Double-layer high-swelling hydrogel microneedle as well as preparation method and application thereof

Abstract

The invention provides a double-layer high-swelling hydrogel microneedle as well as a preparation method and application thereof, and belongs to the technical field of hydrogel microneedle materials. According to the invention, the N, N '-methylene bisacrylamide and polyethylene glycol dimethacrylate double cross-linking agents are utilized to improve the cross-linking efficiency and network uniformity of the gel and enhance the rigidity and toughness of the microneedle; the medicine Col is only loaded on the first layer of the needle tip, so that the microneedle does not cause inflammatory stimulation to the skin, and the utilization rate of the medicine on the needle tip is improved; a GO.Apt compound in the second-layer structure of the needle tip is used as a sensor, so that the microneedle can be used for uric acid marker sampling and specific detection; the carboxylated graphene oxide GO can be used as a quenching group of a sensor GO.Apt compound, and the mechanical property of the microneedle is enhanced; the covalent binding of the Apt. And the GO avoids the release of the Apt. And ensures the performance of the sensor; the microneedle provided by the invention has good morphology, can be effectively inserted into skin, and realizes release of drugs and extraction of skin interstitial fluid.

Description

Technical Field

[0001] The present invention relates to the technical field of hydrogel microneedle materials, and in particular to a double-layer high-swelling hydrogel microneedle and a preparation method and application thereof. Background Art

[0002] Gout is a disease caused by excessive deposition of uric acid. The incidence of gout is distributed worldwide and is affected by region, ethnicity and dietary habits. The basic cause and specific pathogenesis of gout are not yet very clear, but gout is closely related to hyperuricemia, and about 90% of patients are caused by uric acid excretion disorders. Studies have shown that the use of low-dose anti-inflammatory drugs for 3-6 consecutive months, such as 0.6 mg of colchicine per day, can effectively prevent gout attacks. It can also reduce the risk of attacks caused by a rapid drop in uric acid levels in the first few months of starting uric acid-lowering treatment. However, traditional drug delivery modes (oral and injection) have poor compliance, low drug utilization and lack of local targeting. They may cause adverse reactions such as rash and gastrointestinal reactions. Therefore, the challenge in treating gout is to achieve efficient, simplified and low-side effect drug delivery.

[0003] Furthermore, gout is prone to relapse. Long-term hyperuricemia is the underlying cause of relapses, while triggering factors (such as alcohol consumption, a high-purine diet, and exposure to cold) may directly trigger acute attacks. While gout relapses are generally difficult to predict, the likelihood of relapse is related to the severity of hyperuricemia. Studies have shown that in patients with a history of gout, baseline serum uric acid levels are associated with the risk of subsequent gout attacks and hospitalization rates for gout relapses. Therefore, effective long-term control of uric acid levels is central to the cure of gout. According to the American College of Rheumatology guidelines, serum uric acid levels should be below 360 μmol / L (6 mg / dL) for patients receiving uric acid-lowering therapy. Maintaining serum uric acid concentrations below this level for a long time can dissolve sodium urate crystals, inhibit recurrent gout attacks, and alleviate symptoms. However, compliance with uric acid-lowering therapy is poor, so regular monitoring of serum uric acid (SUA) levels can be used to adjust the uric acid-lowering therapy regimen. This has important implications for the prevention and management of gout. Interstitial fluid (ISF) is a bodily fluid found in the skin, containing a range of biomarkers relevant to clinical analysis. In recent years, microneedle extraction of ISF from the skin has garnered increasing attention in minimally invasive diagnostics and biosensors. However, microneedle-based methods for the specific detection of uric acid have not been reported. Summary of the Invention

