SNP molecular marker related to salt tolerance of gossypium barbadense and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to the salt tolerance of island cotton and application of the SNP molecular marker. The site of the SNP molecular marker is located at the 45674375th site of a D02 chromosome of gossypium barbadense, and the allele at the 45674375th site is A or G. According to the invention, whole genome association analysis is carried out on the relative plant height and the relative overground part fresh weight in salt stress and salt-free stress environments, the SNP site related to the salt tolerance of the sea island cotton is obtained through screening, and the SNP molecular marker is accurate and efficient in detection and convenient and stable in amplification, can be used for molecular marker-assisted selection, and can be used for detecting the salt tolerance of the sea island cotton. The identification efficiency of different salt-tolerant cotton varieties is improved.

Description

Technical Field

[0001] The present invention belongs to the field of plant biotechnology, and in particular relates to SNP molecular markers related to salt tolerance of sea island cotton and uses thereof. Background Art

[0002] Salt stress affects cotton growth and development throughout its entire growth cycle, exerting a significant inhibitory effect from seed germination to fiber maturity. Cotton is particularly sensitive to salt stress during the seedling stage, where it significantly inhibits plant height growth, leaf area expansion, and aboveground biomass accumulation. Root morphology and structure also undergo significant changes, manifested by impeded root elongation and a reduction in root surface area. These physiological changes not only affect cotton's immediate growth and development but also may lead to a shortened growth period and a decrease in ultimate yield.

[0003] Traditional breeding methods for improving salt tolerance in crops have inherent limitations, such as low selection efficiency and long breeding cycles. Molecular marker-assisted breeding offers an effective approach to addressing this issue. The key lies in identifying functional molecular markers that are closely linked to salt tolerance. Therefore, mapping QTLs for salt tolerance at maturity in cotton under field conditions and developing molecular markers are of strategic importance for accelerating the development of salt-tolerant cotton germplasm resources and promoting the sustainable development of my country's cotton industry.

[0004] QTL mapping, as a precise statistical analysis method, can effectively elucidate the genetic basis of quantitative traits such as salt tolerance. Currently, researchers have systematically mapped salt-tolerance QTLs in various crops, including soybean and barley. Based on these mapping results, they have successfully cloned genes associated with salt tolerance in rice, enabling practical application in crop genetic improvement. However, compared with other major crops, research on the genetic mechanisms and molecular basis of salt tolerance in cotton remains insufficient.

[0005] The use of SNP markers to construct a high-density genetic linkage map, combined with phenotypic data for important agronomic traits such as plant height, has led to significant scientific research into the mapping of QTLs for salt tolerance in cotton and the development of molecular markers. Crop salt tolerance is a quantitative trait controlled by multiple genes, and its genetic mechanisms are complex. While superior alleles resulting from natural gene variation are valuable in crop molecular breeding, the discovery of molecular markers for salt tolerance in cotton remains significantly limited. Therefore, strengthening research in this area is crucial for advancing cotton genetic improvement. Summary of the Invention

[0006] In response to the problems existing in the prior art, the present invention provides SNP molecular markers related to salt tolerance of sea island cotton and uses thereof.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] Based on the above objectives, the applicant used 240 sea island cotton varieties as materials, planted them under salt stress or non-salt stress treatment, and measured plant height (cotyledon node to apical meristem) and aboveground fresh weight 7 days after treatment; then converted the measured indicators into salt tolerance index, and used a mixed linear model (MLM) to perform association analysis on relative plant height and aboveground fresh weight, and found a SNP that was significantly correlated with cotton salt tolerance, which is D02_45674375, located at position 45674375 of chromosome D02. The polymorphism of this SNP is A / G.

[0009] The first aspect of the present invention protects a SNP molecular marker related to salt tolerance of sea island cotton. Based on the sequence of the sea island cotton reference genome version Gossypium barbadense (AD2)_'3-79'_HAU_v2.0, the site of the SNP molecular marker is located at position 45674375 of chromosome D02 of sea island cotton, and the allele at position 45674375 is A or G.

[0010] Cotton is an allotetraploid (genome composition is AADD). The SNP molecular marker involved in this application is located on the second chromosome (D02) of the D group of the reference genome version of Gossypium barbadense (AD2)_'3-79'_HAU_v2.0 (Genome AD2_HAU_v2.0 of Sea Island Cotton variety 3-79). The nucleotide sequence of the SNP molecular marker includes the sequence shown in SEQ ID No. 1.

