Composition and cream with effects of resisting inflammation and repairing skin barrier injury as well as preparation method and application of composition and cream

Abstract

The invention provides a composition and cream with anti-inflammatory and skin barrier injury repairing effects as well as a preparation method and application of the composition and cream, and belongs to the technical field of skin injury repairing. The invention provides a composition with anti-inflammatory and skin barrier injury repairing effects. The composition is prepared from matrine, dipotassium glycyrrhizinate, bisabolol and asiaticoside according to the weight ratio of 1: 1: 1: 1. The composition provided by the invention can play a role through a multi-target mechanism, such as up-regulation of Invoucrin, and provides a more effective prevention and treatment scheme for skin barrier dysfunction related diseases and sensitive skin.

Description

Technical Field

[0001] The present invention belongs to the technical field of skin damage repair, and specifically relates to a composition with anti-inflammatory and skin barrier damage repairing effects, a cream, and a preparation method and application thereof. Background Art

[0002] Skin barrier dysfunction and inflammatory responses are common pathological features of various skin diseases (such as atopic dermatitis, eczema, and allergic dermatitis). A damaged skin barrier leads to increased transepidermal water loss and facilitates the invasion of external irritants, which in turn triggers immune cell activation and chronic inflammation. Persistent inflammation further damages the barrier structure, creating a vicious cycle. Currently, treatments for skin barrier repair and anti-inflammatory treatments primarily include glucocorticoids, immunosuppressants, and natural plant extracts, but existing technologies still have significant limitations. For example, long-term use of glucocorticoids and immunosuppressants can lead to side effects such as skin atrophy, capillary dilation, and drug resistance, and they are unable to fundamentally repair the damaged barrier. Natural medicines based on plant active ingredients have attracted much attention due to their high safety, but existing plant extracts have shown unsatisfactory effects on repairing skin barrier damage. Therefore, currently available barrier repair products mainly supplement lipid components such as ceramides and cholesterol. While they can temporarily improve skin dryness, they are not effective in repairing the barrier under inflammatory conditions and lack a synergistic mechanism to address the vicious cycle of barrier damage and inflammation.

[0003] In addition, the existing natural ingredients in this field mostly focus on a single function (such as anti-inflammatory or repair), and cannot simultaneously solve the two-way problem of barrier damage and inflammation. Moreover, the ingredient combination of current commercially available compound products lacks scientific optimization, and the synergistic enhancement or antagonistic effects between the ingredients are not fully considered. Natural extracts have problems such as poor stability (such as easy oxidation and degradation) and low transdermal absorption rate, which limit their clinical efficacy. Therefore, there is an urgent need in this field to develop a composition that has both anti-inflammatory and barrier repair effects, synergistic optimization of ingredients, and high safety, which has important clinical value. Summary of the Invention

[0004] In view of this, the object of the present invention is to provide a composition or cream that has both anti-inflammatory and skin barrier damage repair effects, which is generally applicable to individuals with sensitive skin.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a composition with anti-inflammatory and skin barrier damage repairing effects, comprising matrine, dipotassium glycyrrhizate, bisabolol and asiaticoside; the weight ratio of matrine, dipotassium glycyrrhizate, bisabolol and asiaticoside is 1:1:1:1.

[0007] The present invention also provides the use of the above composition in preparing skin barrier damage repair or anti-inflammatory products.

[0008] The present invention also provides the use of the above composition in preparing a product for upregulating the expression of involucrin.

[0009] The present invention also provides use of the composition in preparing atopic dermatitis prevention and treatment product.

[0010] The present invention also provides a cream with anti-inflammatory and skin barrier damage repairing effects. The cream comprises an active ingredient and excipients, and the active ingredient comprises the above composition.

[0011] Preferably, the weight portion of the active ingredient in the cream is 1 to 2 parts, and the weight portion of the excipient in the cream is 98 to 99 parts.

[0012] Preferably, the excipients include polyethylene glycol, cetyl alcohol, medium chain triglycerides, mono- and distearic acid glyceryl, ethyl hydroxybenzoate, diethylene glycol monoethyl ether and water.

[0013] Preferably, the weight parts of each raw material in the auxiliary material are: 10 parts of polyethylene glycol, 3 parts of hexadecanol, 8 parts of medium chain triglycerides, 2 parts of mono- and distearic glycerides, 0.1 parts of ethyl hydroxybenzoate, 15 parts of diethylene glycol monoethyl ether, and 59.9-60.9 parts of water.

[0014] The present invention also provides a method for preparing the above-mentioned cream, comprising the following steps: mixing polyethylene glycol, hexadecanol, medium-chain triglycerides, mono- and distearic glycerides, ethyl hydroxybenzoate, and water to obtain mixture 1; mixing diethylene glycol monoethyl ether and an active ingredient to obtain mixture 2; and mixing mixture 1 and mixture 2 to obtain a cream.

[0015] Preferably, when obtaining mixture 1, the mixing temperature is 85°C; when mixture 1 and mixture 2 are mixed, the mixing temperature is 55°C.

