Method for screening cadmium-tolerant gene of spanishneedles herb by using yeast strain ycf1

Abstract

The invention relates to the technical field of gene screening, and discloses a method for screening a cadmium-resistant gene of spanishneedles herb by using a yeast strain ycf1, and the method comprises the following steps: S1, carrying out no-load plasmid transformation on recipient bacteria ycf1; s2, transforming recipient bacteria ycf1 in a spanishneedles herb library; s3, preparing a yeast working bacterial liquid; and S4, cadmium concentration screening. By adopting yeast screening, the interaction can be simulated in a cell environment close to a natural state, and the method has the following advantages that high-throughput screening capability is realized, and a large number of samples can be rapidly screened; convenience and operability are achieved, and the method is suitable for being widely applied to different laboratories; the stability is realized, the interaction research in yeast cells is more stable, and the influence of the environment on the experimental result is reduced.

Description

Technical Field

[0001] The present invention relates to the technical field of gene screening, in particular to a method for screening a cadmium-resistant gene of Bidens pilosa L. by utilizing a yeast strain ycf1. Background Art

[0002] Heavy metal cadmium pollution in soil is hidden, long-term and irreversible, which will pose a threat to crop growth and seriously affect food production.

[0003] At present, the more common method of soil heavy metal remediation is to use cadmium hyperaccumulator plants for green remediation. Its mechanism is mainly through the absorption, accumulation and transformation of heavy metal elements by certain plants to achieve the purpose of reducing heavy metal contamination of soil. Bidens pilosa L. is an annual herbaceous plant of the genus Bidens in the Asteraceae family. Literature shows that Bidens pilosa improves its ability to chelate heavy metals by increasing the content of oxalic acid, malic acid and citric acid in the body, and reduces the toxicity of cadmium entering the plant body by storing and distributing it in the form of oxalate in a less active pectin and protein-bound state, and subcellularly. This reduces the toxicity of cadmium entering the plant body and improves the plant's tolerance to heavy metals. Compared with other recorded cadmium hyperaccumulators, Bidens pilosa has a strong ability to withstand harsh environments and grows rapidly, making it an ideal material for remediating heavy metal contaminated soil.

[0004] However, there is no research on screening its cadmium resistance. Summary of the Invention

[0005] The purpose of the present invention is to solve the problems existing in the prior art and to propose a method for screening the cadmium-resistant gene of Bidens pilosa L. by using the yeast strain ycf1.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] A method for screening a cadmium-resistant gene of Bidens pilosa L. using yeast strain ycf1 comprises the following steps:

[0008] S1, recipient strain ycf1 transformed with empty plasmid;

[0009] S2, Bidens pilosa library transformed into recipient strain ycf1;

[0010] S3, preparation of yeast working culture solution;

[0011] S4, cadmium concentration screening.

[0012] Preferably, step S1 includes a yeast transformation reaction, a yeast transformation method, and a control positive clone PCR verification;

[0013] Among them, the yeast transformation reaction is to transfer the empty plasmid into ycf1.

[0014] Preferably, the specific steps of the yeast transformation method are:

[0015] (1) Pick a single ycf1 colony from the YPDA plate and inoculate it into 4 ml of YPDA liquid medium. Shake and culture at 30°C, 225 rpm for 18-20 h until the OD 600 >1.5;

[0016] (2) Transfer to YPDA liquid culture medium, the culture volume is 50ml, and the initial OD 600 =0.2, 30°C, 225 rpm, shake culture for 4-5 h until OD 600 =0.6;

[0017] (3) Centrifuge to collect bacteria at room temperature, 4000 rpm, 5 min;

[0018] (4) Resuspend the cells in 20 ml of sterile water, mix well, and centrifuge at 4000 rpm for 5 min at room temperature. Discard the supernatant.

[0019] (5) Resuspend the cells in 5 ml of 0.1 M LiAc, mix well, and centrifuge at room temperature, 4000 rpm, for 5 min. Discard the supernatant.

