Engineering modified bacillus subtilis as well as preparation method and application thereof
By genetically modifying Bacillus subtilis BSC1-4, introducing CTP synthetase without feedback inhibition and blocking the pyrimidine nucleotide pathway, the problem of low citicoline fermentation yield was solved, and a significant increase in citicoline production was achieved.
Patent Information
- Application Number
- CN202511084755.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-04
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2045-08-04
AI Technical Summary
The existing modified Bacillus subtilis strains have low citicoline fermentation yield and high fermentation raw material costs, which affect the industrial production scale of citicoline.
By genetically modifying Bacillus subtilis BSC1-4, the pyrG gene encoding the feedback-inhibited cytidine triphosphate synthase was introduced or overexpressed, the pyrimidine nucleotide operon repressor protein pyrR, pyrimidine nucleotide phosphorylase pdp and cytidine deaminase cdd genes were inactivated or knocked out, and the choline chloride bypass metabolic pathway was blocked to enhance the utilization and absorption of choline chloride.
It promotes intracellular CTP accumulation, reduces pyrimidine nucleotide consumption, and increases citicoline fermentation yield, significantly improving the citicoline yield during the fermentation process to 1441.4 mg/L, an increase of 22.0% compared to the original strain.
Smart Images

Figure CN120608008A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to an engineered Bacillus subtilis strain, a preparation method and application thereof. Background Art
[0002] Citicoline, also known as cytidine-5′-diphosphocholine, is a key intermediate in the biosynthesis pathway of phosphatidylcholine and is crucial for maintaining the structural integrity and function of neuronal membranes. As a precursor for the synthesis of the neurotransmitter acetylcholine, large-scale production of citicoline is crucial.
[0003] Currently, there are numerous reports on strains for the fermentation production of citicoline. Patents such as CN115896211A and CN116144559A disclose recombinant strains modified from Escherichia coli. Furthermore, CN116790466A discloses a strain for producing citicoline by modifying Bacillus subtilis. However, these recombinant strains still suffer from low citicoline fermentation yields and high fermentation raw material costs, severely limiting the scale of industrial production of citicoline.
[0004] Among them, choline phosphate cytidylyltransferase (CCT) catalyzes the reaction of choline phosphate and cytidine triphosphate (CTP) to produce citicoline. Therefore, CTP is one of the important precursors for the synthesis of citicoline. In microorganisms, uridine triphosphate (UTP) is aminated to produce CTP, and uridine monophosphate (UMP) is a precursor for the synthesis of UTP. CTP is also converted into cytidine monophosphate (CMP). UMP and CMP are then converted into uridine and cytidine, and further into components such as uracil and cytosine, which in turn affect the intracellular accumulation of CTP.
[0005] Therefore, by modifying the genes related to the CTP precursor supply of Bacillus subtilis to ensure the energy supply during the fermentation process and avoid the additional loss of carbon source, it is of great significance to improve the citicoline fermentation effect of Bacillus subtilis. Summary of the Invention
[0006] In order to solve the above technical problems, the present invention provides an engineered Bacillus subtilis, a preparation method and applications thereof.
[0007] The first aspect of the present invention is to provide an engineered Bacillus subtilis strain, wherein the engineered Bacillus subtilis strain is obtained by subjecting Bacillus subtilis BSC1-4 to at least one of the modifications (a1) to (a4): (a1) introducing or overexpressing a gene encoding a cytidine triphosphate synthase without feedback inhibition, wherein the gene is pyrGA gene mutant in which the glutamic acid at position 156 of the encoded PyrG protein is replaced by lysine; (a2) Inactivation or knockout of genes encoding pyrimidine nucleotide operon repressor proteins pyrR ; (a3) Inactivation or knockout of genes encoding pyrimidine nucleotide phosphorylases pdp ; (a4) Inactivation or knockout of the gene encoding cytidine deaminase cdd .
[0008] Preferably, before modifying Bacillus subtilis BSC1-4, it is necessary to block the pathway of choline chloride metabolism by Bacillus subtilis BSC1-4, and at the same time, overexpress opuD , and knocking out transcriptional repressor genes opcR , to enhance the utilization and absorption of choline chloride.
[0009] The Bacillus subtilis BSC1-4 is a strain disclosed in the inventor's patent CN116790466B.