[0016] Beneficial effects of the present invention:

[0017] The composition of the present invention combines matrine, dipotassium glycyrrhizate, bisabolol and asiaticoside, and can exert its effects through a multi-target mechanism, such as upregulating involucrin, thereby providing a more effective prevention and treatment plan for diseases related to skin barrier dysfunction and sensitive skin. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The effect of the composition of the present invention on the normal growth of HaCaT cells, where * indicates P < 0.05;

[0019] Figure 2The effect of the composition of the present invention on the expression of HBD2 mRNA in HaCaT cells, where *** indicates P < 0.001;

[0020] Figure 3 The effect of the composition of the present invention on the expression of TNF-α mRNA in the HaCaT inflammation model, where ### indicates that compared with the Control group, P < 0.001; *** indicates that compared with the Model group, P < 0.001;

[0021] Figure 4 The effect of the composition of the present invention on the expression of IL-1β mRNA in the HaCaT inflammation model, where # indicates P < 0.05 compared with the Control group; * indicates P < 0.05 compared with the Model group;

[0022] Figure 5 The effect of the cream of the present invention on the epidermis of mice with mechanical barrier damage model;

[0023] Figure 6 The effect of the cream of the present invention on the epidermis of mice with mechanical barrier damage model was observed under a dermatoscope;

[0024] Figure 7 The effect of the cream of the present invention on the body weight of mice with mechanical barrier damage model;

[0025] Figure 8 The effect of the cream of the present invention on transepidermal water loss in mice with mechanical barrier damage model, where ### indicates P < 0.001 compared with the blank group; * indicates P < 0.05 compared with the model group;

[0026] Figure 9 The effect of the cream of the present invention on the pathological changes of epidermis in mice with mechanical barrier damage model;

[0027] Figure 10 The effect of the cream of the present invention on the epidermal thickness of mice in the mechanical barrier damage model, where the left figure is a sample diagram, and the right figure is a statistical bar chart of the values ​​of each group, where ### indicates P < 0.001 compared with the Control group; *** indicates P < 0.001 compared with the Model group, KBJZ group or MJ1% group;

[0028] Figure 11 The effect of the cream of the present invention on the expression of epidermal ceramide in mice with mechanical barrier damage model, where ### indicates P < 0.001 compared with the Control group; * indicates P < 0.05; *** indicates P < 0.001;

[0029] Figure 12 The effect of the cream of the present invention on the ear skin of atopic dermatitis-like model mice;

[0030] Figure 13 The effect of the cream of the present invention on the body weight of atopic dermatitis-like model mice, where *** indicates P < 0.001;

[0031] Figure 14 The effect of the cream of the present invention on the EASI score of the ear skin of atopic dermatitis-like model mice, where ### indicates P < 0.001 compared with the blank group; * indicates P < 0.05 compared with the model group; *** indicates P < 0.001 compared with the model group;

[0032] Figure 15 The effect of the cream of the present invention on the pathological changes of the ear skin of atopic dermatitis-like model mice;

[0033] Figure 16 The effect of the cream of the present invention on the epidermal thickness of the ear skin of atopic dermatitis-like model mice, where ### indicates P < 0.001 compared with the blank group; *** indicates P < 0.001, and ns indicates P > 0.05;

[0034] Figure 17 The effect of the cream of the present invention on the inflammatory factor IL-4 in the ear skin of atopic dermatitis-like model mice, ### and *** both indicate P < 0.001;

[0035] Figure 18 The effect of the cream of the present invention on the inflammatory factor IL-13 in the ear skin of atopic dermatitis-like model mice, # and * indicate P < 0.05;

[0036] Figure 19 The effect of the cream of the present invention on the inflammatory factor IL-31 in the ear skin of atopic dermatitis-like model mice, ## and ** both indicate P < 0.01, and * indicates P < 0.05;

[0037] Figure 20 The effect of the cream of the present invention on the inflammatory factor FLG in the ear skin of atopic dermatitis-like model mice, ## indicates P < 0.01, *** indicates P < 0.001;

[0038] Figure 21 The results of toluidine blue staining show the effect of the cream of the present invention on mast cell activation in the ear skin of atopic dermatitis-like model mice;

[0039] Figure 22 The statistical results of the effect of the cream of the present invention on mast cell activation in the ear skin of atopic dermatitis-like model mice are shown in Figure 5. ### indicates P < 0.001, * indicates P < 0.05, and *** indicates P < 0.001.

[0040] Figure 23The results show the effect of the cream of the present invention on the expression of involucrin protein in the ear skin of atopic dermatitis-like model mice. The left figure shows the staining section results, and the right figure shows the statistical results. ### indicates P < 0.001, ** indicates P < 0.01, and *** indicates P < 0.001. DETAILED DESCRIPTION

[0041] The present invention provides a composition with anti-inflammatory and skin barrier damage repairing effects, comprising matrine, dipotassium glycyrrhizate, bisabolol and asiaticoside; the weight ratio of matrine, dipotassium glycyrrhizate, bisabolol and asiaticoside is 1:1:1:1.

[0042] The present invention does not specifically limit the specific sources of matrine, dipotassium glycyrrhizate, bisabolol and asiaticoside, and any conventional commercially available product in the art can be used. This application is the first to use monomeric substances extracted from plants in combination. Most of the substances currently added in this field are plant extracts, not monomeric substances. Even if there are reports on the addition of monomeric substances, the concentration of the added monomeric substances is generally high to ensure that the beneficial effects can be exerted. However, too high a concentration will produce irritation, so the effective addition of monomeric substances is actually very difficult to achieve both beneficial effects and no toxic side effects. The present invention uses a variety of monomeric substances in combination, which can produce a synergistic effect on the basis of low-concentration addition, thereby playing a synergistic and toxic-reducing role.

[0043] The present invention also provides the use of the above composition in preparing skin barrier damage repair or anti-inflammatory products.

