, and related diseases. They not only provide a platform for understanding basic biological processes, but also contribute to the development of new treatment strategies for aging and related diseases. By studying these non-human animals, scientists can reveal the mechanisms of aging and its impact on human health. BRIEF DESCRIPTION OF THE DRAWINGS

[0075] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0076] Figure 1 This is the single nucleotide polymorphism detection result of the WRN gene target site provided by the present invention.

[0077] Figure 2 This is the single nucleotide polymorphism detection result of the Terc gene target site provided by the present invention.

[0078] Figure 3 These are the binding site and cleavage site of the BPiI enzyme provided by the present invention.

[0079] Figure 4 This is a diagram for evaluating the knockout efficiency of the WRN gene sgRNA provided by the present invention.

[0080] Figure 5 This is the genotype identification result of the WRN gene knockout mouse provided by the present invention.

[0081] Figure 6 This is the genotype identification result of the Terc gene knockout mouse provided by the present invention.

[0082] Figure 7This is the genotype identification result of the WRN / Terc double gene knockout heterozygous mouse provided by the present invention, wherein the upper part is the WRN gene and the lower part is the Terc gene. DETAILED DESCRIPTION

[0083] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present application belongs.

[0084] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular also includes the plural. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof.

[0085] definition

[0086] As used herein, the terms "polynucleotide," "nucleotide," "nucleotide sequence," "nucleic acid," and "oligonucleotide" are used interchangeably. They refer to a polymeric form of nucleotides (deoxyribonucleotides or ribonucleotides) of any length or their analogs. Examples of polynucleotides include, but are not limited to, coding or non-coding regions of genes or gene fragments, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, DNA isolated from any sequence, RNA isolated from any sequence, nucleic acid probes, and primers. One or more nucleotides in a polynucleotide may be further modified. The sequence of nucleotides may be interrupted by non-nucleotide components. Polynucleotides may also be modified after polymerization, for example, by coupling with a labeling agent.

[0087] The term "CRISPR / Cas9" used in this article refers to an adaptive immune defense developed by bacteria and archaea over a long period of evolution to combat invading viruses and foreign DNA. CRISPR / Cas9 gene editing technology is a technique for making specific DNA modifications to targeted genes. CRISPR / Cas9-based gene editing technology has shown great promise in a range of gene therapy applications, such as blood disorders, tumors, and other genetic diseases. This technology has been applied to the precise modification of the genomes of human cells, zebrafish, mice, and bacteria.

[0088] As used herein, the terms "gRNA," "guide RNA," and "CRISPR guide sequence" are used interchangeably throughout and refer to nucleic acids comprising a sequence that determines the specificity of the Cas binding protein of the CRISPR / Cas system. The gRNA hybridizes (partially or fully complementary) to a target nucleic acid sequence in the genome of the host cell. The length of the gRNA or portion thereof that hybridizes to the target nucleic acid may be between 15-25 nucleotides, 18-22 nucleotides, or 19-21 nucleotides. In some embodiments, the length of the gRNA sequence that hybridizes to the target nucleic acid may be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In some embodiments, the length of the gRNA sequence that hybridizes to the target nucleic acid is between 10-30 or 15-25 nucleotides.

[0089] The term "gRNA" as used herein generally refers to a single-molecule guide RNA or single-stranded guide RNA in an artificial CRISPR / Cas9 system, which refers to an RNA that guides the Cas protein to specifically bind to a target DNA sequence and is an important component of the CRISPR gene knockout / knock-in system. The gRNA of the present application comprises a guide sequence that targets the target sequence. In a preferred embodiment, the gRNA of the present application further comprises a tracrRNA sequence and a crRNA sequence.

[0090] The term "guide sequence" as used herein refers to a sequence of approximately 17-20 bp that specifies a target site and is used interchangeably with "guide sequence" or "spacer." In the context of forming a CRISPR complex, a "target sequence" is a sequence to which a guide sequence is designed to be complementary, wherein hybridization between the target sequence and the guide sequence promotes the formation of a CRISPR complex. The hybridization requires that the "target sequence" and the "guide sequence" or "guide sequence" have sufficient complementarity to cause hybridization and promote the formation of a CRISPR complex; complete complementarity is not required.