[0004] The purpose of the present invention is to provide a double-layer high-swelling hydrogel microneedle and its preparation method and application. The double-layer high-swelling hydrogel microneedle provided by the present invention has excellent swelling ability, realizes painless and minimally invasive extraction of skin interstitial fluid, can be used for uric acid marker sampling and specific detection, and by coating the anti-inflammatory drug colchicine at the needle tip of the hydrogel microneedle, using the first layer of the hydrogel microneedle as a drug loading platform for the release of colchicine, it can be used to prevent and treat gout.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a double-layer high-swelling hydrogel microneedle, comprising a base layer and a microneedle body arranged in an array on the base layer; the microneedle body comprises a first needle tip layer and a second needle tip layer arranged in sequence from the tip to the bottom;

[0007] The material of the first layer of the needle tip is a polyacrylamide gel coated with colchicine; the material for preparing the second layer of the needle tip includes a GO.Apt complex and a polyacrylamide gel solution; the material of the base layer is a polyacrylamide gel;

[0008] The polyacrylamide gel is a double-crosslinked gel of MBA and polyethylene glycol dimethacrylate; the GO.Apt complex is prepared using carboxylated graphene oxide, EDC-HCl, NaCl, 4-morpholineethanesulfonic acid, and an amino-modified aptamer as raw materials;

[0009] The amino-modified aptamer is 5ˋCy3CTCTCGACGACATTACGGGACCTTGCTAAAGGTGGAATTATGTCG T3ˋNH2.

[0010] Preferably, the double-layer high-swelling hydrogel microneedles have a conical array structure; the height of the microneedles is 600-900 μm, the bottom diameter of the microneedles is 200-400 μm; and the center distance between adjacent microneedles is 600-900 μm.

[0011] Preferably, along a direction perpendicular to the base layer, a height ratio between the first needle tip layer and the second needle tip layer is 1:1.

[0012] Preferably, the mass fraction of colchicine in the microneedle body is 25% to 40%; the mass fraction of the GO.Apt complex in the second layer of the needle tip is 0.2% to 0.8%.

[0013] The present invention also provides a method for preparing the double-layer high-swelling hydrogel microneedle described in the above technical solution, comprising the following steps:

[0014] (1) Acrylamide, ammonium persulfate, N,N′-methylenebisacrylamide, methyl methacrylate, polyethylene glycol dimethacrylate, and deionized water are mixed and ultrasonically shaken to obtain a polyacrylamide gel solution, also known as a PAM gel solution;

[0015] Carboxylated graphene oxide, EDC-HCl, NaCl, 4-morpholineethanesulfonic acid, amino-modified aptamer and deionized water were mixed, stirred and post-treated in sequence to obtain a GO.Apt complex;

[0016] dispersing the GO.Apt complex in HEPES buffer to obtain a GO.Apt complex solution;

[0017] (2) pouring a portion of the PAM gel solution obtained in step (1) into the microneedle mold, vacuuming and removing bubbles, then sucking out excess PAM gel liquid so that the tip microcavity of the microneedle mold retains the PAM gel liquid, and then sequentially performing a first curing and drying process, and then dripping colchicine solution into the microneedle mold, and performing a drying-swelling process to form a first needle tip layer in the microneedle mold;

[0018] (3) After removing the supernatant from the GO.Apt complex solution obtained in step (1) by centrifugation, the supernatant was mixed with a portion of the PAM gel solution obtained in step (1) to obtain a PAMGA gel solution;

[0019] Pour the PAMGA gel solution onto the surface of the first needle tip layer formed in step (2), and perform vacuuming and second curing in sequence to form a second needle tip layer on the surface of the first needle tip layer;

[0020] (4) adding a PAM gel solution to the surface of the second layer of the needle tip formed in step (3), performing a third curing to form a base layer on the surface of the second layer of the needle tip, and demolding to obtain a double-layer high-swelling hydrogel microneedle.

[0021] Preferably, the first curing in step (2) is a curing treatment at 60-80° C. for 7-12 minutes.

[0022] Preferably, the concentration of the colchicine solution in step (2) is 3 to 7 mg / mL; and the amount of the colchicine solution added is 100 to 400 μL.

