Primer for identifying content of capsaicin substances in pepper and application of primer

Abstract

The invention provides a primer for identifying the content of capsaicin substances in pepper and application of the primer, and belongs to the technical field of gene engineering. The nucleotide sequence of a forward primer of the primer for identifying the content of capsaicin substances in hot peppers is shown as SEQ ID NO.1, and the nucleotide sequence of a reverse primer of the primer is shown as SEQ ID NO.2. The primer is used for detecting whether the insertion / deletion fragment exists in the upstream of the coding region of the pepper AT3 gene or not, so that the content of the capsaicin substances in the pepper can be judged. According to the method, the content of capsaicin substances in the hot peppers can be identified in the seedling stage of the hot peppers, a new method can be provided for cultivation of the high-capsaicin variety hot peppers, the breeding and genetic improvement cycle of the high-capsaicin variety hot peppers can be shortened, and the method has wide application prospects.

Description

Technical Field

[0001] The present invention relates to the field of gene engineering technology, in particular to a primer for identifying the content of capsaicinoid substances in peppers and an application thereof. Background Art

[0002] Chili pepper is an annual or perennial herb or shrub plant of the genus Capsicum in the Solanaceae family. The fruit is the main edible part. It is rich in vitamins, carotenoids, organic acids, capsaicin and other active ingredients. Among them, capsaicin is rich and is known as "soft gold". It has many physiological effects such as improving swallowing dysfunction, losing weight, regulating blood lipids, lowering blood sugar, anti-fatigue, anti-inflammatory, anti-tumor, etc. It is widely used in many fields such as medicine, agriculture, and military, and has broad development prospects.

[0003] The spiciness of chili peppers is determined by capsaicinoids, of which capsaicin and dihydrocapsaicin account for approximately 90%. Capsaicinoids can be extracted from chili peppers using a variety of methods, including solvent extraction, ultrasound-assisted extraction, and ultrasonic CO2 extraction. However, practical extraction methods still suffer from low yields, long extraction times, and high costs. Therefore, cultivating high-capsaicinoid varieties is crucial for extracting these compounds.

[0004] Capsaicinoid content is a quantitative trait controlled by multiple genes, with complex inheritance and significant influences on developmental stage, temperature, and humidity, resulting in phenotypic instability. Molecular marker-assisted breeding can overcome the shortcomings of traditional breeding methods, such as low breeding efficiency, long breeding cycles, significant environmental influences, and phenotypic instability. By enabling identification and screening of capsaicinoid content at the seedling stage, it can significantly accelerate the breeding process and improve breeding efficiency.

[0005] InDel (Insertion Deletion Length Polymorphism) markers were developed by comparing differences in genomic sequences between different species. The probability of an InDel mutation with the same length but different insertion or deletion base sequences occurring at the same site in a biological genome is extremely low. Therefore, InDel markers are highly stable and accurate. Furthermore, their dimorphic nature enables genotyping using polyacrylamide gel electrophoresis or capillary fluorescence electrophoresis, as well as compatibility with the KASP platform, enabling low-cost, efficient, and high-throughput testing.

[0006] CN 201910336087.2 discloses an InDel marker associated with the spicy taste of chili peppers. The insertion / deletion fragment of this marker is located upstream of the MYB transcription factor Cap1 gene. Finding more InDel markers that can detect the content of capsaicinoids is of great significance for the cultivation of high-capsaicin pepper varieties. Summary of the Invention

[0007] The purpose of the present invention is to provide a primer for identifying the content of capsaicinoids in peppers and its application, so as to provide a theoretical basis for the cultivation of high-capsaicin pepper varieties.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] The present invention provides a primer for identifying the content of capsaicinoids in peppers. The nucleotide sequence of the forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2.

[0010] The present invention provides an application of the primer in identifying the content of capsaicinoids in peppers or in preparing a product for identifying the content of capsaicinoids in peppers.