[0010] As a further preferred method, the method for blocking the choline chloride bypass metabolic pathway of Bacillus subtilis is: inactivating or knocking out the gene encoding choline dehydrogenase gbsB and the gene encoding glycine betaine aldehyde dehydrogenase gbsA .
[0011] The second aspect of the present invention is to provide the use of the engineered Bacillus subtilis in the fermentation production of citicoline.
[0012] Furthermore, the present invention also provides a method for producing citicoline by fermentation using the engineered Bacillus subtilis, comprising the following steps: Activation of S1 strain: The strain stored in the glycerol tube was streaked on an LB agar plate for activation; Preparation of S2 seed solution: Pick a single colony from the S1 plate, inoculate it into LB liquid medium, and culture it at 35-40°C and 150-220 rpm with shaking for 10-18 hours to prepare the seed solution; S3 fermentation culture: The seed liquid in S2 is transferred to the fermentation medium for fermentation culture. After fermentation for 3-6 hours, choline chloride with a final concentration of 0.8-1.5 g / L is added and the fermentation is continued for a total fermentation time of 24-30 hours to obtain a fermentation liquid. Collection of S4 citicoline: Take the fermentation broth in S3, add deionized water to mix, and place in an ice water bath. Use an ultrasonic cell disruptor to disrupt the cell. Perform the first centrifugation, collect the supernatant, heat-treat the supernatant at 80-100°C for 3-8 min, and then perform the second centrifugation. Collect the supernatant to obtain citicoline.
[0013] In the above method, preferably, the components of the LB medium described in S1 are: tryptone 6-15 g / L, yeast extract 3-8 g / L, and NaCl 5-20 g / L.
[0014] Preferably, the components of the shake flask fermentation medium described in S2 are: glucose 30-50 g / L, corn steep liquor powder 6-25 g / L, tryptone 8-12 g / L, yeast extract 3-6 g / L, NaCl 6-12 g / L, (NH4)2SO48-15 g / L, KH2PO41-5 g / L, K2HPO45-10 g / L, MgSO4·7H2O 0.5-2 g / L, and pH 7.0-7.5.
[0015] Preferably, the inoculation amount of the seed solution in S3 is 0.5%-1.2% (v / v).
[0016] Preferably, in S4, the first centrifugation condition is centrifugation at 6000-8000 rpm for 8-15 min, and the second centrifugation condition is centrifugation at 10000-15000 rpm for 8-12 min.
[0017] The beneficial effects of the present invention are: The present invention introduces or overexpresses a gene encoding a cytidine triphosphate synthase without feedback inhibition and modifies the pyrimidine nucleotide synthesis and degradation pathways, thereby reducing the consumption of pyrimidine nucleotides, blocking the conversion of uridine / cytidine to uracil / cytosine, and the conversion of cytidine to uridine, promoting the de novo continuous synthesis of UMP, and further promoting the intracellular accumulation of CTP, thereby further enhancing the utilization of CTP in the process of fermentation production of citicoline by engineered bacteria. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 Schematic diagram of the metabolic pathway and systematic transformation strategy of the engineered bacteria for producing citicoline provided by the present invention; Among them, OpuB, OpuC, and OpuD are choline transporters; OpcR is the transcriptional repressor protein of choline transporters OpuB and OpuC; CKI : encoding choline kinase; CCT: encoding choline phosphate cytidylyltransferase; UMP: uridine monophosphate; UTP: uridine triphosphate; CTP: cytidine triphosphate; CMP: 5-cytidine monophosphate; PPi: pyrophosphate; PyrR: pyrimidine nucleotide operon ( pyr operon) transcriptional repressor protein; pyrG E156K : Encoding CTP synthetase without feedback inhibition; pdp : encoding pyrimidine nucleotide phosphorylase; cdd : Encoding cytidine deaminase. DETAILED DESCRIPTION
[0019] In order to enable those skilled in the art to better understand the present invention, the present invention will be further explained in conjunction with specific embodiments.
[0020] 1. Preparation and sources of the strains, plasmids and culture media involved in the present invention.
[0021] The information of all strains and plasmids involved in the present invention is shown in Table 1. The primers were synthesized by Qingke Biotechnology Co., Ltd.
[0022] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, for general culture of Bacillus subtilis. For solid culture, add 15 g / L agar powder and, if necessary, add 16 μg / mL neomycin or 8 μg / mL chloramphenicol.
