Close linkage marker of wheat powdery mildew resistance gene MlIW30 and application of close linkage marker

Abstract

The invention relates to the technical field of molecular markers, in particular to a close linkage marker of a wheat powdery mildew resistance gene MlIW30 and application of the close linkage marker. The close linkage marker of the wheat powdery mildew resistance gene MlIW30 provided by the invention is an InDel molecular marker, takes a wheat genome as a template, and is obtained by amplifying a specific primer with a nucleotide sequence as shown in SEQ ID NO.1-2. Whether wheat contains the wheat powdery mildew resistance gene MlIW30 or not can be accurately and rapidly identified by utilizing the molecular marker and the detection primer thereof, and the molecular marker and the detection primer thereof have the advantages of simplicity in operation, high efficiency, high accuracy and the like, and have important application value in wheat powdery mildew resistance breeding.

Description

Technical Field

[0001] The present invention relates to the field of molecular marker technology, and in particular to a wheat powdery mildew resistance gene. MlIW30 Tightly linked markers and their applications. Background Art

[0002] wheat( Triticum aestivum ) is an important food crop in the world, however its yield and quality are affected by a variety of diseases, such as wheat powdery mildew ( Blumeria graminis f. sp. Tritici ) causes wheat powdery mildew. Currently, wheat powdery mildew is primarily controlled through chemical control and breeding of resistant varieties. However, chemical control can increase resistance to pesticides and pollute the environment. Breeding resistant varieties is currently the most economical, environmentally friendly, and effective method. To date, over 100 powdery mildew resistance genes / alleles have been identified, of which 71 have been officially named ( Pm1 - Pm71 (Zhang J, Yang H, HanG, et al. Fine mapping of Pm71, a novel powdery mildew resistance gene from emmer wheat[J]. The Crop Journal, 2025.), distributed on different chromosomes except 3D and 5A. However, due to the continuous evolution of pathogen races, the effects of individual disease-resistance genes are often short-lived. Very few broad-spectrum resistance genes are actually utilized in breeding, so it is necessary to discover new disease-resistance genes in closely related species of wheat. Agropyron ovata, Elymus longipterus, Triticum vulgare, Aegilops tauschii, wild emmer wheat, and Einkorn wheat are all valuable resources for wheat disease-resistance genes. Discovering and utilizing disease-resistance genes in closely related wild species in breeding can enrich the genetic background of wheat.

[0003] wild emmer wheat ( Triticum dicoccoides , 2n = 4x = 28, AABB) as the secondary gene library, reported including Pm36 (Li M, Zhang H, K Zhu, et al. A membrane associated tandemkinase from wild emmer wheat confers broad-spectrum resistance to powderymildew[J]. Nature Communications, 2024, 15(1): 3124.), Pm64(Zhang D, Zhu K,Dong L, et al. Wheat powdery mildew resistance gene Pm64 derived from wildemmer (Triticum turgidum var. dicoccoides) is tightly linked in repulsionwith stripe rust resistance gene Yr5[J]. The Crop Journal, 2019, 7(6): 761-770.) and MlIW39 (Qiu L, Liu N, Wang H, et al. Fine mapping of a powdery mildew resistance gene MlIW39 derived from wild emmer wheat (Triticum turgidum ssp.dicoccoides)[J]. Theoretical and Applied Genetics, 2021, 134(8): 2469-2479.), etc. Wild emmer wheat, as the ancestral species of common wheat, has genes that can be more fully recombined into the genome of common wheat, avoiding the problem of poor genetic compensation utility caused by the integration of most exogenous genes into the wheat genome in the form of ectopic lines. Therefore, mining excellent disease-resistant genes in the ancestral seed resources of wheat is easier to achieve a balance between disease resistance and comprehensive agronomic and yield traits, and has greater potential breeding utilization value.