[0091] "Complementary" means that the "guide sequence" or "guide sequence" and the target nucleotide sequence (the target knockout mouse WRN / Terc gene in this application) can hybridize through the nucleotide pairing principle discovered by Watson and Crick. It will be understood by those skilled in the art that as long as there is sufficient complementarity, the "guide sequence" can hybridize with the target nucleotide sequence without the need for 100% complete complementarity between them. In some embodiments, when optimally aligned using an appropriate alignment algorithm, the degree of complementarity between the guide sequence and its corresponding target sequence may be about or greater than about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more. Optimal alignment can be determined using any appropriate algorithm for aligning sequences, including the Smith-Waterman algorithm, the Needleman-Wimsch algorithm, an algorithm based on the Burrows-Wheeler Transform, and the like.

[0092] Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (including hybridization of a guide sequence to a target sequence and complexing with one or more Cas proteins) results in cleavage of one or both strands in or near the target sequence (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from the target sequence). Without wishing to be bound by theory, a tracr sequence can comprise all or a portion of a wild-type tracr sequence, e.g., about or greater than about 20, 23, 26, 29, 32, 35, 38, 41, 44, 47, 50, 53, 56, 59, 62, 65, 70, 75, 80, 85, or more nucleotides of a wild-type tracr sequence, or can further form part of a CRISPR complex, e.g., by hybridization along at least a portion of the tracr sequence to all or a portion of a tracr partner sequence operably linked to a guide sequence.

[0093] In some embodiments, the tracr sequence has sufficient complementarity with the crRNA sequence to hybridize and participate in the formation of the CRISPR complex. Similar to the hybridization of a "target sequence" and a "guide sequence" or "guide sequence", complete complementarity is not required, as long as it is sufficient to perform its function. In some embodiments, under optimal alignment, the tracr sequence has at least 50%, 60%, 70%, 80%, 90%, 95% or 99% complementarity along the length of the crRNA sequence.

[0094] As used herein, the term "gene knockout" or "knockout" refers to editing the gene in the cell (for example, inserting, replacing, and / or deleting the gene) so that the gene loses its original function (for example, it cannot express a functional protein). Various known molecular biology techniques can be used (for example, using gene editing technology based on zinc finger nucleases, TALEN gene editing technology, and CRISPR / Cas (such as CRISPR / Cas9) gene editing technology) to edit the gene in the cell genome. Gene knockout is not limited to the complete deletion or removal of the entire gene, as long as the gene loses its original function. For example, by inserting an exogenous DNA fragment in the gene, the gene cannot express a functional protein, or by inserting or deleting one or more bases in the gene, the gene is subjected to a frameshift mutation to achieve the knockout of the gene. For example, CRISPR / Cas9 gene editing technology can be used in the gene knockout of the present application.

[0095] As used herein, the term "vector" refers to a nucleic acid delivery vehicle into which a polynucleotide can be inserted. When a vector is capable of expressing a protein encoded by the inserted polynucleotide, it is referred to as an expression vector. A vector can be introduced into a host cell via transformation, transduction, or transfection, allowing the genetic material it carries to be expressed in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to, plasmids; phagemids; artificial chromosomes, such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), or P1-derived artificial chromosomes (PACs); bacteriophages, such as lambda phage or M13 phage, and animal viruses. Animal viruses that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillomas (such as SV40). A vector can contain a variety of elements that control expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, a vector may contain an origin of replication.

[0096] As used herein, the term "delivery" refers to the introduction of biomacromolecules such as nucleic acids and proteins from outside the cell membrane into the cell membrane through certain pathways. Examples of "delivery" include electrofection, lipofection, lipid-nanoparticle delivery, viral delivery, and exosome delivery.

[0097] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0098] Example 1

[0099] Instruments used in this experiment:

[0100] The equipment included a stereoscope (Olympus, SZX7), a 37°C 5% CO2 incubator (Sanyo, MCO15A), an inverted fluorescence microscope (Olympus, IX73), a hot stage (THERMOPLATE), an electroporator (BEX, CUY21 EDIT II), a ProFlex PCR System (Thermo Fisher, ProFlex 3×32well PCR system), a gel imager (BiO-RAD, Universal Hood II), an electrophoresis apparatus (BiO-RAD, PowerPacTM Basic), a CO2 constant temperature incubator (Rayward, D180-P), a constant temperature low-speed centrifuge (Eppendorf, 5702R), an inverted fluorescence microscope (Olympus, IX51), a constant temperature water bath (Shanghai Senxin, DKS24), a cell counter (Rayward, C100), and a double-person biological safety cabinet (Shandong Boco, BSC-1360IIA2).