[0020] (6) Resuspend the cells in 500 μl of 0.1 M LiAc, mix well, and dispense into 1.5 ml centrifuge tubes, 50 μl each, for later use;

[0021] (7) Add the following reagents to each 1.5 ml centrifuge tube in sequence and mix thoroughly by pipetting or vigorous shaking for about 1 min.

[0022] (8) Incubate in a water bath at 30°C for 30 min;

[0023] (9) Heat shock in a 42°C water bath for 25 min;

[0024] (10) Resuscitation in a 30°C water bath for 30 min;

[0025] (11) Centrifuge the cells at room temperature, 4000 rpm, for 5 min, and discard the supernatant.

[0026] (12) For each transformation, suspend the cells in 200 μl of sterile water, mix gently, and spread on the corresponding defect screening plate;

[0027] (13) Culture at 30°C for 4 days.

[0028] Preferably, the control positive clone PCR verification is to randomly select several points from the transformed plate for PCR verification, and the specific process includes:

[0029] (1) Pipette 3-3.5 μl of yeast lysis buffer into a PCR tube. Use a sterile pipette tip or toothpick to pick up an appropriate amount of yeast into the PCR tube.

[0030] (2) After pipetting (stirring) to mix thoroughly, incubate at 98°C for 10-20 minutes;

[0031] (3) Prepare another sterile PCR tube and prepare the reaction system to complete the verification.

[0032] Preferably, the specific process of step S2 is:

[0033] (1) Pick a single ycf1 colony from the YPDA plate and inoculate it into 50 ml of YPDA liquid medium. Incubate at 30°C, 225 rpm, and shake for 18-20 h (overnight) until the OD 600 >1.5;

[0034] (2) Transfer to 500ml of YPDA liquid to make the initial OD 600 =0.2, 30°C, 225 rpm, shake culture for 4-5 h until OD 600 =0.6;

[0035] (3) Centrifuge to collect bacteria at room temperature, 4000 rpm, 5 min;

[0036] (4) Resuspend the cells in 30 ml of sterile water, mix well, and centrifuge at 4000 rpm for 5 min at room temperature. Discard the supernatant.

[0037] (5) Resuspend the cells in 20 ml of 0.1 M LiAc, mix well, and centrifuge at 4000 rpm for 5 min at room temperature. Discard the supernatant.

[0038] (6) Resuspend the cells in 10 ml of 0.1 M LiAc, mix well, and centrifuge at 4000 rpm for 5 min at room temperature. Discard the supernatant.

[0039] (7) Add the following reagents to the centrifuge tube in sequence and mix thoroughly by pipetting or vigorous shaking for about 1 minute until completely mixed.

[0040] (8) Incubate in a water bath at 30°C for 30 min;

[0041] (9) Heat shock in a 42°C water bath for 25 min;

[0042] (10) Resuscitation in a 30°C water bath for 1 hour;

[0043] (11) Centrifuge the cells at room temperature, 4000 rpm, 5 min, discard the supernatant, resuspend the cells in 6 ml of sterile water, and take 100 μl of the stock solution to dilute 10 -2 , 10-3 , 10 -4 , spread on 90 mm SD-U plates, and the rest spread on 150 mm SD-U plates, 300 μl / plate;

[0044] (12) Culture at 30°C for 3-7 days and observe the growth of the colonies.

[0045] Preferably, in step S3, in order to identify the quality of the library, 24 clones are randomly selected for PCR verification;

[0046] The specific verification steps are as follows:

[0047] (1) Pipette 3-3.5 μl of yeast lysis buffer into a PCR tube. Use a sterile pipette tip or toothpick to pick up an appropriate amount of yeast into the PCR tube.

[0048] (2) After pipetting (stirring) to mix thoroughly, incubate at 98°C for 10-20 minutes;

[0049] (3) Prepare another sterile PCR tube and prepare the reaction system to complete the verification.