[0023] Preferably, the drying-swelling treatment in step (2) comprises alternately performing drying and dripping colchicine solution for swelling 3 to 4 times.

[0024] The drying temperature is 60-70° C., the drying time is 1-2.5 hours, and the swelling time is 3-5 hours.

[0025] Preferably, the second curing in step (3) is standing at room temperature for 1 to 3 hours.

[0026] The present invention also provides an application of the double-layer high-swelling hydrogel microneedle described in the above technical solution or the double-layer high-swelling hydrogel microneedle prepared by the preparation method in preparing a microneedle patch for detecting uric acid and / or delivering colchicine.

[0027] The present invention provides a double-layer high-swelling hydrogel microneedle (also known as Col-PAMGA-MN), which utilizes N,N'-methylenebisacrylamide and polyethylene glycol dimethacrylate as double cross-linking agents to improve the cross-linking efficiency and network uniformity of the gel, avoid the problem of uneven network structure caused by a single cross-linking agent during the cross-linking process, and further enhance the rigidity and toughness of Col-PAMGA-MN. The GO.Apt complex acts as a new cross-linking agent, further cross-linking with the polymer in the polyacrylamide gel to form a denser three-dimensional network, thereby improving toughness and mechanical properties. The first layer of the needle tip is coated with Col, which reduces the gel pore size and makes the structure denser. Since the drug Col is only loaded in the first layer of the needle tip, it will not irritate the surface skin. Col-PAMGA-MN will not cause inflammatory irritation to the skin. In addition, the drug Col is concentrated in the first layer of the needle tip of the microneedle tip, thereby improving the needle tip drug utilization rate of the double-layer high-swelling hydrogel microneedle, which is higher than that of conventional integrated microneedles, reducing drug waste, and improving the bioavailability of the drug and its therapeutic effect. A specific fluorescently labeled programmable DNA aptamer GO.Apt complex is integrated into the second layer structure of the needle tip as a sensor, so that the microneedle can be used for uric acid marker sampling and specific detection; carboxylated graphene oxide with excellent biocompatibility is used as a raw material to prepare the second layer of the needle tip. In addition to serving as a quenching group for the sensor GO.Apt complex, its high-strength layer provides physical support for the hydrogel, and serves as an anchor point to further enhance the mechanical properties of the double-layer high-swelling hydrogel microneedle; the covalent binding of Apt. to GO avoids the release of Apt by the Col-PAMGA-MN, thereby ensuring the performance of the sensor; the double-layer high-swelling hydrogel microneedle provided by the present invention has good morphology, high mechanical properties and high swelling properties, can be effectively inserted into the skin, achieve drug release and extract skin interstitial fluid; Col-PAMGA-MN has a good inhibitory effect on the occurrence of inflammation, with an effect similar to igCol, can replace oral administration of Col to a certain extent, and can improve the limitations brought by oral administration of Col, and is used for the prevention and treatment of acute gout attacks. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The following is a schematic diagram of the preparation process of Col-PAMGA-MN prepared in Example 1 of the present invention and scanning electron microscope images at different angles, wherein: Figure 1A is a schematic diagram of the preparation process, Figure 1 Middle B is a scanning electron microscope image;

[0029] Figure 2 This is a characterization diagram of Col-PAMGA-MN prepared in Example 1 of the present invention, wherein: Figure 2 Center A is an optical image, scale bar: 2 mm; Figure 2 Middle B is the fluorescence image of Col-PAMGA-MN, scale bar: 100 μm; Figure 2 Middle C is the fluorescence confocal image of Col-PAMGA-MN, scale bar 100 μm;

[0030] Figure 3 Characterization diagram of the mechanical properties of the microneedles of PAM-MN, PAMGA-MN and Col-PAMGA-MN prepared in Example 1;