[0004] 2L6 (IW30 / Zheng 98 / / 87-1*3) is an introgression line of wild emmer wheat material IW30, carrying a dominant powdery mildew resistance gene, tentatively named MlIW30 . MlIW30 The gene is resistant to wheat powdery mildew race E09 throughout its growth period and has important application value in breeding. Geng Miaomiao et al. (Geng M, Zhang J, Peng F, et al. Identification and mapping of MLIW30, a novel powdery mildew resistance gene derived from wild emmer wheat[J]. Molecular Breeding, 2016, 36: 1-11.) used traditional map-based cloning to identify MLIW30. MlIW30 Located at 4AL, located at the marker XG223 andXG270 However, when transferring and utilizing the phenotypic characteristics in the breeding process, phenotypic identification is time-consuming, labor-intensive, and inefficient. Molecular marker-assisted selection (MAS) has become an important means to improve breeding efficiency. MlIW30 The existing markers have a long genetic distance and low accuracy, so there is an urgent need to develop MlIW30 Molecular markers with tightly linked genes are used for genetic analysis such as assisted selection breeding. Summary of the Invention

[0005] The present invention provides a wheat powdery mildew resistance gene MlIW30 Tightly linked markers and their applications.

[0006] Specifically, the present invention provides the following technical solutions.

[0007] In the first aspect, the present invention provides a wheat powdery mildew resistance gene MlIW30 The tightly linked marker is an InDel molecular marker, which is amplified using the wheat genome as a template through specific primers with nucleotide sequences as shown in SEQ ID NO.1-2.

[0008] The present invention utilizes wheat powdery mildew resistance gene MlIW30 PCR amplification and electrophoresis detection are performed using detection primers for tightly linked molecular markers. The carriers can be quickly screened based on the size of the target band. MlIW30 wheat breeding materials.

[0009] In a second aspect, the present invention provides a primer pair, the nucleotide sequence of the primer pair is shown as SEQ ID NO.1-2.

[0010] SEQ ID NO.1: IW30InDel-F: CGGGATTATTCCCGATTCTGGAG; SEQ ID NO. 2: IW30InDel-R: GGGCTTACCAAGATGTACTCTGT.

[0011] Preferably, the primer pair is used to amplify the wheat powdery mildew resistance gene MlIW30 Tightly linked markers may be used to detect wheat powdery mildew resistance genes MlIW30 .

[0012] In a third aspect, the present invention provides a product comprising the primer pair described above.

[0013] Preferably, the product is a PCR reagent, a kit or a gene chip.

[0014] The PCR reagents and kits may contain, in addition to the primer pairs, other reagents for PCR, including but not limited to DNA polymerase, buffer, dNTP, etc.

[0015] In a fourth aspect, the present invention provides use of the tightly linked markers, primer pairs, or products described above in detecting or assisting in detecting wheat powdery mildew resistance or in preparing products for detecting or assisting in detecting wheat powdery mildew resistance.

[0016] In a fifth aspect, the present invention provides the above-mentioned tightly linked marker or the primer pair or the product for detecting wheat powdery mildew resistance gene MlIW30 or preparation for detecting wheat powdery mildew resistance genes MlIW30 application in products.

[0017] Preferably, the detection of wheat powdery mildew resistance gene MlIW30 To detect whether the sample contains wheat powdery mildew resistance gene MlIW30 .

[0018] In a sixth aspect, the present invention provides use of the tightly linked markers, the primer pairs, or the products described above in wheat breeding or in the preparation of products for wheat breeding.

[0019] Preferably, the breeding is powdery mildew resistance molecular marker assisted breeding.

[0020] In a seventh aspect, the present invention provides the above-mentioned tightly linked markers or the primer pairs or the products for screening for the presence of wheat powdery mildew resistance genes. MlIW30 Wheat plants or preparations for screening wheat powdery mildew resistance genes MlIW30 Application of the product to wheat plants.

[0021] In the above applications, the product may be a reagent, a kit or a chip.

[0022] In an eighth aspect, the present invention provides a method for detecting wheat powdery mildew resistance genes. MlIW30 The method comprises: using the genome of the wheat to be tested as a template, using the primer pair with the nucleotide sequence as shown in SEQ ID NO.1-2 to perform PCR amplification, and if the amplified product contains a 1431 bp band, then the wheat to be tested contains the wheat powdery mildew resistance gene MlIW30 .