[0044] The present invention also provides the use of the above composition in preparing a product for upregulating the expression of involucrin, or in preparing a product for preventing and treating atopic dermatitis.

[0045] In the present invention, the types of the products preferably include medicines, skin care products or cosmetics.

[0046] The present invention also provides a cream with anti-inflammatory and skin barrier damage repairing effects. The cream comprises an active ingredient and excipients, and the active ingredient comprises the above composition.

[0047] In the cream of the present invention, the weight portion of the active ingredient is preferably 1 to 2 parts, and the weight portion of the excipient is preferably 98 to 99 parts. In the present invention, the excipients preferably include polyethylene glycol, hexadecanol, medium-chain triglycerides, glyceryl mono- and distearate, ethyl hydroxybenzoate, diethylene glycol monoethyl ether, and water. The water is preferably pure water. The present invention does not specifically limit the specific sources of the various raw materials in the excipients, and conventional commercially available products in this field can be used. In the present invention, the weight portions of the various raw materials in the excipients are preferably: 10 parts of polyethylene glycol, 3 parts of hexadecanol, 8 parts of medium-chain triglycerides, 2 parts of glyceryl mono- and distearate, 0.1 parts of ethyl hydroxybenzoate, 15 parts of diethylene glycol monoethyl ether, and 59.9 to 60.9 parts of water. Involucrin is a marker protein for keratinocyte differentiation and is mainly distributed in the upper part of the epidermal stratum spinosum and the granular layer. It forms a cornified envelope (Cornified Envelope) by cross-linking, and together with loricrin, filaggrin, etc., it constitutes a physical barrier to prevent external allergens, microbial invasion and water loss. A number of clinical studies have found that the expression of Involucrin in AD patients' skin lesions is significantly reduced. The expression of Involucrin is related to the severity of the disease. Reduced expression leads to loose skin barrier structure, promotes allergens (such as dust mites, pollen) to penetrate the epidermis, triggers Th2 type immune response and inflammatory cascade, and aggravates itching, erythema and epidermal exfoliation. The cream provided by the present invention has the effect of increasing the expression of Involucrin, and is dose-dependent, indicating that the cream of the present invention plays a role in improving the symptoms of atopic dermatitis, which is related to increasing the expression of involucrin protein and thus strengthening the barrier function. In addition, the cream of the present invention plays a role in improving the symptoms of atopic dermatitis and is also related to inhibiting mast cell activation.

[0048] The present invention also provides a method for preparing the above-mentioned cream, comprising the following steps: mixing polyethylene glycol, hexadecanol, medium-chain triglycerides, mono- and distearic glycerides, ethyl hydroxybenzoate, and water to obtain mixture 1; mixing diethylene glycol monoethyl ether and an active ingredient to obtain mixture 2; and mixing mixture 1 and mixture 2 to obtain a cream.

[0049] In the present invention, it is preferred to first mix polyethylene glycol, hexadecanol, medium-chain triglycerides, mono- and distearic glyceryl and ethylparaben, and then mix with water. In the present invention, when obtaining mixture 1, the mixing temperature is preferably 85°C. When obtaining mixture 1, in order to ensure that the raw materials are fully mixed, it is preferably required to be homogenized. The present invention has no special restrictions on the specific method of homogenization, and conventional homogenization methods in the art can be used. In the present invention, when diethylene glycol monoethyl ether and the active ingredient are mixed, ultrasonic mixing is preferred, and the present invention has no special restrictions on the specific conditions of ultrasound. In the present invention, when mixing mixture 1 and mixture 2, the mixing temperature is preferably 55°C.

[0050] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0051] In the following examples, unless otherwise specified, all methods are conventional.

[0052] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0053] In the following examples, the manufacturer of matrine is Xi'an Xihai Biotechnology Co., Ltd., with a specification of 50 g (98%); the manufacturer of bisabolol is Guangzhou Shengyuan Chemical Co., Ltd., with a specification of 100 mL; the manufacturer of asiaticoside is Shaanxi Hexiankang Biotechnology Co., Ltd., with a specification of 10 g (90%); the manufacturer of dipotassium glycyrrhizate is Wuhan Lanabai Pharmaceutical Chemical Co., Ltd., with a specification of 20 g.

[0054] Example 1

[0055] A composition with anti-inflammatory and skin barrier damage repairing effects consists of 0.25g of matrine, 0.25g of dipotassium glycyrrhizate, 0.25g of bisabolol and 0.25g of asiaticoside.

[0056] Example 2

[0057] A composition with anti-inflammatory and skin barrier damage repairing effects consists of 0.5g of matrine, 0.5g of dipotassium glycyrrhizate, 0.5g of bisabolol and 0.5g of asiaticoside.

[0058] Example 3

[0059] A cream with anti-inflammatory and skin barrier damage repairing effects (also known as a sensitive skin cream), composed of 1g of active ingredient and 99g of excipients, wherein the active ingredient is the composition of Example 1 (that is, the active ingredient is composed of 0.25g of matrine, 0.25g of dipotassium glycyrrhizate, 0.25g of bisabolol and 0.25g of asiaticoside), and the excipient is composed of 10g of polyethylene glycol, 3g of hexadecanol, 8g of medium-chain triglycerides, 2g of mono- and distearic acid glyceryl, 0.1g of ethyl hydroxybenzoate, 60.9g of pure water and 15g of diethylene glycol monoethyl ether.