[0031] Figure 4 This is a linear curve diagram of Col-PAMGA-MN prepared in Example 1 of the present invention in vitro;

[0032] Figure 5 This is a comparison chart showing the results of using Col-PAMGA-MN prepared in Example 1 of the present invention for uric acid detection in rats and measuring serum UA content using a uric acid kit;

[0033] Figure 6 This is a graph showing the in vitro drug release efficiency of colchicine by Col-PAMGA-MN prepared in Example 1 of the present invention, wherein: Figure 6 A in the middle is the linear standard curve of colchicine absorbance intensity at 350 nm; Figure 6 B in the middle is the cumulative release efficiency of colchicine in Col-PAMGA-MN;

[0034] Figure 7 This is a graph showing the results of the inflammation inhibition effect of Col-PAMGA-MN prepared in Example 1 of the present invention, wherein: Figure 7 Middle A is the optical image of the knee joints of rats in different groups, scale bar: 1 cm; Figure 7 Middle B shows the changes in rat knee joint diameter before and after MSU crystal injection; Figure 7 Middle C shows the changes in knee joint diameter before and after MSU crystal injection in rats in the model group; Figure 7 Middle D is the comparison of knee joint diameters 24 hours after MSU crystal injection in different groups;

[0035] Figure 8 The results of the detection of inflammatory factor levels in rats of different groups 24 hours after injection of MSU crystals in the present invention are shown in FIG. Figure 8 A in the middle is IL-1β; Figure 8 B in the middle is TNF-α; Figure 8C in the middle is IL-6. DETAILED DESCRIPTION

[0036] The present invention provides a double-layer high-swelling hydrogel microneedle, comprising a base layer and a microneedle body arranged in an array on the base layer; the microneedle body comprises a first needle tip layer and a second needle tip layer arranged in sequence from the tip to the bottom;

[0037] The material of the first layer of the needle tip is a polyacrylamide gel coated with colchicine; the material for preparing the second layer of the needle tip includes a GO.Apt complex and a polyacrylamide gel solution; the material of the base layer is a polyacrylamide gel;

[0038] The polyacrylamide gel is a gel of N,N'-methylenebisacrylamide (MBA) and polyethylene glycol dimethacrylate; the GO.Apt complex is prepared using carboxylated graphene oxide, EDC-HCl, NaCl, 4-morpholineethanesulfonic acid, and an amino-modified aptamer as raw materials;

[0039] The amino-modified aptamer is 5ˋCy3CTCTCGACGACATTACGGGACCTTGCTAAAGGTGGAATTATGTCGT3ˋNH2.

[0040] In the present invention, unless otherwise specified, the raw materials used are conventional commercial products in the field.

[0041] In the present invention, the double-layer high-swelling hydrogel microneedles preferably have a conical array structure; the height of the microneedles is preferably 600-900 μm, the bottom diameter of the microneedles is preferably 200-400 μm; and the center distance between adjacent microneedles is preferably 600-900 μm.

[0042] In the present invention, along the direction perpendicular to the base layer, the height ratio of the first needle tip layer to the second needle tip layer is preferably 1:1.

[0043] In the present invention, the mass fraction of colchicine in the microneedle body is preferably 25% to 40%; the mass fraction of the GO.Apt complex in the second layer of the needle tip is 0.2% to 0.8%.

[0044] The present invention also provides a method for preparing the double-layer high-swelling hydrogel microneedle described in the above technical solution, comprising the following steps:

[0045] (1) Acrylamide AM, ammonium persulfate APS, N,N′-methylenebisacrylamide MBA, methyl methacrylate MMA, polyethylene glycol dimethacrylate PEGDMA and deionized water are mixed and ultrasonically shaken to obtain a polyacrylamide gel solution, also known as PAM gel solution;

[0046] Carboxylated graphene oxide, EDC-HCl, NaCl, 4-morpholineethanesulfonic acid, amino-modified aptamer and deionized water were mixed, stirred and post-treated in sequence to obtain a GO.Apt complex;