[0023] Shake flask fermentation medium: glucose 40 g / L, corn steep liquor 10 g / L, tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, (NH4)2SO4 10 g / L, KH2PO4 3 g / L, K2HPO4 8 g / L, MgSO4·7H2O 1 g / L, pH 7.2. After fermentation for 4 h, choline chloride was added to a final concentration of 1 g / L.
[0024] Fed-batch initial medium: the same as shake flask fermentation medium, feed medium consists of 600 g / L glucose, 20 g / L MgSO4·7H2O and 30 g / L choline chloride.
[0025] Table 1 Strains and plasmids involved in the experiment
[0026] 2. Primers and sequences involved in the present invention.
[0027] 2. Primers and sequences involved in the present invention.
[0028] The primers used for PCR are shown in Table 2.
[0029] Table 2 PCR primer sequences Primer Sequence Name Sequence (5'→3') pksL-U1 SEQ ID No.1 TGCCTCCTGTAATCTCTGA pksL-U2 SEQ ID No.2 GCCATCTAAGTGTCCGAAA pksL-D1q SEQ ID No.3 TTTTCGGACACTTAGATGGCGGCACACAACATTGATGAAT pksL-D2 SEQ ID No.4 TTGATTTGGCTGACTCTATTG pksL-CR1q SEQ ID No.5 GCAATAGAGTCAGCCAAATCAATCTTCAACTAAAGCACCCAT CR2 SEQ ID No.6 TTATTCATTCAGTTTTCGTG pksL-G1q SEQ ID No.7 GCACGAAAACTGAATGAATAAAGGCTGATTACGCAATGG pksL-G2 SEQ ID No.8 CTTACCTGCTTCTGCTCTT pksL-U2q SEQ ID No.9 TCTACTATGTTCTCTCTTCCTTTTGCCATCTAAGTGTCCGAAA pyrG-P1 SEQ ID No.10 AAAAGGAAGAGAGAACATAGTAG pyrG-2 SEQ ID No.11 CGCACGAAAACTGAATGAATAACTATATGAACTGTGAGGTGTC pyrR-G2 SEQ ID No.21 TGCTGAAGGCTGAATGAA pdp-U1 SEQ ID No.22 TGAATGTTCTCTTGCCAATC pdp-U2 SEQ ID No.23 CACCTTAGCCATCGTCAA pdp-D1q SEQ ID No.24 ACTTGACGATGGCTAAGGTGCGGCGAAGGTGATTCATA pdp-D2 SEQ ID No.25 AGTGTATGGATGTGGAGTG pdp-CR1q SEQ ID No.26 GCACTCCACATCCATACACTTCTTCAACTAAAGCACCCAT pdp-G1q SEQ ID No.27 CGCACGAAAACTGAATGAATAACTTGTTGGGGCTCTTGAT pdp-G2 SEQ ID No.28 CCGATGAGGATGTTGTCA cdd-U1 SEQ ID No.29 AATCCTAACCATCCGCTATT cdd-U2 SEQ ID No.30 GTACCGCTATCACTTTATATTTTAC cdd-D1q SEQ ID No.31 TGTAAAATATAAAGTGATAGCGGTACGGAAGAATTATTGCCAGGC cdd-D2 SEQ ID No.32 AACACAAGAAACCCACCTTT cdd-CR1q SEQ ID No.33 AAAGGTGGGTTTCTTGTGTTTCTTCAACTAAAGCAGCCAT cdd-G1q SEQ ID No.34 CGCACGAAAACTGAATGAATAAAAGTGATAGAGGAACCATTA cdd-G2 SEQ ID No.35 TGGCAATAATTCTTCCACAG
[0030] Example 1 An engineered Bacillus subtilis strain was prepared as follows: First, the pathway of choline chloride metabolism by Bacillus subtilis is blocked, and the gene encoding choline dehydrogenase is knocked out using conventional techniques known to those skilled in the art. gbsB , gene encoding glycine betaine aldehyde dehydrogenase gbsA , gene encoding choline transporter transcriptional repressor opcR At the same time, according to the method in patent CN116790466B, overexpression opuD In order to enhance the absorption of choline chloride, a strain BSC5-1 with choline chloride bypass metabolism and enhanced choline chloride absorption was obtained.