[0023] In a ninth aspect, the present invention provides a method for detecting powdery mildew resistance in wheat, the method comprising: using the genome of the wheat to be tested as a template, and performing PCR amplification using a primer pair with a nucleotide sequence as shown in SEQ ID NO.1-2. If the amplified product contains a 1431 bp band, the wheat to be tested is resistant to powdery mildew.

[0024] In a tenth aspect, the present invention provides a wheat breeding method, comprising: using the wheat genome as a template, performing PCR amplification using a primer pair having a nucleotide sequence as shown in SEQ ID NO. 1-2, and selecting wheat containing a 1431 bp band in the amplified product as a parent for breeding; Alternatively, the method includes: in the wheat breeding process, using the wheat genome as a template, using the primer pair with nucleotide sequences as shown in SEQ ID NO.1-2 to perform PCR amplification, and selecting wheat seeds containing a 1431 bp band in the amplification product.

[0025] In the methods of the eighth to tenth aspects above, the reaction procedure of the PCR amplification includes: pre-denaturation at 95°C for 3 min; 35 cycles of denaturation at 95°C for 30 s, annealing at 57°C for 30 s, and extension at 72°C for 30 s; and extension at 72°C for 5 min.

[0026] In the methods of the eighth to tenth aspects above, the reaction system (10 μL) for PCR amplification is as follows: 1 μL of template DNA, 5 μL of 2× Taq PCR Mix, 0.5 μL each of upstream primer and downstream primer, and water to make up to 10 μL.

[0027] The beneficial effects of the present invention include at least: the present invention provides a wheat powdery mildew resistance gene MlIW30 A tightly linked InDel molecular marker and a detection primer for the molecular marker were developed. The molecular marker and its detection primer can be used to distinguish whether the strain carries the powdery mildew resistance gene by the presence or absence of the target band and the difference in band size. MlIW30 As well as whether it is a functional haplotype, this molecular marker can be used as a co-dominant / dominant marker to quickly and accurately identify the gene carrying the powdery mildew resistance gene. MlIW30 The method can be used to obtain germplasm materials and can be carried out throughout the entire growth period of the plant. It is simple to operate, saves time and effort, and saves costs. It significantly improves the efficiency of wheat disease-resistant breeding and has important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the technical solutions in the present invention or the prior art, a brief introduction will be given below to the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0029] Figure ́1 Marked in Example 1 of the present invention IW30InDelSpecific detection and identification of corresponding powdery mildew resistance phenotypes; among them, M: Marker; 1: 2L6; 2: Svevo; 3: Zavitan; 4: Nongda 210; 5: Shiluan 02-1; 6: Fielder; 7: Aikang 58.

[0030] Figure 2 In Example 2 of the present invention IW30InDel Results of testing the Wx-2L6 / Dwarf Kang 58 F2 progeny and identification of the powdery mildew resistance phenotype; M: Marker; 2 and 5 are Wx-2L6 and Dwarf Kang 58 R1, respectively; R1 or R represents disease-resistant plants, and S1 and S represent disease-susceptible plants.

[0031] Figure 3 In Example 2 of the present invention IW30InDel Detection of wild emmer wheat and identification of powdery mildew resistance phenotypes.

[0032] Figure 4 In Example 2 of the present invention IW30InDel Results of testing 288 susceptible accessions from natural populations.

[0033] Figure 5 In Example 3 of the present invention IW30InDel Detection of Wx-2L6 / Shiluan02-1 BC1F1 progeny and identification of powdery mildew resistance phenotype.

[0034] Figure 6 In Example 3 of the present invention IW30InDel Detection of Wx-2L6 / Nongda 210 BC1F1 progeny and identification of powdery mildew resistance phenotype. DETAILED DESCRIPTION

[0035] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.