[0011] Preferably, the varieties of the peppers include Scotch Bonnet Jamaica Yellow Pepper, SnowWhite Pepper, Poblano L Pepper, Habanero,Caribbean Mix Seeds, Quick viewLeviathan Chocolate Pepper, Dedo de Moca Pepper, Aji Crystal Pepper, ChineseFive-ColorPepper-1, Golden Cayenne Pepper, Cayenne Mix Pepper, PadronPepper-1, Naga ViperPepper, 7Pot Pepper, Dragon's Breath Pepper, Bhut Jolokia Pepper,Mixed, Habanero Paper Lantern Pepper, TAM Jalapeno Pepper, Pasilla Bajio Pepper, Chocolate Habanero Pepper, Cherry Pepper-1, Hawaiian Kona Pepper, Padron Pepper-2, Little ElfPepper, Large Red Thick Cayenne Pepper, Bhutlah Pepper,Chocolate, Cherry Pepper-2, Genghis Khan Brain Pepper, Quick view Habanero Pepper,Peach, QuickviewKomodo Dragon Pepper, Habanero Pepper,Orange, White Knight Pepper, Carolina Reaper Yellow Pepper, Trinidad DouglahPepper Seeds, Chinese Five-ColorPepper-2, Joe E.Parker Pepper, Yellow Hungarian Wax Pepper, CherryPepper-3, Quick view Cascabella Pepper, Santaka Pepper, Trinidad Scorpion Moruga YellowPepper, Caribbean Red Habanero Pepper, Caribbean Yellow Habanero, Thai Pepper,Red, Jay's Peach Ghost Scorpion Pepper, Bhut Jolokia Pepper,Chocolate, FresnoChile, Pumpkin Spice Jalapeno Seeds,Serrano Huasteco Pepper,Hawaiian Sweet HotPepper,Jalapeno Pepper,Early,Pepperoncini Pepper,Golden Greek,ManganjiPepper,Thai Dragon Pepper,Devil's Tongue Red Pepper,Trinidad ScorpionMorugaPepper,Quick view Giant Red Habanero Pepper,Royal Black Pepper,Pepperoncini Any one or more of Pepper, Italian, Hangjiao 008, and Zunla 1, as well as the progeny obtained by hybridization of any two peppers and the progeny population obtained by self-pollination of the progeny.

[0012] Preferably, the capsaicinoids include capsaicin and dihydrocapsaicin.

[0013] Preferably, the product comprises a kit.

[0014] The present invention provides a method for identifying the content of capsaicinoids in peppers, wherein the method comprises detecting whether there is a 9 bp insertion / deletion fragment upstream of the coding region of the pepper AT3 gene by using the primers, and identifying the content of capsaicinoids in the peppers; the nucleotide sequence of the 9 bp insertion / deletion fragment is CACTTTTTT;

[0015] If there is a 9 bp insertion / deletion fragment, it means that the content of capsaicinoids in the pepper is high; if there is no 9 bp insertion / deletion fragment, it means that the content of capsaicinoids in the pepper is low.

[0016] Preferably, the upstream of the pepper AT3 gene coding region is the 800-1000 bp region of the pepper AT3 gene promoter.

[0017] The invention provides a kit for identifying the content of capsaicinoids in peppers, and the kit comprises the primers.

[0018] Preferably, the kit further comprises DNA to be tested, 2×Taq PCR Master mix and ddH2O.

[0019] Preferably, the volume ratio of the DNA to be tested, the forward primer, the reverse primer, the 2×Taq PCR Mastermix and ddH 2 O in the kit is 0.8-1.2:0.8-1.2:0.8-1.2:8-12:5-9.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] By comparing the promoter 800-1000 bp region of the key gene AT3 regulating capsaicin synthesis in peppers located on chromosome 2 between the low-spiciness pepper variety "Hangjiao 008" and the high-spiciness pepper variety "Zunla No. 1," the present invention discovered a 9-bp insertion / deletion structural variation. Primers AT3Indel-F1 and AT3Indel-R1 were designed near the structural variation. The primers were used to detect the presence of the insertion / deletion fragment upstream of the pepper AT3 gene coding region, thereby determining the capsaicinoid content in the peppers. The method of the present invention can identify the capsaicinoid content in peppers at the seedling stage, providing a new method for cultivating high-capsaicinoid pepper varieties, thereby shortening the breeding and genetic improvement cycle of high-capsaicinoid pepper varieties and possessing broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0023] Figure 1 The comparison results of the nucleotide sequences of the promoter regions of the key gene AT3 regulating capsaicin synthesis in peppers Hangjiao 008 and Zunla No. 1 in Example 1;

[0024] Figure 2 This is the sequence alignment result of 60 pepper material varieties used in Example 2;

[0025] Figure 3 The statistical results of capsaicin content in pepper materials of different genotypes in Example 2;

[0026] Figure 4 These are the statistical results of the dihydrocapsaicin content in pepper materials of different genotypes in Example 2. DETAILED DESCRIPTION

[0027] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0028] Example 1

[0029] The screening method for InDel markers is as follows:

[0030] The low-spiciness pepper variety "Hangjiao 008" and the high-spiciness pepper variety "Zunla No. 1" (spiciness refers to the capsaicin content) were compared in the 800-1000 bp promoter region of the key gene AT3 (acyltransferase 3) regulating capsaicin synthesis on chromosome 2. A 9 bp insertion / deletion structural variation was detected between the two through cloning. Figure 1 As shown, the nucleotide sequence is CACTTTTTT.