[0060] The preparation method is:

[0061] Polyethylene glycol, hexadecanol, medium-chain triglycerides, mono- and distearic glyceryl, and ethylparaben were mixed as component A; purified water was used as component B; diethylene glycol monoethyl ether and the active ingredient were mixed and ultrasonicated for 5 minutes to fully dissolve the mixture to obtain mixture 2.

[0062] Components A and B were heated to 85° C. respectively, mixed thoroughly with stirring, and homogenized for 3 minutes to obtain mixture 1; when mixture 1 dropped to 55° C., mixture 2 was added and homogenized for another 3 minutes to obtain a cream.

[0063] Example 4

[0064] A cream with anti-inflammatory and skin barrier damage repairing effects (also known as a sensitive skin cream), composed of 2g of active ingredients and 98g of excipients, wherein the active ingredient is the composition of Example 2 (that is, the active ingredient is composed of 0.5g of matrine, 0.5g of dipotassium glycyrrhizate, 0.5g of bisabolol and 0.5g of asiaticoside), and the excipient is composed of 10g of polyethylene glycol, 3g of hexadecanol, 8g of medium-chain triglycerides, 2g of mono- and distearic acid glyceryl, 0.1g of ethyl hydroxybenzoate, 59.9g of pure water and 15g of diethylene glycol monoethyl ether.

[0065] The preparation method is the same as Example 3.

[0066] Example 5

[0067] HaCaT cell assay

[0068] HaCaT cells were cultured in DMEM supplemented with 10% FBS in a 37°C incubator. The medium was changed every 24 hours. Cells were passaged when 70% to 80% of the cells were confluent, maintaining logarithmic growth. Cells were used in experiments after reaching passage 3 and stabilizing.

[0069] 1. Effect of the composition of the present invention on the normal growth of HaCaT cells

[0070] HaCaT cells were cultured at a rate of 1 × 10 4 / well was inoculated into a 96-well plate and cultured in an incubator. When the cell density was approximately 80%, different concentrations (0 μg / mL, 2.5 μg / mL, 5 μg / mL, 10 μg / mL, 25 μg / mL) of the composition were added and incubated for 24 hours. Taking the addition of 2.5 μg / mL of the composition as an example, the preparation method was to add matrine with a final concentration of 2.5 μg / mL, dipotassium glycyrrhizate with a final concentration of 2.5 μg / mL, bisabolol with a final concentration of 2.5 μg / mL, and asiaticoside with a final concentration of 2.5 μg / mL to the DMEM medium. Similarly, the addition of 5 μg / mL of the composition refers to the addition of matrine with a final concentration of 5 μg / mL, dipotassium glycyrrhizate with a final concentration of 5 μg / mL, bisabolol with a final concentration of 5 μg / mL, and asiaticoside with a final concentration of 5 μg / mL to the DMEM medium. Dilute CCK8 with culture medium at a ratio of 1:9. Remove the liquid from the 96-well plate and add 100 μL of the diluted CCK8 solution to each well. Incubate in the incubator for 30 minutes, then remove the plate and measure the absorbance of each well at 450 nm using a microplate reader.

[0071] Cell viability (%) = [OD 450 (Test hole)-OD 450 (PBS well)] / [OD 450 (Blank control

[0072] Hole)-OD 450 (PBS well)], the blank control well in this formula refers to cells cultured with normal culture medium without the composition; the PBS well refers to cells cultured with PBS; and the test well refers to cells cultured with normal culture medium and the composition.

[0073] The results are as follows Figure 1 As shown, the composition of the present invention had no proliferative effect on normal HaCaT cells at 0-25 μg / mL. 25 μg / mL inhibited HaCaT proliferation (P<0.05), suggesting that the concentration used in subsequent cell experiments should be lower than 25 μg / mL.

[0074] 2. Effect of the composition of the present invention on the expression of barrier-related genes in HaCaT cells

[0075] 300,000 HaCaT cells were seeded into 6-well plates per well, and after culturing for 24 h, medium (control group, Control) or medium containing different concentrations of the composition was added. The medium containing different concentrations of the composition was a medium containing 2.5 μg / mL of the composition (denoted as MJ2.5 group) and a medium containing 5 μg / mL of the composition (denoted as MJ5 group). The medium containing 2.5 μg / mL of the composition refers to the medium in which matrine with a final concentration of 2.5 μg / mL and 2.5 μg / mL of Dipotassium glycyrrhizate, bisabolol at a final concentration of 2.5 μg / mL, and asiaticoside at a final concentration of 2.5 μg / mL. A culture medium containing a 5 μg / mL composition refers to a culture medium supplemented with matrine at a final concentration of 5 μg / mL, dipotassium glycyrrhizate at a final concentration of 5 μg / mL, bisabolol at a final concentration of 5 μg / mL, and asiaticoside at a final concentration of 5 μg / mL. The culture medium was incubated for 24 hours, and total RNA from HaCaT cells was extracted and reverse transcribed according to the kit instructions to detect the gene human β-defensin 2 (HBD2). The primer sequences used for gene detection are shown in Table 1.

[0076] Table 1 Primer list

[0077] Primer Name Sequence (5' to 3') Human-GAPDH-S GGAGCGAGATCCCTCCAAAAT(SEQ ID NO.1) Human-GAPDH-A GGCTGTTGTCATACTTCTCATGG(SEQ ID NO.2) Human-HBD2-S GCGATCCTGTTACCTGCCTTAAGAG(SEQ ID NO.3) Human-HBD2-A AGCATTTTGTTCCAGGGAGACCAC(SEQ ID NO.4)

[0078] The results showed that only HBD2 showed positive results, such as Figure 2 The results showed that 5 μg / mL of the composition of the present invention could significantly promote the expression of HBD2 mRNA (P<0.001).