[0036] The wheat materials used in the following examples are varieties bred and approved in different years, and the wild emmer wheat materials are germplasm resources preserved by the Wheat Research Center of the College of Agriculture, China Agricultural University.

[0037] Example 1 Wheat Powdery Mildew Resistance Gene MlIW30 Development of tightly linked InDel molecular markers and their detection primers The present invention simultaneously uses the physical intervals corresponding to the reference genomes of wild emmer wheat Zavitan and durum wheat Svevo for sequence analysis, and develops multiple pairs of InDel markers based on 2L6 resequencing data, wherein the markers IW30InDel There are stable polymorphic bands between 2L6 and susceptible materials Svevo, Zavitan, Nongda 210, Shiluan 02-1, Fielder and Aikang 58, which can be used as co-dominant or dominant markers. Figure 1 As shown, the amplified band size of 2L6 was 1431 bp, the amplified band size of Svevo, Nongda 210, Shiluan 02-1 and Fielder was 955 bp, with a difference of 476 bp, while there was no band in Zavitan and Aikang 58. The primer information is shown in Table 1.

[0038] The PCR amplification reaction system was 10 μL: 1 μL template DNA, 5 μL 2× Taq PCR Mix, upstream primer ( IW30InDel - F , SEQ ID NO.1) and downstream primers ( IW30InDel - R , SEQ ID NO.2) 0.5 μL each, and add sterile distilled water to 10 μL.

[0039] The PCR amplification reaction program was as follows: pre-denaturation at 95°C for 3 min; 35 cycles of denaturation at 95°C for 30 s, annealing at 57°C for 30 s, and extension at 72°C for 30 s; extension at 72°C for 5 min; and storage at 4°C.

[0040] PCR products were detected by 2% agarose gel: 4 μL of PCR products were separated by electrophoresis on 2% agarose gel containing nucleic acid dye, electrophoresed at a constant voltage of 200 V for 10 min, and photographed and recorded on a developer.

[0041] Table 1 Marking IW30InDel Sequences of upstream and downstream primers

[0042] Example 2 IW30InDel Specific detection in wheat with different backgrounds For detection markers IW30InDel In identification MlIW30 The present invention first uses this marker in the powdery mildew resistant material Wx-2L6 (a hybrid derivative of 2L6 and Zhongmai 816wx, containing MlIW30 ) and dwarf resistant 58 F2 segregant populations, the primers and PCR amplification method used were the same as in Example 1. The results are shown in FIG. Figure 2 As shown, the results showed that all disease-resistant plants could amplify the target band of 1431 bp, while the susceptible plants had no target band, indicating that the markerIW30InDel It is a dominant marker in the population of Wx-2L6 and Dwarf Kang 58 and is related to MlIW30 Tightly linked.

[0043] Furthermore, 288 susceptible germplasms from natural populations (Table 2) and 50 wild emmer wheat accessions preserved by the applicant (Table 3) were selected and labeled IW30InDel The primers and PCR amplification method used were the same as in Example 1. Figure 3 and Figure 4 As shown, the target band of 1431 bp was not detected in 288 susceptible natural populations, but a material 8IW45 was detected in wild emmer wheat with the same band size as Wx-2L6. Sanger sequencing showed that the sequence was consistent with Wx-2L6, and the powdery mildew resistance phenotype was highly resistant (IT = 0). The experiment proved that the molecular marker of the present invention can track the MlIW30 Highly specific.

[0044] Table 2 Information on 288 susceptible germplasms Table 3 Information on 50 wild emmer wheat germplasms