[0011] >D02_45674375:

[0012] TAGAAATTGGAAAACTTGTCCAGGATGCTATAGGCAGGGGTCATCAAGTATAGTAAC AGCCTTTCT[A>G]CATCCTCTATTGTAATGGTGAAGAAAAAATATGGGAGTTGGAGGTT GTGTGTAGACTACAGATAGCTCAACCAACTCACCATCAAGGAGCAATTTCCTATTCCTG TTATAG(SEQ ID No.1)

[0013] In some embodiments, when the allele is A, it is a salt-tolerant genotype; when the allele is G, it is a salt-sensitive genotype.

[0014] The second aspect of the present invention is a product for detecting the SNP molecular marker as described above, comprising a primer pair having a nucleotide sequence of SEQ ID No. 2-3.

[0015] 5'-TAGAAATTGGAAAACTTGTCCAGGAG-3' (SEQ ID No. 2)

[0016] 5'–CTATAACAGGAATAGGAAATTGCTCC–3'(SEQ ID No.3)

[0017] In some embodiments, the detection product is selected from one or more of a reagent, a chip, or a kit.

[0018] The third aspect of the present invention protects the use of the SNP molecular marker as described above or the product as described above in identifying the salt tolerance of cotton or preparing a product for identifying the salt tolerance of cotton.

[0019] The fourth aspect of the present invention protects the use of the SNP molecular marker as described above or the product as described above in molecular marker-assisted breeding related to cotton salt tolerance.

[0020] The fifth aspect of the present invention protects the use of the SNP molecular marker as described above or the product as described above in salt-tolerant cotton germplasm resources.

[0021] In some embodiments, the method comprises the following steps:

[0022] (1) Extracting genomic DNA from the cotton to be tested;

[0023] (2) using the genomic DNA of step (1) as a template and performing a PCR amplification reaction using the product;

[0024] (3) Sequencing the amplified products to perform genotyping and haplotype analysis;

[0025] If the allele at the SNP site is A, the cotton to be tested is salt-tolerant cotton;

[0026] If the allele at the SNP site is G, the cotton to be tested is salt-sensitive cotton.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] 1) The present invention uses a mixed linear model (MLM) to conduct association analysis on relative plant height and relative aboveground fresh weight under salt stress and non-salt stress environments, and screens out SNP sites related to salt tolerance in cotton.

[0029] 2) Furthermore, the present invention divides cotton into salt-tolerant genotypes and salt-sensitive genotypes based on SNP molecular markers. The SNP molecular markers and products for detecting SNP molecular markers of the present invention can be used to identify cotton salt tolerance or prepare products for identifying cotton salt tolerance, auxiliary breeding related to cotton salt tolerance, and screening cotton germplasm resources with different salt tolerance.

[0030] 3) The SNP molecular markers of the present invention are accurate and efficient in detection, convenient and stable in amplification, and can improve the efficiency of identifying cotton varieties with different salt tolerance. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Manhattan and QQ plots for the association analysis of relative plant height (RPH) and relative shoot fresh weight (RSFW) of cotton in 2021 in Example 1. (a) Manhattan and QQ plots of relative shoot fresh weight (RSFW). (b) Manhattan and QQ plots of relative plant height (RPH). The red arrow marks the site D02_45674375 associated with salt stress. The red dotted line in the Manhattan plot is the threshold -log 10 (P value) = 4.

[0032] Figure 2 Figure 1 shows the relative fresh weight (RSFW) and relative plant height (RPH) phenotypes of 240 sea island cotton accessions at locus 45674375 on chromosome D02 for different haplotypes. (a) Relative fresh weight (RSFW); (b) Relative plant height (RPH). Two-tailed t-test, *P < 0.05, **P < 0.01, ***P < 0.001. Blue represents the AA genotype, and yellow represents the GG genotype.

[0033] Figure 3 Figure 2 shows the relative fresh weight (RSFW) and relative plant height (RPH) phenotypes of 20 sea island cotton accessions at locus 45674375 on chromosome D02, as described in Example 2. (a) Relative fresh weight (RSFW); (b) Relative plant height (RPH). Two-tailed t-test, *P < 0.05, **P < 0.01, ***P < 0.001. Blue represents the AA genotype, and yellow represents the GG genotype. DETAILED DESCRIPTION

[0034] The present invention will be further described below in conjunction with specific examples. The following examples are only specific examples of the present invention, but the scope of protection of the present invention is not limited thereto. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples were purchased from conventional biochemical reagent stores unless otherwise specified.