[0079] 3. Effect of the composition of the present invention on the secretion of inflammatory factors by HaCaT cells induced by TNF-α

[0080] 600,000 HaCaT cells were seeded in 6-well plates at a concentration of 10 μg / mL. After 24 h of culture, the blank group (Control) was replaced with fresh culture medium, the model group (Model) was replaced with culture medium containing 10 ng / mL TNF-α, and the drug-treated group was replaced with culture medium containing the specified concentration sample (MJ10 or MJ25) + 10 ng / mL TNF-α. MJ10 refers to culture medium supplemented with a final concentration of 10 μg / mL matrine, a final concentration of 10 μg / mL dipotassium glycyrrhizate, a final concentration of 10 μg / mL bisabolol, and a final concentration of 10 μg / mL asiaticoside. MJ25 refers to culture medium supplemented with a final concentration of 25 μg / mL matrine, a final concentration of 25 μg / mL dipotassium glycyrrhizate, a final concentration of 25 μg / mL bisabolol, and a final concentration of 25 μg / mL asiaticoside. The cells were incubated for another 24 h. Total RNA from HaCaT cells was extracted and reverse transcription and amplification reactions were performed according to the kit instructions. The expression levels of inflammatory markers TNF-α and IL-1β were detected. The primer sequences used are shown in Table 2. The results are shown in Figure 3 and Figure 4 shown.

[0081] Table 2 Information of primers for inflammation indicators

[0082] Primer Name Sequence (5' to 3') Homosapiens TNF-α-F GGGATCAGCTCCGTGGATCT(SEQ ID NO.5) Homosapiens TNF-α-R TGCACTTTGGTACTCTTGAAGTT(SEQ ID NO.6) Homosapiens IL-1β-F ATGATGGCTTATTACAGTGGCAA(SEQ ID NO.7) Homosapiens IL-1β-R GTCGGAGATTCGTAGCTGGA(SEQ ID NO.8)

[0083] Depend on Figure 3 It can be seen that the composition of the present invention can inhibit the expression of TNF-α mRNA in the HaCaT cell inflammation model, and the inhibitory effect is dose-related within the concentration range of 10 to 25 μg / mL.

[0084] Depend on Figure 4 It can be seen that the composition of the present invention has a tendency to inhibit the expression of IL-1β mRNA in the HaCaT cell inflammation model, wherein 25 μg / mL has a significant difference (P<0.05).

[0085] Example 6

[0086] 1. Construction of a mouse model with impaired mechanical barrier

[0087] Twenty-five 20-22g BALB / c mice (SPF grade) were randomly divided into five groups: a blank group, a model group, a blank matrix group (the blank matrix differs from Example 3 in that it does not contain the active ingredient; otherwise, it is the same as Example 3 and is labeled KBJZ or CV), a high-dose group (applied with the cream obtained in Example 4, containing 2% active ingredient, designated as the Sensitive 2% group or Sensitive Muscle 2% group), and a low-dose group (applied with the cream obtained in Example 3, containing 1% active ingredient, designated as the Sensitive 1% group or Sensitive Muscle 1% group), with five mice in each group. The mice's backs were shaved and hair removed. Except for the blank group, all other groups had medical tape applied to the shaved back skin of the mice and then quickly removed. Each mouse underwent two modeling stimulations daily, with the "tape application-tear-off" process repeated five times each time. The interval between the two modeling stimulations was 8 hours, and the modeling process continued for 3 consecutive days. Administration: Administration was administered while the modeling was in progress. The blank matrix group was treated with a blank matrix cream, while the high-dose and low-dose groups were given the corresponding creams, gently massaged until absorbed, for 5 consecutive days, twice daily. Samples were collected 24 hours after the last administration for subsequent experiments.

[0088] During the modeling process, as the number of modeling increases, the backs of mice in all groups except the blank group show symptoms such as redness, thickening, and even bleeding and scabs, indicating that the modeling is successful. Figure 5 As shown, the model group still showed significant epidermal damage compared to the blank group, while the back skin of the mice treated with 2% Sensitive showed significant repair compared to the model group. This was determined by the fact that three out of four mice in the model group had blood-red scabs, while only one of the mice treated with 2% Sensitive had a significant blood-red scab. Compared to the blank matrix group, the epidermal repair of the mice treated with 2% Sensitive was more pronounced, suggesting that the active ingredient, rather than the blank matrix, was responsible. Compared to the 2% Sensitive matrix group, the 2% (composition obtained in Example 4) showed more pronounced barrier repair.

[0089] Observation using dermatoscope Figure 5 The results of the mouse epidermis shown in Figure 6 As shown, compared with the blank group, the model group showed significant epidermal damage and even bleeding symptoms after tape stripping. The blank matrix, 1% Minute, and 2% Minute groups all showed a repair effect on the epidermal barrier, with significant improvement in bleeding. Compared with the blank matrix group, the 1% Minute group showed more significant epidermal recovery, suggesting that the barrier repair effect also comes from the active ingredients of the Minute Skin. Compared with the 1% Minute group, the 2% Minute group showed better epidermal repair, suggesting that the barrier repair function of the Minute Skin ingredients is dose-dependent.