[0031] Next, build pksL The knockout strain was used as a control: the genome of BS168N was used as a template to amplify fragment U (SEQ ID No.36, 1118 bp), fragment D (SEQ ID No.37, 1004 bp), and fragment G (SEQ ID No.38, 769 bp) using primer pairs pksL-U1 / pksL-U2, pksL-D1q / pksL-D2, and pksL-G1q / pksL-G2, respectively; yrpCm The genome of the bacterium was used as a template, and the primer pair pksL-CR1q / CR2 was used to amplify the fragment CR (disclosed in patent CN116790466B, the same as below, and no further description is given), and then the fragments U, D, CR and G were spliced into the fragment UDCRG (SEQ ID No. 39, 4960 bp), which was then transformed into the competent cells of BSC5-1 to obtain pksL Knockout strain BSC6.
[0032] Build pyrG E156K Overexpression strain: Using the genome of BSC6m as a template, primer pairs pksL-U1 / pksL-U2q, pyrG-3 / pyrG-4, and pksL-pD1q / pksL-G2 were used to amplify fragment U (SEQ ID No. 40, 1118 bp), pyrG The fragment G2 (SEQ ID No.41, 1306 bp) and the fragment DCRG (SEQ ID No.42, 3842 bp) of the second half of the gene sequence were cloned into plasmid pUC57-simple-PyrG E156KAs a template, primer pair pyrG-P1 / pyrG-2 was used to amplify the gene containing P SB Promoter and pyrG The first half of the gene sequence (including mutation E156K) fragment G1 (SEQ ID No. 43, 576 bp) was synthesized by splicing fragments U, PG1, G2, and DCRG into fragment UPG1G2DCRG (SEQ ID No. 44, 6842 bp), which was then transformed into BSC5-1 competent cells to obtain P SB - pyrG E156K exist pksL Site-integrated expression pyrG E156K Overexpression strain recombinant strain BSC7.
[0033] pyrR 、 pdp, cdd The specific steps for knockout of genes are as follows: The genome of BS168N was used as a template to amplify fragment U (SEQ ID No.45, 1258 bp), fragment D (SEQ ID No.46, 960 bp) and fragment G (SEQ ID No.47, 820 bp) using primer pairs pyrR-U1 / pyrR-U2, pyrR-D1q / pyrR-D2 and pyrR-G1q / pyrR-G2, respectively. yrpCm The genome of the strain was used as a template, and the primer pair pyrR-CR1q / CR2 was used to amplify the fragment CR. The fragments U, D, CR, and G were spliced into the fragment UDCRG (SEQ ID No. 48, 5107 bp), which was then transformed into the competent cells of BSC7 to obtain pyrR Knockout strain BSC8.
[0034] Using the genome of BS168N as a template, the primer pairs pdp-U1 / pdp-U2, pdp-D1q / pdp-D2, and pdp-G1q / pdp-G2 were used to amplify fragment U (SEQ ID No.49, 1129 bp), fragment D (SEQ ID No.50, 1128 bp), and fragment G (SEQ ID No.51, 962 bp), respectively; yrpCm The genome of the strain was used as a template, and the primer pair pdp-CR1q / CR2 was used to amplify the fragment CR. The fragments U, D, CR, and G were spliced into the fragment UDCRG (SEQ ID No. 52, 5288 bp). The fragment UDCRG was then transformed into the competent cells of BSC8 to obtain pdp Knockout strain BSC9-6.
[0035] Using the genome of BS168N as a template, the primer pairs cdd-U1 / cdd-U2, cdd-D1q / cdd-D2, and cdd-G1q / cdd-G2 were used to amplify fragment U (SEQ ID No.53, 1601 bp), fragment D (SEQ ID No.54, 1099 bp), and fragment G (SEQ ID No.55, 408 bp), respectively. yrpCm The genome of the strain was used as a template, and the primer pair cdd-CR1q / CR2 was used to amplify the fragment CR. The fragments U, D, CR, and G were spliced into the fragment UDCRG (SEQ ID No. 56, 5177 bp). The fragment UDCRG was then transformed into the competent cells of BSC8 to obtain cdd Knockout strain BSC9-7.
[0036] In addition, knockout pdp and cdd The double knockout strain was named BSC9-8.