[0035] Example 1

[0036] In this example, through investigation and analysis of salt tolerance of 240 sea island cotton samples and genome-wide association studies, SNP molecular markers related to cotton salt tolerance were screened and obtained. They include the following:

[0037] 1.1 Experimental Materials

[0038] 240 sea island cotton varieties were selected for seedling salt tolerance testing in 2021.

[0039] 1.2 Salt tolerance investigation

[0040] Experimental group: Sulfate-delinted seeds were sown in 10×5 seedling trays and transferred to a hydroponic chamber containing 1 / 2 MS nutrient solution (pH 5.8) three days after germination. The nutrient solution was changed every three days with continuous aeration. Plants were grown in a greenhouse at the Zhejiang University Agricultural Experiment Station. When the seedlings reached the two-leaf, one-heart stage, 200 mmol / L NaCl treatment was applied.

[0041] At the same time, a control group was set up, which was not treated with NaCl, and the rest were the same as the experimental group.

[0042] After 7 days of treatment, wilted cotyledons were removed and plant height (from the cotyledonary node to the apical meristem) and aboveground fresh weight were measured. Three biological replicates were set for each treatment. All measured parameters were converted to the Salt Tolerance Index (STI):

[0043] STI = measured value under salt stress / measured value under control

[0044] The phenotypic results of relative plant height and relative aboveground fresh weight are shown in Table 1.

[0045] Table 1 Descriptive statistical analysis of phenotypic data of 240 sea island cotton accessions

[0046]

[0047] As shown in Table 1, RPH ranged from 0.49 to 0.79, and RSFW ranged from 0.27 to 0.79, indicating that 200 mmol / L NaCl treatment reduced plant height and aboveground fresh weight of G. barbadense seedlings. The coefficient of variation for relative plant height (RPH) (7.99) was lower than that for relative aboveground fresh weight (RSFW) (18.42%).

[0048] 1.3 Genome-wide association study of salt tolerance in sea island cotton populations

[0049] A genome-wide association study (GWAS) was performed on relative plant height (RPH) and aboveground fresh weight (RSFW) using a mixed linear model (MLM). Figure 1 Among them, a is the GWAS of relative plant height (RPH), where the left figure is the Manhattan plot and the right is the QQ plot; b is the GWAS of relative aboveground fresh weight (RSFW), where the left figure is the Manhattan plot and the right is the QQ plot.

[0050] from Figure 1 It can be seen that the GWAS results of relative plant height (RPH) showed that there was a significant SNP peak on chromosome D02, among which the site with the highest peak was D02_45674375, -log10 (P value) = 6.56. At the same time, the GWAS of aboveground fresh weight (RSFW) showed that there was also a significant SNP peak on chromosome D02, -log10 (P value) = 4.10, which was also greater than the threshold value of -log10 (P value) = 4.

[0051] This SNP is located at position 45674375 on chromosome D02 ( Figure 1 There are two alleles at this site: A and G.

[0052] 1.4 Haplotype analysis

[0053] Combined with the allele type of SNP site D02_45674375, the haplotype analysis of relative plant height and relative aboveground fresh weight data of 240 sea island cotton accessions showed that Figure 2 Among them, the relative plant height and relative aboveground fresh weight of the materials carrying the AA genotype were significantly higher than those carrying the GG genotype.

[0054] Based on the comprehensive P value and haplotype comparison, it was considered that D02_45674375 was significantly correlated with the salt tolerance of sea island cotton.

[0055] Example 2

[0056] The cotton genotype was analyzed using the D02_45674375 SNP molecular marker combined with PCR amplification technology.

[0057] 2.1 Test materials

[0058] DNA was extracted from leaves of 20 accessions of sea island cotton (Gossypium barbata) from Xinjiang, China and abroad. Hydroponically grown, when the seedlings reached the two-leaf, one-heart stage, the plants were phenotypically analyzed for plant height and aboveground fresh weight (SFR) after seven days of treatment with 20 mmol / L NaCl and a control (no NaCl addition). Relative plant height (RPH) and relative SFR (RSFW) were calculated.

[0059] 2.2 DNA extraction

[0060] DNA was extracted from fresh leaves at the seedling stage using the DNAquick Plant System from TIANGEN. The detailed steps are as follows:

[0061] a) Processing Materials: Take 100 mg of fresh plant tissue and grind thoroughly in liquid nitrogen. Add 400 μL of buffer FP1 and 6 μL of RNase A (10 mg / ml), vortex for 1 minute, and let stand at room temperature for 10 minutes.