[0090] The weight of mice in each group was weighed and recorded. Figure 7As shown in the data, modeling will cause the mice to lose weight, while applying blank matrix, sensitive muscle 1% cream, and sensitive muscle 2% cream can restore the mice's weight; compared with the blank matrix group, there was no significant difference in weight change in the sensitive muscle 1% group, while there was a significant difference in the sensitive muscle 2% group, and the recovery of the sensitive muscle 2% group was closer to that of the blank group.

[0091] 2. Effect of Sensitive Skin Cream on Transepidermal Water Loss in Mice with Mechanical Barrier Damage

[0092] 24 hours after the last dose, a skin tester was used to measure the transepidermal water loss (TEWL) of the mouse back skin. TEWL, also known as transepidermal water loss, represents the loss of water from the deep dermis through evaporation from the epidermis. It is an important parameter for describing the skin barrier and is closely related to the water content of the skin's stratum corneum. The higher the TEWL value, the more water is lost through the skin and the poorer the barrier function of the stratum corneum. Testing environment: room temperature 20-25°C, relative humidity 50%-60%. During the test, the instrument was in full contact with the skin of the test area and kept as vertical as possible. The same test area was measured multiple times and the average value was taken.

[0093] The results are as follows Figure 8 As shown in the results, the TEWL values ​​of the model group mice increased compared with the blank group, and there was a statistically significant difference. Compared with the model group, the TEWL value of the blank matrix group did not show a significant difference; the TEWL value of the mice in the 2% sensitization group was significantly improved compared with the model group (P < 0.05), indicating that the cream of the present invention has the function of promoting the repair of the skin stratum corneum barrier, and the difference was significant when the active ingredient concentration in the cream was 2%.

[0094] 3. Effect of Sensitive Skin Cream on Skin Pathology and Epidermal Thickness in Mice with Mechanical Barrier Damage

[0095] The skin tissue from the back of the mouse in step 1 was fixed in 4% paraformaldehyde, dehydrated, embedded, and sliced ​​for HE staining. Figure 9 As shown in the results, compared with the blank group, the model group showed significant thickening of the stratum corneum, accompanied by dense hyperkeratosis, significant epidermal hyperplasia, acanthosis, widening and elongation of epidermal processes, and inflammatory cell infiltration in the dermis. The blank matrix group, the 1% sensitivity group, and the 2% sensitivity group all showed improvement in these pathological changes.

[0096] Using an Eclipse Ci-L camera microscope, one field of view was randomly selected from each slice, and the epidermal thickness was measured 10 times in each field of view to calculate the average value. The epidermal thickness was measured and quantified using software. The results are as follows Figure 10As shown, the blank group had an epidermal thickness of 20.72±4.34μm. Tape stripping was used to disrupt the epidermal barrier of the mouse back skin, and the model group had an epidermal thickness of 193.95±84.26μm, indicating that the epidermal thickness of the model group increased significantly after modeling (P<0.001). Compared with the model group, application of the blank matrix (KBJZ) (206.68±49.61μm) did not improve epidermal thickness. However, the epidermal thickness of mice treated with the 1% Min cream (133.57±35.02μm) and the 2% Min cream (76.86±23.08μm) both significantly decreased (P<0.001). Furthermore, compared with the 1% Min cream, the 2% Min cream significantly reduced epidermal thickness (P<0.001), suggesting a dose-dependent effect.

[0097] 4. Determination of ceramide content in the skin of mice with mechanically damaged skin after treatment with Sensitive Skin Cream

[0098] Prepare homogenates from the dorsal skin of each group in step 1. Follow the ELISA kit instructions to measure the ceramide content in the damaged skin tissue of each group of mice. Ceramide is a major component of human stratum corneum lipids, and its synthesis and distribution in the skin follow specific patterns. Changes in its quality and quantity can alter lipid structure, thereby affecting skin barrier function.

[0099] The results are as follows Figure 11 As shown, compared with the blank group, the epidermal barrier of the mouse back skin was damaged by tape stripping. At this time, a significant increase in ceramide was observed in the model group (P < 0.001). This phenomenon may be related to the skin's repair mechanism and stress response. However, the ceramide content of mice treated with blank matrix, 1% sensitive cream, and 2% sensitive cream all decreased significantly (P < 0.05 or P < 0.001), suggesting that the cream of the present invention protects the epidermal barrier to a certain extent, allowing the skin to slow down the synthesis of ceramide. The ceramide content in the blank matrix group was 150.21 ± 4.80 pg / mL, the ceramide content in the 1% sensitive cream group was 95.38 ± 2.33 pg / mL, and the ceramide content in the 2% sensitive cream group was 111.60 ± 5.05 pg / mL. Compared with the blank matrix group, the active ingredients in the cream had a significant difference in reducing ceramide expression (P < 0.001).