[0031] Based on the structural variations of the two pepper varieties, primers AT3Indel-F1 and AT3Indel-R1 were designed near the structural variations. The nucleotide sequence of the primer AT3Indel-F1 is shown in SEQ ID NO.1 (ACTAACCTTGCAAAGCAGCA), and the nucleotide sequence of the primer AT3Indel-R1 is shown in SEQ ID NO.2 (ACAAAATGAACAAACCTCGCC).

[0032] Example 2

[0033] The purpose of this example is to verify the effectiveness of the InDel markers and primers obtained in Example 1 for identifying the content of capsaicinoids in pepper fruits. The specific method is as follows:

[0034] In the spring of 2024, 60 pepper materials (the varieties of pepper materials are shown in Table 1, 1 to 58 pepper materials were purchased from TradeWinds Fruit ( https: / / www.tradewindsfruit.com / Hangzhou Pepper 008 and Zunla No. 1 (from the Tomato and Pepper Research Laboratory of the Zhejiang Academy of Agricultural Sciences) were grown at the Yangdu Base of the Zhejiang Academy of Agricultural Sciences in Haining, Jiaxing, Zhejiang Province. After ripening, pepper fruits were analyzed using a standard high-performance liquid chromatography (HPLC) mobile phase with an organic mobile phase. The assay method was as follows: 0.05 g of the sample was dried in a dryer and ground. The sample was then weighed and added to 0.5 mL of the extract. After sonication for 10 minutes, the supernatant was removed and the precipitate was added to 0.5 mL of the extract again. The supernatant was sonicated and centrifuged twice. The three extracts were combined, dried to dryness with nitrogen, and reconstituted with 0.5 mL of methanol. The sample was filtered through a syringe filter and tested. Separation was performed on a C18 reverse-phase column (150 mm × 4.6 mm, 5 μm). The separated sample was detected using an SPD-20A UV detector at a wavelength of 280 nm. The chromatographic conditions were as follows: mobile phase A: 100% methanol, mobile phase B: pure water, mobile phase A: mobile phase B = 70:30; injection volume 10 μL, flow rate 1.0 mL / min, column temperature 30°C, and the contents of capsaicin and dihydrocapsaicin in each sample were calculated using a standard curve made using standards (capsaicin (Product No. B20693) and dihydrocapsaicin (Product No. B20361) from Shanghai Yuanye Biotechnology Co., Ltd.).

[0035] Genomic DNA of the test samples was extracted using the CTAB method and PCR amplification was performed using the InDel-tagged primers AT3Indel-F1 and AT3IndelR1. The amplification system was as follows: 1 μL DNA, 1 μL each of the forward primer AT3Indel-F1 and the reverse primer AT3Indel-R1, 10 μL 2× TaqPCR Mastermix, and 7 μL ddH2O. The amplification program was as follows: initial denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 20 s, for a total of 30 cycles; final extension at 72°C for 5 min; and storage at 4°C. The PCR amplification products and molecular tagging primers were sent to a biological company for sequencing. The sequence alignment results of the 60 pepper materials are shown in Figure 2. Figure 2 As shown, the comparison results were recorded, and the genotype of the sample with a 9 bp insertion / fragment was recorded as "1 / 1", and the genotype of the sample without a 9 bp insertion / fragment was recorded as "0 / 0". The statistical results of the genotype, capsaicin content and dihydrocapsaicin content of the 60 pepper materials are shown in Table 2. The statistical results of the capsaicin content in pepper materials of different genotypes are shown in Table 2. Figure 3 The statistical results of dihydrocapsaicin content are shown in Figure 4 shown.