[0037] Example 2 The method for producing citicoline by fermentation using various engineered Bacillus subtilis prepared in Example 1 comprises the following steps: Activation of S1 strains: Each engineered Bacillus subtilis was streaked and activated on LB agar plates; Preparation of S2 seed solution: Pick a single colony from the S1 plate and inoculate it into a test tube containing 5 mL of LB liquid medium. Incubate the tube at 37°C and 200 rpm with shaking for 12 h to prepare the seed solution. S3 fermentation culture: According to the inoculum volume of 1% (v / v), the seed solution in S2 was transferred to a 250 mL conical flask containing 30 mL of fermentation medium. The culture was shaken at 37°C and 220 rpm in a shaker. After 4 h of fermentation, choline chloride was added to a final concentration of 1 g / L and the fermentation was continued for a total fermentation time of 24 h to obtain the fermentation broth. Collection of S4 citicoline: Take the fermentation broth in S3, add deionized water to mix, place in an ice water bath, and use an ultrasonic cell disruptor to disrupt it. Centrifuge at 8000 rpm for 10 min, take the supernatant, heat treat the supernatant at 100°C for 5 min, and then centrifuge at 12000 rpm for 10 min, take the supernatant, and obtain it.
[0038] During the fermentation process, the OD 600 The values and the total citicoline production in the fermentation broth were determined.
[0039] In the present invention, the concentration of citicoline is determined by high performance liquid chromatography (HPLC). The specific method is as follows: HPLC analysis conditions: high performance liquid chromatograph LC-2030 (Shimadzu); chromatographic column, PC HILIC column (250 mm × 4.6 mm, 5 μm); column temperature, 30°C; mobile phase A was 0.5% formic acid in water, and mobile phase B was acetonitrile / methanol (8:2, v / v ) solution, A:B at 4:6 ( v / v ) ratio for isocratic elution; flow rate, 1.0 mL / min; detector, UV detector; detection wavelength, 280 nm; injection volume, 20 μL.
[0040] Determination of total citicoline concentration: The supernatant obtained in S4 was taken and washed with 20% acetonitrile water ( v / v ) and perform appropriate dilution, and then filter through a 0.22 μm filter membrane for HPLC analysis.
[0041] The control strain BSC5-1, pksL Knockout strain BSC6, pyrG E156K Overexpression strain BSC7, pyrR Knockout strain BSC8, pdp Knockout strain BSC9-6, cdd Knockout strain BSC9-7 and pdp and cdd The double knockout strain 9-8 was fermented. During the fermentation process, the growth conditions of each strain are shown in Table 3.
[0042] Table 3 Growth of strains
[0043] Note: * The results showed that there were significant differences compared with the control bacteria (P < 0.05); ** There was a significant difference compared with the control bacteria (P < 0.01).
[0044] BSC6 is the control bacteria for BSC7; BSC7 is the control bacteria for BSC8; BSC8 is the control bacteria for BSC9-6, 9-7 and 9-8, as shown in Table 4.
[0045] The results in Table 3 show that overexpression of CTP synthetase without feedback inhibition based on BSC6 ( pyrG E156K ) resulted in a significant inhibition of the growth of strain BSC7. However, further knockout of the pyrimidine operon repressor protein gene based on BSC7pyrR After that, the growth level of strain BSC8 was effectively restored, and other genetic modifications had no significant effect on the growth of the strain.
[0046] The citicoline production of each strain after 12 h and 24 h of fermentation is shown in Table 4.
[0047] Table 4 Citicoline production (mg / L) of different strains after 12 h and 24 h of fermentation Strain 12 h 24 h BSC5-1 757.6±9.9 1181.6±11.2 BSC6 749.3±14.2 <![CDATA[1114.6 # ±15.9]]> BSC7 <![CDATA[795.7 ## ±6.1]]> <![CDATA[1219.7 ## ±14.3]]> BSC8 <![CDATA[819.2 ## ±4.3]]> <![CDATA[1309.5 ## ±3.0]]> BSC9-6 <![CDATA[802.0 # ±6.5]]> <![CDATA[1324.6 ## ±1.4]]> BSC9-7 <![CDATA[832.5 # ±4.3]]> <![CDATA[1384.9 ## ±5.1]]> BSC9-8 <![CDATA[846.9 # ±17.2]]> <![CDATA[1441.4 ## ±15.7]]>
[0048] The results in Table 4 show that each step of genetic modification in the invention resulted in a steady increase in yield. pyrG E156K ) under growth inhibition, its 24 h production still reached 1219.7±14.3 mg / L, which was 9.4% higher than that of its control strain BSC6, proving the direct effectiveness of the enhanced CTP synthesis step; strain BSC8 (knockout pyrR ) While the growth was restored, the yield was further increased to 1309.5±3.0 mg / L, which was 7.4% higher than that of BSC7. pdp and cdd The gene blocked the CTP degradation pathway and the yield was continuously improved. Among them, the double knockout strain BSC9-8 showed the best performance, with a 24-h yield of 1441.4±15.7 mg / L, a significant increase of 22.0% compared with the strain BSC5-1, and 12.6 times the yield of the original starting strain BSC1-4 (114.3 mg / L in patent CN116790466B).