[0050] Preferably, in step S3, after verification, all clones on the plate are scraped off with 2×YPDA liquid. Take 100 μl of the stock solution and dilute it with ddH2O for 10 min. -2 , 10 -3 , 10 -4 , 10 -5 , spread 100ul of the dilution on a 90mm SD-Ura plate and count the yeast colonies.

[0051] Preferably, the specific process of step S4 is:

[0052] A series of SG-U (galactose substituted glucose) solid culture media containing 0 μM, 40 μM, 60 μM, 80 μM, 100 μM, 110 μM, 120 μM, and 130 μM CdCl2 were prepared;

[0053] Take the working bacterial solution and the empty control strain and dilute them with ddH2O to OD 600 =0.05. Then dilute to 10 -0 , 10 -1 , 10 -2 , spot the plates on the above series of plates, culture at 30℃ for 7 days, observe the growth of colonies and determine the cadmium screening concentration.

[0054] Preferably, the method further comprises step S5, identifying positive clones in the library, which specifically comprises the following steps:

[0055] Take 300uL of the library working bacterial solution and spread it on 150mm SG-Ura plates, a total of 20 plates;

[0056] After the clones grew, 96 clones were randomly selected for colony PCR and plated onto SG-Ura plates;

[0057] In order to identify the genes of the positive clones screened, the following tests were performed:

[0058] 1) Pipette 3-3.5 μl of Yeast lysis buffer into a PCR tube. Use a sterile pipette tip or toothpick to pick up an appropriate amount of yeast into the PCR tube.

[0059] 2) After mixing by pipetting (stirring), incubate at 98°C for 10-20 minutes;

[0060] 3) Prepare another sterile PCR tube and prepare the reaction system;

[0061] 4) The bands identified by colony PCR were sent for sequencing. After the sequencing results were returned, BLAST comparison was performed using the NCBI database.

[0062] Preferably, the process further includes step S6, rotation verification, which specifically comprises the following steps:

[0063] The positive clone transformants grown on the SG-Ura deficient plate after streaking the single clone were resuspended in ddH2O, and 10uL was spotted on SG-Ura solid plate and SG-Ura+120mM CdCl2 solid plate, and cultured at 30℃ for 3-4 days to obtain the rotation verification results.

[0064] Compared with the prior art, the present invention has the following beneficial effects:

[0065] The present invention transforms yeast strain ycf1 with the pYES2-NTB empty vector as a control group. Next, the previously constructed Bidens pilosa library is transformed into recipient strain ycf1 to prepare a yeast working culture solution. Then, SG-U solid culture medium prepared with different concentrations of cadmium chloride (CdCl2) is used for screening. After determining the screening concentration, the library working culture solution is coated on a cadmium plate with the corresponding concentration to identify library positive clones. The positive clones are sequenced and finally subjected to rotation verification. Compared with the existing technology, the present invention uses yeast screening to simulate these interactions in a cellular environment close to the natural state and has the following advantages:

[0066] 1. High-throughput screening capability, capable of rapidly screening a large number of samples;

[0067] 2. Simplicity and operability make it suitable for wide application in different laboratories;

[0068] 3. Stability. Interaction studies conducted in yeast cells are more stable, reducing the impact of the environment on experimental results. BRIEF DESCRIPTION OF THE DRAWINGS

[0069] Figure 1 Schematic diagram of the control colony PCR results;

[0070] Figure 2 Schematic diagram of library quality identification;

[0071] Figure 3 Count yeast colonies;

[0072] Figure 4 This is a schematic diagram of the cadmium concentration screening results;

[0073] Figure 5 Schematic diagram of the rotation verification results. DETAILED DESCRIPTION

[0074] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments.

[0075] Reference Figure 1-Figure 5 A method for screening a cadmium-resistant gene in Bidens pilosa using yeast strain ycf1, comprising:

[0076] 1. Transformation of recipient bacteria ycf1 with empty plasmid

[0077] 1. Yeast transformation reaction

[0078] The following plasmids were transferred into ycf1 respectively, as shown in the following table:

[0079]

[0080] 2. Yeast transformation method

[0081] (1) Pick a single ycf1 colony from the YPDA plate and inoculate it into 4 ml of YPDA liquid medium. Incubate at 30°C, 225 rpm, and shake for 18-20 h (overnight) until the OD 600 >1.5.