[0045] Example 3 Carrying MlIW30 Creation of new wheat germplasm and molecular marker-assisted selection The present invention uses the wheat varieties Shiluan 02-1 and Nongda 210, which are high-quality but highly susceptible to powdery mildew, as transgenic recipients, and uses the powdery mildew resistance gene to MlIW30 The wild emmer wheat introgression line Wx-2L6 was hybridized with it, and then backcrossed with Shiluan 02-1 and Nongda 210 as recurrent parents, and then selfed to obtain BC1F1. It was planted in plug trays and inoculated with powdery mildew fungus E09 using the sweeping method at the one-leaf and one-heart stage. The powdery mildew resistance phenotype was identified after 15 days, and DNA samples were labeled with IW30InDel PCR amplification and agarose gel electrophoresis were performed. Figure 5 Mark IW30InDel Results of testing the progeny of Wx-2L6 / Shiluan02-1 BC1F1 and identification of the powdery mildew resistance phenotype. M is a marker, No. 2 is Wx-2L6, No. 3 is the susceptible material Shiluan02-1, R2 represents the disease-resistant individual plant of Wx-2L6 / Shiluan02-1 BC1F1, and S2 represents the disease-susceptible individual plant of Wx-2L6 / Shiluan02-1 BC1F1. Figure 6 Mark IW30InDelResults of testing the progeny of Wx-2L6 / Nongda 210 BC1F1 and identification of the powdery mildew resistance phenotype. M is a marker, No. 2 is Wx-2L6, No. 4 is the susceptible material Nongda 210, R3 represents the disease-resistant individual plant of Wx-2L6 / Nongda 210 BC1F1, and S3 represents the disease-susceptible individual plant of Wx-2L6 / Nongda 210 BC1F1.

[0046] The above experimental results show that the molecular markers of the present invention can effectively detect whether wheat materials carry powdery mildew resistance genes. MlIW30 , assist in identifying whether wheat is resistant to powdery mildew and be used to assist wheat breeding.

[0047] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A wheat powdery mildew resistance gene MlIW30 A tightly linked marker characterized in that The marker is an InDel molecular marker, which is obtained by amplifying the wheat genome as a template through specific primers with nucleotide sequences as shown in SEQ ID NO. 1-2.

2. A primer pair, characterized in that The nucleotide sequence of the primer pair is shown in SEQ ID NO.1-2; Preferably, the primer pair is used to amplify the wheat powdery mildew resistance gene MlIW30 Tightly linked markers may be used to detect wheat powdery mildew resistance genes MlIW30 .

3. A product, characterized in that The product comprises the primer pair according to claim 2.

4. The product according to claim 3, characterized in that The product is a PCR reagent, a kit or a gene chip.

5. Use of the tightly linked marker according to claim 1, the primer pair according to claim 2, or the product according to claim 3 or 4 in detecting or assisting in detecting wheat powdery mildew resistance or in preparing a product for detecting or assisting in detecting wheat powdery mildew resistance.

6. The tightly linked marker according to claim 1, the primer pair according to claim 2, or the product according to claim 3 or 4 in detecting the powdery mildew resistance gene in wheat MlIW30 or preparation for detecting wheat powdery mildew resistance genes MlIW30 application in products.

7. Use of the tightly linked marker according to claim 1, the primer pair according to claim 2, or the product according to claim 3 or 4 in wheat breeding or in the preparation of a product for wheat breeding; Preferably, the breeding is powdery mildew resistance molecular marker assisted breeding.

8. The tightly linked marker according to claim 1, the primer pair according to claim 2, or the product according to claim 3 or 4 is used in screening for wheat powdery mildew resistance genes. MlIW30 Wheat plants or preparations for screening wheat powdery mildew resistance genes MlIW30 Application of the product to wheat plants.

9. A method for detecting wheat powdery mildew resistance genes MlIW30 The method is characterized in that The method comprises: using the genome of the wheat to be tested as a template, using the primer pair with nucleotide sequences as shown in SEQ ID NO.1-2 to perform PCR amplification; if the amplified product contains a 1431 bp band, the wheat to be tested contains the wheat powdery mildew resistance gene. MlIW30 .

10. A method for detecting wheat powdery mildew resistance, characterized in that: The method comprises: using the genome of the wheat to be tested as a template, and performing PCR amplification using a primer pair with nucleotide sequences as shown in SEQ ID NO. 1-2; if the amplified product contains a 1431 bp band, the wheat to be tested is resistant to powdery mildew.

Images