[0047] dispersing the GO.Apt complex in HEPES buffer to obtain a GO.Apt complex solution;

[0048] (2) pouring a portion of the PAM gel solution obtained in step (1) into the microneedle mold, vacuuming and removing bubbles, then sucking out excess PAM gel liquid so that the tip microcavity of the microneedle mold retains the PAM gel liquid, and then sequentially performing a first curing and drying process, and then dripping colchicine solution into the microneedle mold, and performing a drying-swelling process to form a first needle tip layer in the microneedle mold;

[0049] (3) After removing the supernatant from the GO.Apt complex solution obtained in step (1) by centrifugation, the supernatant was mixed with a portion of the PAM gel solution obtained in step (1) to obtain a PAMGA gel solution;

[0050] Pour the PAMGA gel solution onto the surface of the first needle tip layer formed in step (2), and perform vacuuming and second curing in sequence to form a second needle tip layer on the surface of the first needle tip layer;

[0051] (4) adding a PAM gel solution to the surface of the second layer of the needle tip formed in step (3), performing a third curing to form a base layer on the surface of the second layer of the needle tip, and demolding to obtain a double-layer high-swelling hydrogel microneedle.

[0052] The invention mixes acrylamide, ammonium persulfate, N,N'-methylenebisacrylamide, methyl methacrylate, polyethylene glycol dimethacrylate and deionized water, and then subjecting the mixture to ultrasonic vibration to obtain a polyacrylamide gel solution, also known as a PAM gel solution.

[0053] In the present invention, the mass ratio of acrylamide, ammonium persulfate, N,N′-methylenebisacrylamide, methyl methacrylate and polyethylene glycol dimethacrylate is preferably 2000:80:4:940:9. The present invention controls the usage ratio of each raw material within the above range to balance swelling and strength and avoid network defects. In the present invention, the time of the ultrasonic oscillation is preferably 3 to 10 minutes, more preferably 4 to 7 minutes; the power of the ultrasonic oscillation is preferably 40 to 100 W, more preferably 40 to 60 W. The present invention ensures that the materials are fully mixed and uniform by ultrasonic oscillation to avoid excessive condensation reaction resulting in unstable colloidal properties.

[0054] In the present invention, the PAM gel solution is preferably stored at 4°C.

[0055] The present invention mixes carboxylated graphene oxide, EDC-HCl, NaCl, 4-morpholineethanesulfonic acid (MES, pH=6), an amino-modified aptamer and deionized water, and sequentially stirs and post-treats to obtain a GO.Apt complex.

[0056] In the present invention, the stirring is preferably at 70-120 rpm at room temperature and magnetic stirring for 2-5 hours. The present invention uses stirring to fully covalently bind GO and Apt, ensuring that Apt is stably fixed on GO to ensure the stability of sensor performance. In the present invention, the post-treatment includes: subjecting the stirred product to a first centrifugation, a DEPC water wash, a first isopropanol wash, dispersion in a Tris solution, a second isopropanol wash, elution with a Tris solution, and a second centrifugation to obtain a GO.Apt complex.

[0057] In the present invention, the first centrifugation is preferably performed at 15,000 rpm for 15 to 40 minutes. In the present invention, the concentration of the Tris solution is preferably 5 mM; and the pH of the Tris solution is preferably 9.5.

[0058] After obtaining the GO.Apt complex, the present invention disperses the GO.Apt complex in a HEPES buffer to obtain a GO.Apt complex solution.

[0059] In the present invention, the HEPES buffer is preferably an aqueous solution containing 100 mM NaCl, 25 mM HEPES, and 1 mM MgCl2 at a pH of 7.6. In the present invention, the concentration of the GO.Apt complex in the GO.Apt complex solution is preferably 50 to 90 μg / mL, more preferably 60 to 85 μg / mL, and even more preferably 75 μg / mL.