[0049] The above description is only a preferred specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any technician familiar with the technical field, within the technical scope disclosed by the present invention, who makes equivalent replacements or changes based on the technical solution and inventive concept of the present invention, should be covered by the scope of protection of the present invention.
Claims
1. An engineered Bacillus subtilis, characterized in that: This is achieved by performing at least one of the modifications (a1) to (a4) on Bacillus subtilis BSC1-4: (a1) introducing or overexpressing a gene encoding a cytidine triphosphate synthase without feedback inhibition, wherein the gene is pyrG A gene mutant in which the glutamic acid at position 156 of the encoded PyrG protein is replaced by lysine; (a2) Inactivation or knockout of genes encoding pyrimidine nucleotide operon repressor proteins pyrR ; (a3) Inactivation or knockout of genes encoding pyrimidine nucleotide phosphorylases pdp ; (a4) Inactivation or knockout of the gene encoding cytidine deaminase cdd .
2. The engineered Bacillus subtilis according to claim 1, wherein Before transforming Bacillus subtilis BSC1-4, it is necessary to block the pathway of choline chloride metabolism by Bacillus subtilis BSC1-4 and overexpress opuD , and knocking out transcriptional repressor genes opcR , to enhance the utilization and absorption of choline chloride.
3. The engineered Bacillus subtilis strain according to claim 2, wherein: The method for blocking the choline chloride bypass metabolic pathway of Bacillus subtilis is to inactivate or knock out the gene encoding choline dehydrogenase gbsB and the gene encoding glycine betaine aldehyde dehydrogenase gbsA .
4. Use of the engineered Bacillus subtilis according to any one of claims 1 to 3 in the fermentative production of citicoline.
5. A method for producing citicoline by fermentation using the engineered Bacillus subtilis according to any one of claims 1 to 3, characterized in that: The following steps are involved: Activation of S1 strain: The strain stored in the glycerol tube was streaked on an LB agar plate for activation; Preparation of S2 seed solution: Pick a single colony from the S1 plate, inoculate it into LB liquid medium, and culture it at 35-40°C and 150-220 rpm with shaking for 10-18 hours to prepare the seed solution; S3 fermentation culture: The seed liquid in S2 is transferred to the fermentation medium for fermentation culture. After fermentation for 3-6 hours, choline chloride with a final concentration of 0.8-1.5 g / L is added and the fermentation is continued for a total fermentation time of 24-30 hours to obtain a fermentation liquid. S4 Collection of Citicoline: Take the fermentation broth in S3, add deionized water to mix, place in an ice water bath, use an ultrasonic cell disruptor to disrupt, perform the first centrifugation, collect the supernatant, heat treat the supernatant at 80-100°C for 3-8 minutes, then perform the second centrifugation, collect the supernatant, and obtain Citicoline.
6. The method according to claim 5, wherein The inoculation amount of seed liquid in S3 is 0.5%-1.2%.
7. The method according to claim 5, wherein In S4, the first centrifugation condition is centrifugation at 6000-8000 rpm for 8-15 min, and the second centrifugation condition is centrifugation at 10000-15000 rpm for 8-12 min.
Citation Information
Patent Citations
Genetically engineered bacterium for producing citicoline as well as construction method and application of genetically engineered bacterium
CN116144559A
Genetically engineered bacterium for efficiently synthesizing cytidine from beginning by taking cheap carbon sources such as glucose and like as substrates without plasmids, method and application of genetically engineered bacterium
CN115948307A
Method for promoting synthesis of cytidine and application
CN116656585A
Method for producing citicoline through fermentation of engineering modified bacillus subtilis
CN116790466A
Genetically engineered bacterium for producing cytidine and application of genetically engineered bacterium
CN117802186A