[0101] Reagents used in this experiment:

[0102] BPiI (Thermo Fisher Scientific, ER0291), MinElute PCR Purification Kit (QIAGEN, 2084), T4 DNA Ligase kit (Solebio, T1410), Phanta Max Super-Fidelity DNA Polymerase (Novozymes, P505), MinElute PCR Purification Kit (QIAGEN, Germany, 28004), AgeI (Western enzyme, SE1464S), Hyaluronidase (Nanjing Aibei, M2215), M2 culture medium (Sigma, M7167), Tissue culture oil (SAGE, ARF4008P-5P), Pregnant mare serum hormone PMSG (Ningbo Sansheng Biological), Human chorionic gonadotropin hCG (Ningbo Sansheng Biological), PBS solution (Solebio, P1010), TSINGKE TSE030 T3 Super PCR Mix (TSINGKE, TSE030), Mini-prep Kit (TIANGEN, DP118), Agarose Rapid Gel Extraction Kit (Generay, GK7045-200), PCR Product Purification Kit (Generay, GK2052-100), 5 min TA / Blunt-Zero Cloning Kit (Novagene, C601), DMEM (Gibico, C11995500BT), Serum (Anwei, F0601), Penicillin-Streptomycin (Pusitang, PS0526), ​​Transfection Reagent (Biyuntian, C0533), Puromycin (Gibico, A11138), Trypsin-EDTA (0.25%) (Thermo, 25200056), SpyCas9 NLS (NEB, M0646T).

[0103] 1. gRNA design

[0104] Three gRNAs were designed for knockout of the mouse WRN gene (SEQ ID NO: 8), namely gRNA1, gRNA2 and gRNA3.

[0105] Four gRNAs were designed for knockout of the mouse Terc gene (SEQ ID NO: 9), namely gRNA4, gRNA5, gRNA6 and gRNA7.

[0106] The sequence of gRNA1 is: AGACAGACGCATGCTATCAA (SEQ ID NO: 1);

[0107] The sequence of gRNA2 is: TCTGTCTGATGGCGATGTGG (SEQ ID NO: 2);

[0108] The sequence of gRNA3 is: GCAGAGATACCAACCTGACA (SEQ ID NO: 3);

[0109] The sequence of gRNA4 is: GGCATTTCCCCAGCGGGAAT (SEQ ID NO: 4);

[0110] The sequence of gRNA5 is: TGGGGAAATGCCCCGCTGCA (SEQ ID NO: 5);

[0111] The sequence of gRNA6 is: ACCAATCAGCGCGCGCCATG (SEQ ID NO: 6);

[0112] The sequence of gRNA7 is: CCATGGGGTATTTAAGGTCG (SEQ ID NO: 7).

[0113] 2. Target single nucleotide polymorphism detection

[0114] Using NCBI Primer-BLAST, a pair of primers containing all gRNAs was designed for the WRN gene and the Terc gene, respectively. No nonspecific bands were generated after amplification of the genome to be edited using these primers. The sequence of the WRN gene forward primer was AGCCACCAATTACATGCTTTCT (SEQ ID NO: 10), and the sequence of the reverse primer was TTTCTTAGCTAATGCCGAGTCC (SEQ ID NO: 11). The sequence of the Terc gene forward primer was ATACCCTTTGGCTGGCTACC (SEQ ID NO: 12), and the sequence of the reverse primer was TGGCTAGGAAGAGTGGGGAA (SEQ ID NO: 13).

[0115] The amplified products were subjected to 1% agarose gel electrophoresis and sequencing. The results of agarose gel electrophoresis were as follows: Figure 1-2 As shown in the figure, M represents the D2000 marker, and the bands are 100 bp, 250 bp, 500 bp, 750 bp, 1000 bp, and 2000 bp, respectively. Electrophoresis results showed a target band of 724 bp, and no primer-specific bands were observed. The PCR stock solution containing the target band was sent to the company for sequencing, which revealed no single nucleotide mutation at the gRNA location.