[0082] (2) Transfer to YPDA liquid culture medium, the culture volume is 50ml, and the initial OD 600 =0.2, 30°C, 225 rpm, shake culture for 4-5 h until OD 600 =0.6.

[0083] (3) Collect the bacteria by centrifugation at room temperature, 4000 rpm, for 5 min.

[0084] (4) Resuspend the cells in 20 ml of sterile water, mix well, and centrifuge at room temperature, 4000 rpm, for 5 min. Discard the supernatant.

[0085] (5) Resuspend the cells in 5 ml of 0.1 M LiAc, mix well, and centrifuge at room temperature, 4000 rpm, for 5 min. Discard the supernatant.

[0086] (6) Resuspend the cells in 500 μl of 0.1 M LiAc, mix well, and aliquot into 1.5 ml centrifuge tubes, 50 μl each (for each transformation), for later use.

[0087] (7) Add the following reagents to each 1.5 ml centrifuge tube in sequence and mix thoroughly by pipetting or vigorous shaking for about 1 minute until completely mixed.

[0088]

[0089] (8) Incubate in a 30°C water bath for 30 min.

[0090] (9) Heat shock in a 42°C water bath for 25 min.

[0091] (10) Resuscitate in a 30°C water bath for 30 minutes.

[0092] (11) Collect the bacteria by centrifugation at room temperature, 4000 rpm, for 5 min, and discard the supernatant.

[0093] (12) For each transformation, suspend the cells in 200 μl of sterile water, mix gently, and spread on the corresponding defective type (SD-Ura) screening plate.

[0094] (13) Culture at 30°C for 4 days.

[0095] 3. PCR verification of positive control clones

[0096] Eight spots were randomly selected from the transformed plate (SD-Ura) and verified by PCR. If correct, these spots were used for yeast phenotype verification. Positive clones were amplified using the Yeast Colony Rapid Detection Kit (Cat. No. RY8001), independently developed by Nanjing Ruiyuan Biotechnology Co., Ltd.

[0097] The specific experimental steps are as follows:

[0098] (1) Pipette 3-3.5 μl of Yeast lysis buffer into a PCR tube. Use a sterile pipette tip or toothpick to pick up an appropriate amount of yeast into the PCR tube.

[0099] (2) After mixing by pipetting (stirring), place at 98℃ for 10-20 minutes.

[0100] (3) Prepare another sterile PCR tube and prepare the reaction system according to the table below.

[0101] PCR reaction system:

[0102]

[0103] The reaction solution in step 2 was centrifuged briefly, mixed and then 1 μl was taken as the template, which was the best;

[0104] F:CAGCTGTAATACGACTCACTATAGG

[0105] R:AGGGTTAGGGATAGGCTTACCTTCG

[0106] PCR reaction conditions:

[0107]

[0108] The annealing temperature is adjusted according to the Tm value of the primer, generally set to Tm-5°C

[0109] The results are as follows Figure 1 shown.

[0110] 2. Transformation of Bidens pilosa library into recipient strain ycf1

[0111] (1) Pick a single ycf1 colony from the YPDA plate and inoculate it into 50 ml of YPDA liquid medium. Incubate at 30°C, 225 rpm, and shake for 18-20 h (overnight) until the OD 600 >1.5.

[0112] (2) Transfer to 500ml of YPDA liquid to make the initial OD 600 =0.2, 30°C, 225 rpm, shake culture for 4-5 h until OD 600 =0.6.

[0113] (3) Collect the bacteria by centrifugation at room temperature, 4000 rpm, for 5 min.

[0114] (4) Resuspend the cells in 30 ml of sterile water, mix well, and centrifuge at room temperature, 4000 rpm, for 5 min. Discard the supernatant.