[0060] After obtaining the PAM gel solution, the present invention pours a portion of the PAM gel solution into a microneedle mold, performs a vacuum-assisted bubble removal process, and then sucks out excess PAM gel liquid, allowing the PAM gel liquid to remain in the tip microcavity portion of the microneedle mold. The process then sequentially performs a first curing and drying process, and then drips a colchicine solution into the microneedle mold. The process then performs a drying-swelling process to form a first needle tip layer in the microneedle mold.

[0061] In the present invention, the microneedle mold is preferably a silicone mold; the center-to-center distance between adjacent microcavities of the microcavity array in the microneedle mold is preferably 1100-1700 μm; each microcavity is preferably conical; the bottom diameter of the microcavity is preferably 300-900 μm; and the height of the microcavity is preferably 1200-1800 μm.

[0062] In the present invention, the vacuuming-bubble removal treatment is preferably performed alternately by vacuuming for 5 minutes and then sucking away excess bubbles with a pipette, and the treatment is circulated 2 to 3 times.

[0063] In the present invention, the first curing is preferably performed at 60-80° C. for 7-12 minutes. In the present invention, the drying is preferably performed at room temperature using a solid desiccant to accelerate drying overnight.

[0064] In the present invention, the concentration of the colchicine solution is preferably 3 to 7 mg / mL; and the amount of the colchicine solution added is preferably 100 to 400 μL.

[0065] In the present invention, the drying-swelling treatment preferably includes alternately performing drying and dripping colchicine solution for swelling 3 to 4 times.

[0066] The drying temperature is 60-70° C., the drying time is 1-2.5 hours per time, and the swelling time is 3-5 hours per time.

[0067] Since the strong alkaline nature of the Col aqueous solution will destroy the covalent bonds in the original PAM polymer material, the Col coating cannot be completed in a one-step method. However, the present invention gradually swells the Col aqueous solution into the PAM polymer material. This method successfully encapsulates the Col into the PA gel, thereby enabling the microneedles to release colchicine during subsequent use to prevent gout attacks.

[0068] After the GO.Apt complex solution is obtained and formed, the present invention centrifuges the GO.Apt complex solution to remove the supernatant, and then mixes it with part of the PAM gel solution to obtain a PAMGA gel solution.

[0069] In the present invention, the centrifugation is preferably performed at 15000 rpm for 20 min. In the present invention, the volume ratio of the GO.Apt complex solution to the PAM gel solution is preferably 2:(60-90), more preferably 2:(65-85), and even more preferably 2:73.

[0070] After obtaining the PAMGA gel solution and forming the first needle tip layer, the present invention pours the PAMGA gel solution onto the surface of the first needle tip layer, performs vacuuming and second curing in sequence, and forms the second needle tip layer on the surface of the first needle tip layer.

[0071] In the present invention, the vacuuming time is preferably 3 to 8 minutes. In the present invention, the second curing is preferably standing at room temperature for 1 to 3 hours.

[0072] After forming the second layer of the needle tip, the present invention adds a PAM gel solution to the surface of the second layer of the needle tip, performs a third curing, forms a base layer on the surface of the second layer of the needle tip, and demolds to obtain a double-layer high-swelling hydrogel microneedle.

[0073] In the present invention, the third curing is preferably performed at 50-80° C. for 6-15 min. In the present invention, the double-layer high-swelling hydrogel microneedles are preferably dried with a desiccant at room temperature and then stored at 4° C. to ensure the proper activity of the amino-modified microneedles.

[0074] The present invention also provides an application of the double-layer high-swelling hydrogel microneedle described in the above technical solution or the double-layer high-swelling hydrogel microneedle prepared by the preparation method in preparing a microneedle patch for detecting uric acid and / or delivering colchicine.