[0116] 3. Plasmid construction

[0117] The following gRNA-F and gRNA-R synthesized by Qingke Company were mixed and annealed according to the procedure in Table 1 to form double-stranded gRNA with sticky ends; the PX459 vector was linearized using BPiI enzyme to generate sticky ends. The restriction sites and binding sites are as follows Figure 3 , the enzyme digestion system is as shown in Table 2; the linearized PX459 vector with sticky ends and the double-stranded gRNA with sticky ends were ligated according to the enzyme ligation system in Table 3, the ligation products were transformed and plated to obtain vectors PX459-gRNA1 to PX459-gRNA7.

[0118] gRNA1F: CACCGAGACAGACGCATGCTATCAA (SEQ ID NO: 14);

[0119] gRNA1R: AAACTTGATAGCATGCGTCTGTCTC (SEQ ID NO: 15);

[0120] gRNA2F: CACCGTCTGTCTGATGGCGATGTGG (SEQ ID NO: 16);

[0121] gRNA2R: AAACCCACATCGCCATCAGACAGAC (SEQ ID NO: 17);

[0122] gRNA3F: CACCGGCAGAGATACCAACCTGACA (SEQ ID NO: 18);

[0123] gRNA3R: AAACTGTCAGGTTGGTATCTCTGCC (SEQ ID NO: 19);

[0124] gRNA4F: CACCGGGCATTTCCCCAGCGGGAAT (SEQ ID NO: 20);

[0125] gRNA4R:AAACATTCCCGCTGGGGAAATGCCC (SEQ ID NO: 21);

[0126] gRNA5F: CACCGTGGGGAAATGCCCCGCTGCA (SEQ ID NO: 22);

[0127] gRNA5R: AAACTGCAGCGGGGCATTTCCCCAC (SEQ ID NO: 23);

[0128] gRNA6F: CACCGACCAATCAGCGCGCGCCATG (SEQ ID NO: 24);

[0129] gRNA6R: AAACCATGGCGCGCGCTGATTGGTC (SEQ ID NO: 25);

[0130] gRNA7F: CACCGCCATGGGGTATTTAAGGTCG (SEQ ID NO: 26);

[0131] gRNA7R: AAACCGACCTTAAATACCCCATGGC (SEQ ID NO: 27).

[0132] Table 1 gRNA annealing program

[0133]

[0134] Table 2 PX459 vector enzyme digestion system

[0135]

[0136] Table 3 Enzyme-linked system

[0137]

[0138] 4. Carrier efficiency identification

[0139] PX459-gRNA1+PX459-gRNA3 vector, PX459-gRNA2+PX459-gRNA3 vector, PX459-gRNA4+PX459-gRNA6 vector, PX459-gRNA4+PX459-gRNA7 vector, PX459-gRNA5+PX459-gRNA6 vector, and PX459-gRNA+PX459-gRNA7 vector were mixed and transfected into B16 cells at a ratio of 1:1. After 48 hours, puromycin was added for selection and culture. After another 48 hours, the cells were extracted for PCR amplification, and the PCR products were identified by 1% agarose gel electrophoresis. The results of vector efficiency identification are shown in the figure. Figure 4 As shown, gRNA1+gRNA3 or gRNA2+gRNA3 can successfully knock out the WRN gene, with two target bands and different knockout fragment sizes. Among them, gRNA2+gRNA3 has higher knockout efficiency. gRNA4+gRNA6, gRNA4+gRNA7, gRNA5+gRNA6, or gRNA5+gRNA7 can successfully knock out the Terc gene, with two target bands and different knockout fragment sizes. Among them, gRNA4+gRNA6 has higher knockout efficiency.

[0140] 5. Preparation of gene editing fluid

[0141] Synthesize gRNA2 and gRNA3, prepare gRNA mixture with a molar ratio of 1:1; Spy Cas9 NLS and gRNA mixture were mixed at a molar ratio of 3:2 and Opti-MEM culture medium was added according to volume to prepare WRN gene editing solution.

[0142] Synthesize gRNA4 and gRNA6, and prepare gRNA mixture with a molar ratio of 1:1; The Spy Cas9 NLS and gRNA mixture was mixed at a molar ratio of 3:2 and Opti-MEM culture medium was added according to volume to prepare the Terc gene editing solution.