[0115] (5) Resuspend the cells in 20 ml of 0.1 M LiAc, mix well, and centrifuge at room temperature, 4000 rpm, for 5 min. Discard the supernatant.

[0116] (6) Resuspend the cells in 10 ml of 0.1 M LiAc, mix well, and centrifuge at room temperature, 4000 rpm, for 5 min. Discard the supernatant.

[0117] (7) Add the following reagents to the centrifuge tube in sequence and mix thoroughly by blowing with a pipette or by vigorous shaking for about 1 minute until completely mixed.

[0118]

[0119] (8) Incubate in a 30°C water bath for 30 min.

[0120] (9) Heat shock in a 42°C water bath for 25 min.

[0121] (10) Resuscitate in a 30°C water bath for 1 hour.

[0122] (11) Centrifuge the cells at room temperature, 4000 rpm, 5 min, discard the supernatant, resuspend the cells in 6 ml of sterile water, and take 100 μl of the stock solution to dilute 10 -2 , 10 -3 , 10 -4 , spread on 90mm SD-U plates, and the rest spread on 150mm SD-U plates, 300μl / plate.

[0123] (12) Culture at 30°C for 3-7 days and observe the growth of the colonies.

[0124] 3. Preparation of Yeast Working Liquid

[0125] 3.1 Colony PCR verification

[0126] To verify the quality of the library, 24 clones were randomly selected for PCR verification. Positive clones were amplified using a Yeast Colony Rapid Detection Kit (Cat. No. RY8001), independently developed by Nanjing Ruiyuan Biotechnology Co., Ltd.

[0127] The specific experimental steps are as follows:

[0128] 1. Pipette 3-3.5μl Yeast lysis buffer into a PCR tube. Use a sterile pipette tip or toothpick to pick up an appropriate amount of yeast into the PCR tube.

[0129] 2. After mixing by pipetting (stirring), incubate at 98°C for 10-20 minutes.

[0130] 3. Prepare another sterile PCR tube and prepare the reaction system according to the table below.

[0131] PCR reaction system:

[0132]

[0133] The reaction solution in step 2 was centrifuged briefly, mixed and then 1 μl was taken as a template.

[0134] F:CAGCTGTAATACGACTCACTATAGG

[0135] R:AGGGTTAGGGATAGGCTTACCTTCG

[0136] PCR reaction conditions:

[0137]

[0138] The annealing temperature is adjusted according to the Tm value of the primer, generally set to Tm-5°C

[0139] The results are as follows Figure 2 shown.

[0140] Result: The band size was in line with expectations, and downstream experiments were continued.

[0141] 3.2 Scraper

[0142] Scrape off all the clones on the plate with 2×YPDA liquid. Take 100 μl of the stock solution and dilute it with ddH2O for 10 min. -2 , 10 -3 , 10 -4 , 10 -5 , take 100ul of the dilution and spread it on a 90mm SD-Ura plate.

[0143] 3.3 Results, such as Figure 3 As shown;

[0144] Divide into 16 equal parts and count.

[0145] Library titer CFU / ml = number of clones on the plate / coating volume (ml) × dilution factor = 209 × 16 / 0.1 × 10 4 =3.344×10 8

[0146] CFU = titer × total volume = 3.344 × 10 8 ×1=3.344×10 8

[0147] 4. Cadmium resistance screening

[0148] Prepare a series of SG-U (galactose substituted for glucose) solid media containing 0μM, 40μM, 60μM, 80μM, 100μM, 110μM, 120μM, and 130μM CdCl2. The specific configuration is as follows, using a total volume of 15mL as an example:

[0149]

[0150] Take the working bacterial solution and the empty control strain and dilute them with ddH2O to OD 600 =0.05. Then dilute to 10 -0 , 10 -1 , 10 -2 , spot the plates on the above series of plates, culture at 30℃ for 7 days, observe the growth of colonies and determine the cadmium screening concentration.