[0062] b) Add 130 μL of buffer FP2, mix thoroughly, and vortex for 1 min.

[0063] c) Centrifuge at 12,000 rpm for 5 min and transfer the supernatant to a new centrifuge tube.

[0064] d) Add 0.7 volumes of isopropanol to the supernatant and mix thoroughly. Flocculent genomic DNA will appear. Centrifuge at 12,000 rpm for 2 minutes, discard the supernatant, and retain the pellet.

[0065] e) Add 600 μL of 70% ethanol, vortex for 5 seconds, centrifuge at 12,000 rpm for 2 minutes, and discard the supernatant.

[0066] f) Repeat step e.

[0067] g) Open the lid and invert it at room temperature for 5-10 minutes to completely dry any remaining ethanol.

[0068] h) Add an appropriate amount of elution buffer TE and dissolve the DNA in a 65°C water bath for 10-60 min, inverting and mixing several times to aid dissolution. The final DNA solution is stored at -20°C until use.

[0069] 2.3 Primer design for detecting SNP molecular markers

[0070] Based on the SNP site information in Example 1 and combined with the whole genome sequence information of Gossypium barbadense 3-79 (HAU), primers for detecting SNP molecular markers were developed. The upstream primer F was: 5'-TAGAAATTGGAAAACTTGTCCAGGAG-3' (SEQ ID No. 2); the downstream primer R was: 5'-CTATAACAGGAATAGGAAATTGCTCC-3' (SEQ ID No. 3). The amplified size was 180 bp, and the SNP was located at the 69th bp of the amplified fragment. The above primers were used for detection.

[0071] 2.4PCR

[0072] PCR amplification was performed using 2×TOROBlue Flash KOD Dye Mix (KAO-201P) from TOROVID. The reaction system (50 μL) was as follows:

[0073]

[0074] The cycling conditions for the PCR reaction were:

[0075]

[0076] 2.5 After the reaction is completed, the reaction product is sequenced

[0077] As shown in Table 2, the genotype results of each material at the D02_45674375 site were obtained by PCR amplification and sequencing of 20 materials.

[0078] Table 2 SNP typing results and salt tolerance phenotypes of 20 sea island cotton accessions

[0079]

[0080]

[0081] As shown in Table 2, the relative plant height (RPH) and relative aboveground fresh weight (RSFW) of the 10 materials containing genotype A were significantly better than those of the 10 materials carrying genotype G ( Figure 3 ), so this SNP can effectively divide cotton into salt-tolerant and salt-sensitive types.

[0082] The present invention is not limited by the above specific description. Various changes can be made to the present invention within the scope outlined by the claims, and these changes are all within the scope of the present invention.

Claims

1. A SNP molecular marker associated with salt tolerance in sea island cotton, characterized in that: Based on the sequence of the reference genome version of Gossypium barbadense (AD2)_'3-79'_HAU_v2.0, the SNP molecular marker is located at position 45674375 of chromosome D02 of Gossypium barbadense, and the allele at position 45674375 is A or G.

2. The SNP molecular marker according to claim 1, wherein When the allele is A, it is a salt-tolerant genotype; when the allele is G, it is a salt-sensitive genotype; And / or, the nucleotide of the SNP molecular marker comprises the sequence shown in SEQ ID No.

1.

3. A product for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: The primer pair comprises the nucleotide sequence of SEQ ID No. 2-3.

4. The product according to claim 3, characterized in that The product is selected from one or more of reagents, chips or kits.

5. Use of the SNP molecular marker according to claim 1 or the product according to claim 2 in identifying the salt tolerance of cotton or preparing a product for identifying the salt tolerance of cotton.

6. Use of the SNP molecular marker according to claim 1 or the product according to claim 2 in molecular marker-assisted breeding related to cotton salt tolerance.

7. Use of the SNP molecular marker according to claim 1 or the product according to claim 2 in screening salt-tolerant cotton germplasm resources.

8. The use according to claim 7, characterized in that The steps include: (1) Extracting genomic DNA from the cotton to be tested; (2) using the genomic DNA of step (1) as a template and performing a PCR amplification reaction using the detection product; (3) Sequencing the amplified products to perform genotyping and haplotype analysis; If the allele at the SNP site is A, the cotton to be tested is salt-tolerant cotton; If the allele at the SNP site is G, the cotton to be tested is salt-sensitive cotton.

Images