[0100] Example 7

[0101] Construction of atopic dermatitis-like mouse model and related detection indicators

[0102] Twenty-five 7- to 8-week-old female BALB / c mice were randomly divided into five groups: a blank group (Control), a model group (Model), a blank matrix group (KBJZ group, or CV group; the blank matrix differs from Example 3 in that it does not contain the active ingredient, and all other components are the same as Example 3), a high-dose group (applied with the cream obtained in Example 4, containing 2% active ingredient, designated as the Sensitive Muscle 2% group or MJ 2% group), and a low-dose group (applied with the cream obtained in Example 3, containing 1% active ingredient, designated as the Sensitive Muscle 1% group or MJ 1% group), with five mice in each group. Modeling method: Calcipotriol (MC903), a vitamin D3 analog, was applied to the mouse ears daily for 10 days to induce modeling. The modeling dose was 2 nmol calcipotriol (20 μL) per ear. Modeling was performed between May 8th and May 17th, for a total of 10 sessions. Administration: Administration was administered twice daily, morning and evening. Administration was administered between May 8th and May 18th. Record: EASI scores were performed on days 0, 4, 7, 10, and 12, and body weight was recorded. The thickness of the right ear was recorded with a vernier caliper. Each mouse was photographed after the last administration. The right ear tissue was taken for HE staining (epidermal thickness), and PCR was used to detect the expression of AD-related inflammatory factors IL-31, IL-13, IL-4, and Filaggrin in the mouse ear skin. The primer sequences are shown in Table 3. In addition, toluidine blue was used to detect the effect of the cream of the present invention on mast cell activation in the ear skin of atopic dermatitis-like model mice, and immunohistochemistry was used to detect the effect of the cream of the present invention on involucrin protein in the ear skin of atopic dermatitis-like model mice. Three fields of view were selected for each slice, and the pictures under each field of view were quantitatively analyzed using Image J software.

[0103] EASI scoring requirements: The severity of mouse ear skin inflammation was scored according to the Eczema Area and Severity Index (EASI) scoring criteria, which includes erythema, edema or exudation, and scaling. The scores indicating severity are: 0 (none), 1 (mild), 2 (moderate), 3 (moderate to severe), and 4 (severe).

[0104] Table 3 Primer information

[0105]

[0106] The results of the effect of the cream of the present invention on the ear skin of atopic dermatitis-like model mice are as follows: Figure 12As shown, compared with the blank group, the model group showed significant redness, swelling, scaling, and even blood crusts, and the skin texture changed from soft to stiff. Compared with the model group, the blank matrix group, Sensitive Skin 1%, and Sensitive Skin 2% groups showed a reduction in symptoms, including significant relief of redness, swelling, and scaling, and no blood crusts. Compared with the blank matrix group, the Sensitive Skin 1% and Sensitive Skin 2% groups showed more significant improvement in these symptoms, with ears noticeably thinner upon touch. Sensitive Skin 2% was even more effective than Sensitive Skin 1%, demonstrating a greater efficacy in alleviating ear redness and swelling in mice.

[0107] The results of the effect of the cream of the present invention on the body weight of atopic dermatitis-like model mice are as follows: Figure 13 As shown in the figure, with the increase in the number of calcipotriol modeling, the weight of the mice continued to decrease. When the modeling was stopped on day 11, the weight of the mice recovered. Compared with the model group, the blank matrix group and the two cream-administered groups did not significantly improve the weight of the mice.

[0108] Effect of the cream of the present invention on the EASI score of the ear skin of atopic dermatitis-like model mice Figure 14 As shown, compared with the blank group, the total EASI score in the model group continued to improve with increasing modeling frequency, with a significant difference in EASI on the fourth day (P < 0.001). During modeling, the mouse ears became red and swollen. With increasing modeling frequency, desquamation and even blood scabs gradually appeared. Compared with the model group, blank matrix, sensitive muscle 1%, and sensitive muscle 2% all significantly reduced EASI scores (P < 0.05, P < 0.001), and no blood scabs appeared in the sensitive muscle group. Compared with the blank matrix group, sensitive muscle 1% and sensitive muscle 2% significantly reduced the redness, swelling, thickening, and desquamation of mouse ear tissue, and significantly reduced EASI (P < 0.001).

[0109] The results of histopathological examination (HE staining) were as follows Figure 15 The results demonstrate that calcipotriol successfully induced an atopic dermatitis-like model. The main pathological changes were marked epidermal hyperplasia, thickening of the spinous cell layer, and thickening of the stratum corneum with parakeratosis. There was also significant intercellular edema (spongioma) and elongated spikes in some areas. Dense inflammatory cell infiltration was observed in the dermis. Application of blank matrix, 1% sensitive skin, and 2% sensitive skin all improved these pathological changes to some extent.

[0110] The thickness of the epidermis was measured and quantified by software. Figure 16As shown, the ear epidermal thickness of the blank group was 16.63±3.30μm. After calcipotriol induction, the epidermal thickness of the model group was 94.57±34.29μm, indicating that the epidermal thickness of the model group increased significantly after modeling (P<0.001). Compared with the model group, the epidermal thickness of mice treated with blank matrix (55.88±13.18μm), 1% Min Muscle Cream (49.81±14.51μm), and 2% Min Muscle Cream (32.89±8.65μm) all decreased significantly (P<0.001). Compared with the blank matrix group, 2% Min Muscle Cream significantly reduced epidermal thickness (P<0.001).

[0111] Effect of the cream of the present invention on the expression of inflammatory factors in the ear skin of atopic dermatitis-like model mice Figures 17 to 20 shown.

[0112] Depend on Figure 17 It can be seen that compared with the blank group, the IL-4 mRNA level in the model group was significantly increased (P<0.001), and after applying the 2% cream for sensitive skin, the IL-4 mRNA level was significantly decreased (P<0.001).

[0113] Depend on Figure 18 It can be seen that compared with the blank group, the IL-13 mRNA level in the model group was significantly increased (P<0.05), and after applying the 2% cream for sensitive skin, the IL-13 mRNA level was significantly decreased (P<0.05).