[0075] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions of the present invention. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0076] Example 1

[0077] A double-layer high-swelling hydrogel microneedle comprises a base layer and a microneedle body arranged in an array on the base layer; the microneedle body comprises a first needle tip layer and a second needle tip layer arranged in sequence from the tip to the bottom;

[0078] The material of the first layer of the needle tip is a polyacrylamide gel coated with colchicine; the material for preparing the second layer of the needle tip includes a GO.Apt complex and a polyacrylamide gel solution; the material of the base layer is a polyacrylamide gel;

[0079] The polyacrylamide gel is a double-crosslinked gel of N,N′-methylenebisacrylamide and polyethylene glycol dimethacrylate; the GO.Apt complex is prepared using carboxylated graphene oxide, EDC-HCl, NaCl, 4-morpholineethanesulfonic acid, and an amino-modified aptamer as raw materials;

[0080] The amino-modified aptamer is 5`Cy3CTCTCGACGACATTACGGGACCTTGCTAAAGGTGGAATTATGTCG T3`NH2;

[0081] The double-layer high-swelling hydrogel microneedles have a 10×10 conical array structure; the height of the microneedles is 750 μm, the bottom diameter of the microneedles is 320 μm; the center spacing between adjacent microneedles is preferably 710 μm;

[0082] In the direction perpendicular to the basal layer, the height ratio of the first needle tip layer to the second needle tip layer is (1:1); the mass fraction of colchicine in the microneedle body is 33%; and the mass fraction of the GO.Apt complex in the second needle tip layer is 0.5%.

[0083] The preparation method of the above-mentioned double-layer high swelling hydrogel microneedle comprises the following steps:

[0084] (1) Dissolve 1 g acrylamide, 40 mg ammonium persulfate, and 2 mg N,N′-methylenebisacrylamide with 0.5 mL methyl methacrylate and 4 μL polyethylene glycol dimethacrylate in 3 mL deionized water. Mix by ultrasonic vibration for 5 min to obtain a PAM gel solution, which can be stored at 4°C for a long time.

[0085] The mass ratio of acrylamide, ammonium persulfate, N,N′-methylenebisacrylamide, methyl methacrylate and polyethylene glycol dimethacrylate is 2000:80:4:940:9;

[0086] 75 μg / mL carboxylated graphene oxide was mixed with freshly prepared 10 mM EDC-HCl, 25 mM NaCl, 25 mM MES (pH 6) and 2 μM amino-modified Apt in water. The mixture was magnetically stirred at 100 rpm at room temperature for 3 h to initially obtain a GO.Apt complex. The GO.Apt complex was then post-treated by a first centrifugation at 15,000 rpm for 20 min to purify the GO.Apt complex. The supernatant was removed and the sample was washed twice with DEPC water. To further remove non-bound DNA, the sample was washed with 80% isopropanol and then dispersed in 5 mM Tris solution at pH 9.5 and sonicated to disperse the non-covalent complex. Finally, after washing with 80% isopropanol, it was eluted in a 5 mM Tris solution at pH 9.5 at 75°C. After the final centrifugation, the GO.Apt complex was obtained.

[0087] The GO.Apt complex was dispersed in HEPES buffer (an aqueous solution containing 100 mM NaCl, 25 mM HEPES, and 1 mM MgCl2 at a pH of 7.6) to obtain a GO.Apt complex solution, which was stored in an environment of 4°C;

[0088] The concentration of the GO.Apt complex in the GO.Apt complex solution is 75 μg / mL;

[0089] (2) The microneedle mold is a silicone mold, the center spacing between adjacent microcavities in the microcavity array of the microneedle mold is 1450 μm, and each microcavity is conical with a bottom diameter of 650 μm and a height of 1500 μm;

[0090] Slowly pour a portion of the PAM gel solution prepared in step (1) into the microneedle mold, repeatedly vacuum for 5 minutes to fill the tip of the microneedle mold with liquid, and repeatedly remove bubbles during this process to ensure that the needle tip has a good morphology. After carefully sucking out excess liquid, only the microcavity of the mold retains liquid. After sealing the microneedle mold, place it in a constant temperature box at 70°C for the first curing for 10 minutes. Use a desiccant to accelerate drying at room temperature. Then, take 200 μL of 5 mg / mL Col solution and add it dropwise to the microneedle mold. Gently shake it, and repeatedly dry and swell it at room temperature for 4 hours. At this time, Col is loaded into the system during the swelling process to form the first layer of the needle tip in the microneedle mold.