[0143] 6. Gene editing fluid is delivered to the fertilized egg

[0144] 6.1 Superovulation in Female Mice

[0145] PMSG and hCG were diluted to 50 IU / ml and injected intraperitoneally into 4-week-old C57BL / 6J female mice with 10 IU of PMSG per mouse. Forty-eight hours after PMSG injection, hCG was injected intraperitoneally with 10 IU per mouse. Immediately after hCG injection, the mice were caged with the male mice, with one male mouse and one female mouse in the same cage.

[0146] 6.2. Culture droplet preparation

[0147] Hyaluronidase digestion droplets: Prepare one 200 μL hyaluronidase droplet in a 35 mm culture dish, prepare five 50 μL M2 culture drops around it, cover with mineral oil, and preheat in a 37°C incubator overnight.

[0148] M2 culture drops: Prepare 100 μL M2 culture drops in 35 mm culture dishes, cover with mineral oil, and preheat in a 37°C incubator overnight.

[0149] 6.3 Electrotransfection

[0150] The next morning after rehousing, examine the vaginal plug and remove any female mice with plugs. Female mice were sacrificed by cervical dislocation, and the dorsal region was dissected to expose the uterus, fallopian tubes, and ovaries. The fallopian tubes were removed. Fat and blood were removed on paper. The oviductal dilatation was ruptured in a drop of digestive oil, and the oocytes containing cumulus cells were pulled into hyaluronidase. After 1-2 minutes, the culture dish was shaken clockwise 8-10 times. After digestion, the eggs were removed and washed three times in an M2 drop of culture medium. They were then cultured in M2 medium for at least 2 hours in preparation for electrofection. 5 μL of WRN gene editing solution was added to the gap between the platinum plates of the electrode. The fertilized eggs were then transferred to Opti-MEM medium, washed three times, and then transferred to WRN gene editing solution for electrofection. After the first electrofection, the gap between the platinum plates of the electrode was cleaned and 5 μL of Terc gene editing solution was added. The fertilized eggs were then transferred to Opti-MEM medium, washed three times, and then transferred to Terc gene editing solution for electrofection. After electroporation, wash the fertilized eggs three times with M2 culture medium, transfer them to M2 culture drops, and culture them in a 37°C 5% CO2 incubator overnight until they are two cells. The next day, transplant them into the oviduct of the surrogate mother mouse. After the mouse is born, take the mouse tail for identification.

[0151] 7. Genotyping of WRN / Terc double knockout mice

[0152] After 5 days of birth, the 0.5 cm tail of the WRN gene knockout F2 generation mice and the Terc gene knockout F2 generation mice were collected and placed in a sterile centrifuge tube. After lysis, the tail DNA was crudely extracted. Using the tail DNA as a template, PCR amplification was performed using the target single nucleotide identification primers. The amplification system is shown in Tables 4 and 5. The amplified products were identified by 1% agarose gel electrophoresis and sequenced. The agarose gel electrophoresis identification results are shown in Tables 4 and 5. Figure 5 and 6 As shown, the WRN gene homozygous mouse No. 10 had only one band, measuring 442 bp, while the wild-type mouse had only one band, measuring 570 bp, with a knockout fragment length of 128 bp. Terc gene homozygous mice Nos. 2 and 3 had only one band, measuring 178 bp, while the wild-type mouse had only one band, measuring 624 bp, with a knockout fragment length of 446 bp. The PCR stock solution containing the target bands was sent to the company for sequencing, and the results showed that WRN and Terc gene homozygous knockout mice were successfully constructed.

[0153] WRN gene knockout homozygous mice and Terc gene knockout homozygous mice were mated. After the WRN / Terc double gene knockout heterozygous mice were born 5 days later, 0.5 cm of the mouse tail was collected and placed in a sterile centrifuge tube. After lysis, the crude DNA of the mouse tail was extracted. Using the mouse tail DNA as a template, PCR amplification was performed using the target single nucleotide identification primers. The amplified product was identified by 1% agarose gel electrophoresis and sequencing. The agarose gel electrophoresis identification results are as follows Figure 7As shown, the WRN gene in the same mouse had only one band, 442 bp in size, while the wild-type mouse had only one band, 570 bp in size, with a knockout fragment length of 128 bp. The Terc gene had only one band, 178 bp in size, while the wild-type mouse had only one band, 624 bp in size, with a knockout fragment length of 446 bp. The PCR stock solution containing the target band was sent to the company for sequencing, and the results showed that the WRN / Terc double-knockout mouse was successfully constructed.