[0114] Depend on Figure 19 As can be seen, compared with the blank group, the IL-31 mRNA level in the model group was significantly increased (P < 0.01). After application of the blank matrix cream, the sensitive muscle 1% cream, and the sensitive muscle 2% cream, the IL-31 mRNA level was significantly reduced (P < 0.01). Furthermore, compared with the blank matrix group, the sensitive muscle 1% cream and the sensitive muscle 2% cream also showed significant differences in reducing IL-31 mRNA expression (P < 0.05, P < 0.01).

[0115] Depend on Figure 20 It can be seen that compared with the blank group, the FLG mRNA level in the model group was significantly reduced (P<0.01). After application of the blank matrix cream, the sensitive muscle 1% cream, and the sensitive muscle 2% cream, the FLG mRNA level was significantly increased (P<0.001). In addition, compared with the blank matrix group, the sensitive muscle 1% cream and the sensitive muscle 2% cream also showed significant differences in increasing FLG mRNA expression (P<0.001).

[0116] From the above results, it can be seen that the cream of the present invention can significantly reduce the expression levels of IL-4, IL-13, and IL-31 mRNA related inflammatory factors in atopic dermatitis-like model mice, and increase FLG mRNA expression.

[0117] Mast cells are the core effector cells and regulatory cells in the pathogenesis of atopic dermatitis. They are activated through IgE-dependent and -independent pathways, releasing a large number of mediators with multiple biological activities. These mediators are not only the direct initiators of acute inflammatory reactions (erythema, edema, itching), but also the key driving factors for the maintenance of chronic inflammation, the generation of severe itching (especially through neuroimmune interactions), tissue remodeling, and the synergistic amplification of Th2 immune responses with other immune cells. The present invention detects the effect of Sensitive Skin Cream on mast cell activation by toluidine blue staining. The results are as follows: Figure 21 and Figure 22 As shown, compared with the blank group, the model group had a significant increase in mast cell infiltration (P < 0.001). Compared with the model group, the number of mast cells in the mouse ear skin tissue after application of Min Ji 1% cream and Min Ji 2% cream was significantly decreased (P < 0.05, P < 0.001), and this was dose-dependent. No significant difference was observed in the blank matrix group. This suggests that the cream of the present invention improves atopic dermatitis symptoms, which may be related to the inhibition of mast cell activation.

[0118] Involucrin is a key structural protein in the process of epidermal terminal differentiation and plays a central role in the pathogenesis of atopic dermatitis. Its role is mainly reflected in maintaining the integrity of the skin barrier, regulating immune response and affecting the severity of the disease. The present invention uses immunohistochemistry to investigate the improvement effect of the cream of the present invention on the Involucrin protein in the skin lesions of atopic dermatitis-like mice. The results are as follows Figure 23 As shown, induction with the vitamin D3 analog calcipotriol significantly decreased involucrin protein expression in mouse ear lesions. Application of the 1% and 2% creams to the sensitive skin significantly increased involucrin protein expression (P < 0.01, P < 0.001), while the blank substrate showed a trend toward increased involucrin protein expression but no significant difference. This suggests that the cream improves atopic dermatitis symptoms, possibly by increasing involucrin protein expression and thus strengthening barrier function.

[0119] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A composition having anti-inflammatory and skin barrier damage repairing effects, characterized in that: The invention comprises matrine, dipotassium glycyrrhizate, bisabolol and asiaticoside; the weight ratio of matrine, dipotassium glycyrrhizate, bisabolol and asiaticoside is 1:1:1:

1.

2. Use of the composition according to claim 1 in preparing skin barrier damage repair or anti-inflammatory products.

3. Use of the composition according to claim 1 in preparing a product for upregulating the expression of involucrin.

4. Use of the composition according to claim 1 in preparing a product for preventing and treating atopic dermatitis.

5. A cream with anti-inflammatory and skin barrier damage repairing effects, characterized in that: The cream comprises an active ingredient and excipients, wherein the active ingredient comprises the composition according to claim 1.

6. The cream according to claim 5, characterized in that The weight portion of the active ingredient in the cream is 1 to 2 parts, and the weight portion of the auxiliary material in the cream is 98 to 99 parts.

7. The cream according to claim 5, characterized in that The auxiliary materials include polyethylene glycol, cetyl alcohol, medium chain triglyceride, mono- and distearic acid glyceryl, ethyl hydroxybenzoate, diethylene glycol monoethyl ether and water.

8. The cream according to claim 7, characterized in that The weight parts of the raw materials in the auxiliary materials are: 10 parts of polyethylene glycol, 3 parts of hexadecanol, 8 parts of medium chain triglycerides, 2 parts of mono- and distearic glycerides, 0.1 parts of ethyl hydroxybenzoate, 15 parts of diethylene glycol monoethyl ether, and 59.9-60.9 parts of water.

9. The method for preparing the cream according to claim 8, characterized in that: The method comprises the following steps: mixing polyethylene glycol, hexadecanol, medium chain triglycerides, mono- and distearic glyceryl, ethyl hydroxybenzoate and water to obtain mixture 1; mixing diethylene glycol monoethyl ether and active ingredients to obtain mixture 2; and mixing mixture 1 and mixture 2 to obtain a cream.

10. The preparation method according to claim 9, characterized in that When mixture 1 was obtained, the mixing temperature was 85°C; when mixture 1 and mixture 2 were mixed, the mixing temperature was 55°C.

Images