[0151] 3. Cadmium concentration screening results

[0152] like Figure 4 As shown, the experimental group can still grow under the concentration of SG-U + 120μM cadmium, while the control group cannot grow.

[0153] Conclusion: 120 mM cadmium concentration was selected as the library screening condition.

[0154] 5. Identification of positive clones in the library

[0155] Under the above conditions, 300uL of the library working bacterial solution was spread on 150mm SG-Ura plates, for a total of 20 plates.

[0156] After the clones grew out, 96 clones were randomly picked for colony PCR and plated on SG-Ura plates.

[0157] In order to identify the genes of the positive clones screened, a Yeast Colony Rapid Detection Kit (Cat. No. RY8001) independently developed by Nanjing Ruiyuan Biotechnology Co., Ltd. was used to amplify the positive clones.

[0158] The specific experimental steps are as follows:

[0159] 1) Pipette 3-3.5 μl of Yeast lysis buffer into a PCR tube. Use a sterile pipette tip or toothpick to pick up an appropriate amount of yeast into the PCR tube.

[0160] 2) Mix thoroughly by pipetting (stirring), and incubate at 98°C for 10-20 minutes.

[0161] 3) Prepare another sterile PCR tube and prepare the reaction system according to the table below.

[0162] PCR reaction system:

[0163]

[0164] The reaction solution in step 2 was centrifuged briefly, mixed and then 1 μl was taken as a template.

[0165] F:CAGCTGTAATACGACTCACTATAGG

[0166] R:AGGGTTAGGGATAGGCTTACCTTCG

[0167] PCR reaction conditions:

[0168]

[0169] The annealing temperature is adjusted according to the Tm value of the primer, generally set to Tm-5°C

[0170] The bands identified by colony PCR were sent for testing, and after the sequencing results were returned, the NCBI database was used to

[0171] BLAST alignment (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome) was performed. The specific results are shown in the following table:

[0172]

[0173] As shown in the table above, after BLAST analysis of the sequencing results of 96 positive clones, eight distinct sequences were ultimately obtained, of which sequence numbers 1, 3, and 5 are metallothionein genes. Metallothioneins are cadmium-binding metalloproteins isolated from animal organs by American scientist Margoshoes in 1957 while studying the biological effects of metals. Due to their low molecular weight and high thiol content, they are called metallothioneins (MTs). MTs are a class of metal-binding proteins ubiquitous in organisms, possessing metal-binding capacity and high inducibility. Their thiol groups strongly chelate toxic metals, primarily cadmium, copper, and zinc. Currently, many articles have demonstrated that under metal stress, plants regulate metal balance and buffer toxic heavy metals by inducing the production of MT. For example, an article entitled "Structural Role of Cadmium and Zinc in Metallothionein Oxidation by Hydrogen Peroxide: The Resilience of Metal–Thiolate Clusters" published in the Journal of the American Chemical Society revealed the structural role of cadmium and zinc in hydrogen peroxide oxidation of metallothionein.

[0174] 6. Rotation Verification

[0175] The positive clone transformants grown on the SG-Ura-deficient plates from the above 8 single clones were resuspended in ddH2O, and 10uL was spotted on SG-Ura solid plates and SG-Ura+120mM CdCl2 solid plates, and cultured at 30℃ for 3-4 days.

[0176] The rotation verification results are as follows Figure 5 As shown, it shows that:

[0177] The negative control was able to grow on SG-U but could not grow on SG-U + 120 mM CdCl2;

[0178] The 8 clones screened could grow on SG-U and SG-U+120mM CdCl2 plates.

[0179] The above description is only a preferred specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any technician familiar with the technical field, within the technical scope disclosed by the present invention, who makes equivalent replacements or changes based on the technical solution and inventive concept of the present invention, should be covered by the scope of protection of the present invention.

Claims

1. A method for screening a cadmium-resistant gene in Bidens pilosa using yeast strain ycf1, characterized in that: The following steps are involved: S1, recipient strain ycf1 transformed with empty plasmid; S2, Bidens pilosa library transformed into recipient strain ycf1; S3, preparation of yeast working culture solution; S4, cadmium concentration screening.