[0036] Table 1 Varieties of pepper materials

[0037]

[0038]

[0039]

[0040] Table 2 Determination of capsaicin and dihydrocapsaicin content in 60 portions of pepper materials (mg / g)

[0041]

[0042]

[0043] From Table 2, Figure 3 and Figure 4 The recorded data show that the average capsaicin content in the pepper materials with genotype "1 / 1" was 28.558 mg / g, and the average dihydrocapsaicin content was 9.967 mg / g; the average capsaicin content in the pepper materials with genotype "0 / 0" was 3.527 mg / g, and the average dihydrocapsaicin content was 1.589 mg / g. The differences in the contents of capsaicin and dihydrocapsaicin in the fruits of the two genotypes of peppers reached an extremely significant level (P < 0.001), indicating that the InDel marker can be used to achieve the typing of high / low capsaicinoid content in different pepper fruits, assisting in the selection of pepper varieties.

[0044] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A primer for identifying the content of capsaicinoids in peppers, characterized in that: The nucleotide sequence of the forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

2.

2. Use of the primer according to claim 1 in identifying the content of capsaicinoids in peppers or in preparing a product for identifying the content of capsaicinoids in peppers.

3. The use according to claim 2, characterized in that The varieties of the peppers include Scotch Bonnet, Jamaica Yellow Pepper, Snow White Pepper, Poblano L Pepper, Habanero, CaribbeanMix Seeds, Quickview Leviathan Chocolate Pepper, Dedo de Moca Pepper, AjiCrystal Pepper, Chinese Five-Color Pepper-1, Golden Cayenne Pepper, Cayenne Mix Pepper, Padron Pepper-1, Naga Viper Pepper, 7Pot Pepper, Dragon's Breath Pepper, Bhut Jolokia Pepper, Mixed, Habanero Paper Lantern Pepper, TAM Jalapeno Pepper, Pasilla Bajio Pepper, Chocolate Habanero Pepper, Cherry Pepper-1, Hawaiian Kona Pepper, Padron Pepper-2, Little Elf Pepper, Large Red Thick Cayenne Pepper, Bhutlah Pepper, Chocolate, Cherry Pepper-2, Genghis Khan Brain Pepper, Quick view Habanero Pepper, Peach, Quick view Komodo Dragon Pepper, Habanero Pepper, Orange, White Knight Pepper, Carolina Reaper Yellow Pepper, Trinidad Douglah Pepper Seeds, Chinese Five-Color Pepper-2, Joe E.Parker Pepper, Yellow Hungarian Wax Pepper, Cherry Pepper-3, Quick view Cascabella Pepper, Santaka Pepper, Trinidad Scorpion, Moruga Yellow Pepper, Caribbean Red Habanero Pepper, Caribbean Yellow Habanero, Thai Pepper, Red, Jay's Peach Ghost Scorpion Pepper, Bhut Jolokia Pepper, Chocolate, Fresno Chile, Pumpkin Spice Jalapeno Seeds, Serrano Huasteco Pepper,Hawaiian Sweet HotPepper,Jalapeno Pepper,Early,Pepperoncini Pepper,GoldenGreek,Manganji Pepper,Thai Dragon Pepper,Devil's Tongue Red Pepper,Trinidad Scorpion MorugaPepper,Quick view Giant Red Habanero Pepper,Royal BlackPepper,Pepperoncini Any one or more of Pepper, Italian, Hangjiao 008, and Zunla 1, as well as the progeny obtained by hybridization of any two peppers and the progeny population obtained by self-pollination of the progeny.

4. The use according to claim 2, characterized in that The capsaicinoids include capsaicin and dihydrocapsaicin.

5. The use according to claim 2, characterized in that The products include kits.

6. A method for identifying the content of capsaicinoids in peppers, characterized in that: The presence of a 9 bp insertion / deletion fragment upstream of the coding region of the pepper AT3 gene is detected by the primers as claimed in claim 1 to identify the content of capsaicinoids in the pepper; the nucleotide sequence of the 9 bp insertion / deletion fragment is CACTTTTTT; If there is a 9 bp insertion / deletion fragment, it means that the content of capsaicinoids in the pepper is high; if there is no 9 bp insertion / deletion fragment, it means that the content of capsaicinoids in the pepper is low.

7. The method according to claim 6, wherein The upstream of the pepper AT3 gene coding region is the 800-1000bp region of the pepper AT3 gene promoter.

8. A kit for identifying the content of capsaicinoids in peppers, characterized in that: The kit comprises the primer according to claim 1.

9. The kit according to claim 8, wherein The kit also includes DNA to be tested, 2×TaqPCR Mastermix and ddH2O.

10. The kit according to claim 9, wherein The volume ratio of the DNA to be tested, the forward primer, the reverse primer, the 2×TaqPCR Mastermix and ddH2O in the kit is 0.8-1.2:0.8-1.2:0.8-1.2:8-12:5-9.

Images