[0154] Table 4 PCR reaction system

[0155]

[0156] Table 5 Nested PCR reaction system

[0157]

[0158]

[0159] This study used CRISPR / Cas9 technology to establish a WRN / Terc double knockout mouse model and establish a stable genetic population of WRN / Terc double knockout mice. This mouse model is crucial for revealing the molecular and cellular mechanisms of aging, modeling age-related diseases, accelerating the screening of anti-aging drugs, and studying the impact of genetic and environmental factors on aging. These models not only enable researchers to more quickly and effectively understand the complex mechanisms of aging, but also provide a scientific basis for the development of anti-aging therapeutic strategies.

[0160] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A gRNA targeting the WRN / Terc gene of a non-human animal, characterized in that: include: gRNA targeting the WRN gene of non-human animals and gRNA targeting the Terc gene of non-human animals; the gRNA targeting the WRN gene of non-human animals includes a nucleotide sequence complementary to the third exon region of the WRN gene of non-human animals, and the gRNA targeting the Terc gene of non-human animals includes a nucleotide sequence complementary to the Terc gene of non-human animals.

2. The gRNA targeting the non-human animal WRN / Terc gene according to claim 1, characterized in that The nucleotide sequence of the gRNA targeting the WRN gene of non-human animals includes one or more of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO:

3.

3. The gRNA targeting the non-human animal WRN / Terc gene according to claim 1, characterized in that The gRNA targeting the Terc gene of non-human animals includes one or more of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:

7.

4. A method for preparing a WRN / Terc double gene knockout non-human animal model, characterized in that: The method comprises the following steps: using gene editing technology to destroy the WRN and Terc genes of non-human animals, wherein the gRNA used to target the WRN gene of non-human animals includes one or more of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, and the gRNA used to target the Terc gene of non-human animals includes one or more of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO:

7.

5. The method for preparing the WRN / Terc double gene knockout non-human animal model according to claim 4, characterized in that: The gene editing technology adopts: any one of zinc finger nuclease-based gene editing technology, TALEN gene editing technology or CRISPR / Cas9 gene editing technology.

6. The method for preparing the WRN / Terc double gene knockout non-human animal model according to claim 4, characterized in that: The gRNA for targeting the WRN gene of a non-human animal is selected from any one of the following groups: (A) SEQ ID NO:1 and SEQ ID NO:3; (B) SEQ ID NO:2 and SEQ ID NO:3; The gRNA for targeting the non-human animal Terc gene is selected from any one of the following groups: (C) SEQ ID NO: 4 and SEQ ID NO: 6; (D) SEQ ID NO:4 and SEQ ID NO:7; (E) SEQ ID NO:5 and SEQ ID NO:6; (F) SEQ ID NO:5 and SEQ ID NO:

7.

7. The method for preparing the WRN / Terc double gene knockout non-human animal model according to claim 4, characterized in that: The steps include: preparing a WRN gene editing solution comprising Cas9 and a gRNA for targeting the WRN gene of a non-human animal, and a Terc gene editing solution comprising Cas9 and a gRNA for targeting the Terc gene of a non-human animal; Delivering the WRN gene editing solution and the Terc gene editing solution into different fertilized eggs of non-human animals respectively; The delivered fertilized eggs were cultured and then transplanted into pseudo-pregnant mice to obtain WRN gene knockout non-human animal models and Terc gene knockout non-human animal models; The WRN gene knockout non-human animal model and the Terc gene knockout non-human animal model were passaged separately to obtain a homozygous WRN gene knockout non-human animal model and a homozygous Terc gene knockout non-human animal model; The homozygous WRN gene knockout non-human animal model and the homozygous Terc gene knockout non-human animal model were mated to obtain the WRN / Terc double gene knockout non-human animal model.

8. A carrier, characterized in that include: A vector backbone and the gRNA according to any one of claims 1 to 3.

9. A cell, tissue or organ, characterized in that: The cells, tissues or organs are derived from a non-human animal model obtained by the preparation method according to any one of claims 4-7.

10. Use of the non-human animal model obtained by the method for preparing the WRN / Terc double gene knockout non-human animal model according to any one of claims 4 to 7, and the cells, tissues or organs according to claim 9 in model systems for pharmacological, neurological, immunological, microbiological and medical research.

Images