2. The method for screening the cadmium-resistant gene of Bidens pilosa L. using the yeast strain ycf1 according to claim 1, characterized in that: Step S1 includes yeast transformation reaction, yeast transformation method and control positive clone PCR verification; Among them, the yeast transformation reaction is to transfer the empty plasmid into ycf1.

3. The method for screening the cadmium-resistant gene of Bidens pilosa L. using yeast strain ycf1 according to claim 2, characterized in that: The specific steps of the yeast transformation method are: (1) Pick a single ycf1 colony from the YPDA plate and inoculate it into 4 ml of YPDA liquid medium. Shake and culture at 30°C, 225 rpm for 18-20 h until the OD 600 >1.5; (2) Transfer to YPDA liquid culture medium, the culture volume is 50ml, and the initial OD 600 =0.2, 30°C, 225 rpm, shake culture for 4-5 h until OD 600 =0.6; (3) Centrifuge to collect bacteria at room temperature, 4000 rpm, 5 min; (4) Resuspend the cells in 20 ml of sterile water, mix well, and centrifuge at 4000 rpm for 5 min at room temperature. Discard the supernatant. (5) Resuspend the cells in 5 ml of 0.1 M LiAc, mix well, and centrifuge at room temperature, 4000 rpm, for 5 min. Discard the supernatant. (6) Resuspend the cells in 500 μl of 0.1 M LiAc, mix well, and dispense into 1.5 ml centrifuge tubes, 50 μl each, for later use; (7) Add the following reagents to each 1.5 ml centrifuge tube in sequence and mix thoroughly by pipetting or vigorous shaking for about 1 min. (8) Incubate in a water bath at 30°C for 30 min; (9) Heat shock in a 42°C water bath for 25 min; (10) Resuscitation in a 30°C water bath for 30 min; (11) Centrifuge the cells at room temperature, 4000 rpm, for 5 min, and discard the supernatant. (12) For each transformation, suspend the cells in 200 μl of sterile water, mix gently, and spread on the corresponding defect screening plate; (13) Culture at 30°C for 4 days.

4. The method for screening the cadmium-resistant gene of Bidens pilosa L. using the yeast strain ycf1 according to claim 3, characterized in that: The control positive clone PCR verification is to randomly select several points from the transformed plate for PCR verification, and the specific process includes: (1) Pipette 3-3.5 μl of yeast lysis buffer into a PCR tube. Use a sterile pipette tip or toothpick to pick up an appropriate amount of yeast into the PCR tube. (2) After pipetting (stirring) to mix thoroughly, incubate at 98°C for 10-20 minutes; (3) Prepare another sterile PCR tube and prepare the reaction system to complete the verification.

5. The method for screening the cadmium-resistant gene of Bidens pilosa L. using yeast strain ycf1 according to claim 1, characterized in that: The specific process of step S2 is: (1) Pick a single ycf1 colony from the YPDA plate and inoculate it into 50 ml of YPDA liquid medium. Incubate at 30°C, 225 rpm, and shake for 18-20 h (overnight) until the OD 600 >1.5; (2) Transfer to 500ml of YPDA liquid to make the initial OD 600 =0.2, 30°C, 225 rpm, shake culture for 4-5 h until OD 600 =0.6; (3) Centrifuge to collect bacteria at room temperature, 4000 rpm, 5 min; (4) Resuspend the cells in 30 ml of sterile water, mix well, and centrifuge at 4000 rpm for 5 min at room temperature. Discard the supernatant. (5) Resuspend the cells in 20 ml of 0.1 M LiAc, mix well, and centrifuge at 4000 rpm for 5 min at room temperature. Discard the supernatant. (6) Resuspend the cells in 10 ml of 0.1 M LiAc, mix well, and centrifuge at 4000 rpm for 5 min at room temperature. Discard the supernatant. (7) Add the following reagents to the centrifuge tube in sequence and mix thoroughly by pipetting or vigorous shaking for about 1 minute until completely mixed. (8) Incubate in a water bath at 30°C for 30 min; (9) Heat shock in a 42°C water bath for 25 min; (10) Resuscitation in a 30°C water bath for 1 hour; (11) Centrifuge the bacteria at room temperature, 4000 rpm, 5 min, discard the supernatant, resuspend the bacteria in 6 ml of sterile water, and take 100 μl of the stock solution to dilute 10 -2 , 10 -3 , 10 -4 , spread on 90 mm SD-U plates, and the rest spread on 150 mm SD-U plates, 300 μl / plate; (12) Culture at 30°C for 3-7 days and observe the growth of the colonies.

6. The method for screening the cadmium-resistant gene of Bidens pilosa L. using yeast strain ycf1 according to claim 1, characterized in that: In step S3, 24 clones were randomly selected for PCR verification to identify the quality of the library; The specific verification steps are as follows: (1) Pipette 3-3.5 μl of yeast lysis buffer into a PCR tube. Use a sterile pipette tip or toothpick to pick up an appropriate amount of yeast into the PCR tube. (2) After pipetting (stirring) to mix thoroughly, incubate at 98°C for 10-20 minutes; (3) Prepare another sterile PCR tube and prepare the reaction system to complete the verification.

7. The method for screening the cadmium-resistant gene of Bidens pilosa L. using yeast strain ycf1 according to claim 1, characterized in that: In step S3, after verification, all clones on the plate were scraped off with 2×YPDA liquid. 100 μl of the stock solution was diluted with ddH2O for 10 min. -2 , 10 -3 , 10 -4 , 10 -5 , spread 100ul of the dilution on a 90mm SD-Ura plate and count the yeast colonies.

8. The method for screening the cadmium-resistant gene of Bidens pilosa L. using yeast strain ycf1 according to claim 1, characterized in that: The specific process of step S4 is as follows: A series of SG-U (galactose substituted glucose) solid culture media containing 0 μM, 40 μM, 60 μM, 80 μM, 100 μM, 110 μM, 120 μM, and 130 μM CdCl2 were prepared; Take the working bacterial solution and the empty control strain and dilute them with ddH2O to OD 600 =0.

05. Then dilute to 10 -0 , 10 -1 , 10 -2 , spot the plates on the above series of plates, culture at 30℃ for 7 days, observe the growth of colonies and determine the cadmium screening concentration.

9. The method for screening the cadmium-resistant gene of Bidens pilosa L. using yeast strain ycf1 according to claim 1, characterized in that: The method also includes step S5, identifying positive clones in the library, which specifically includes the following steps: Take 300uL of the library working bacterial solution and spread it on 150mm SG-Ura plates, a total of 20 plates; After the clones grew, 96 clones were randomly selected for colony PCR and plated onto SG-Ura plates; In order to identify the genes of the positive clones screened, the following tests were performed: 1) Pipette 3-3.5 μl of Yeast lysis buffer into a PCR tube. Use a sterile pipette tip or toothpick to pick up an appropriate amount of yeast into the PCR tube. 2) After mixing by pipetting (stirring), incubate at 98°C for 10-20 minutes; 3) Prepare another sterile PCR tube and prepare the reaction system; 4) The bands identified by colony PCR were sent for sequencing. After the sequencing results were returned, BLAST comparison was performed using the NCBI database.

10. The method for screening the cadmium-resistant gene of Bidens pilosa L. using the yeast strain ycf1 according to claim 8, characterized in that: The step S6 is also included, which is a rotation verification step. The specific steps are as follows: The positive clone transformants grown on the SG-Ura deficient plate after streaking the single clone were resuspended in ddH2O, and 10uL was spotted on SG-Ura solid plate and SG-Ura+120mM CdCl2 solid plate, and cultured at 30℃ for 3-4 days to obtain the rotation verification results.

Images