[0091] (3) taking 3.5 mL of the GO.Apt complex solution obtained in step (1), centrifuging it at 15,000 rpm for 20 min to remove the supernatant, and then mixing it with 3.5 mL of the clarified PAM gel solution obtained in step (1) to obtain a PAMGA gel solution;

[0092] The prepared PAMGA gel solution is poured into the microneedle mold of step (2) to prepare the second layer surface of the needle tip, and the solution is repeatedly vacuumed for 5 minutes and allowed to stand at room temperature for 2 hours for the second curing, thereby forming the second layer of the needle tip on the surface of the first layer of the needle tip;

[0093] (4) adding a portion of the PAM gel solution obtained in step (1) to the surface of the second layer of the needle tip formed in step (3), performing a third curing at 70°C for 10 minutes to form a base layer, and demolding after the base layer is completely solidified to obtain Col-PAMGA-MN; to ensure the activity of the aptamer, the Col-PAMGA-MN is dried with a desiccant at room temperature and then stored at 4°C.

[0094] Comparative Example 1

[0095] The preparation method of PAM-MN comprises the following steps: pouring the PAM gel solution prepared in step (2) of Example 1 into a microneedle mold, heating at 70° C. for 10 minutes, and then demolding.

[0096] Comparative Example 2

[0097] The preparation method of PAMGA-MN comprises the following steps: pouring the PAMGA gel solution prepared in step (2) of Example 1 into a microneedle mold, repeatedly evacuating the mold for 5 minutes, standing at room temperature for 2 hours to solidify, and then demolding the mold.

[0098] Gold was sprayed on the surface of the Col-PAMGA-MN prepared in Example 1 for 30 seconds to form a conductive layer on the surface, and imaging was performed at different angles using a field emission scanning electron microscope. Figure 1The preparation process diagram of Col-PAMGA-MN prepared in Example 1 of the present invention and the scanning electron microscope images at different angles are shown. Figure 1 A is a schematic diagram of the preparation process, Figure 1 B is a scanning electron microscope image. Figure 1 As can be seen, the actual tip height of the Col-PAMGA-MN prepared in Example 1 of the present invention is approximately 750 μm, the base diameter is approximately 320 μm, and the center-to-center spacing between adjacent microneedles is approximately 710 μm. This indicates that the Col-PAMGA-MN has a considerable needle length to penetrate the stratum corneum without reaching the nerve endings in the dermis.

[0099] In order to achieve the visual characterization of Col-PAMGA-MN, fluorescence image simulation characterization was performed. The PAM gel solution was stained with rhodamine B and FITC-BSA dyes, respectively. The rhodamine B-PAM gel solution was used to simulate the first layer of the needle tip containing Col drug (red), and the FITC-PAM gel solution was used to simulate the second layer of the needle tip containing GO.Apt complex (green). The characterization diagram of Col-PAMGA-MN was obtained as shown in the figure below. Figure 2 As shown, Figure 2 A in the middle is the optical image; Figure 2 Middle B is the fluorescence image of Col-PAMGA-MN; Figure 2 Figure C is the fluorescence confocal image of Col-PAMGA-MN. Figure 2 It can be seen from the figure that double-layer microneedles were successfully synthesized in Example 1. Some needle tips in the fluorescence image showed side bending in the same direction, which was caused during the demolding process.

[0100] The present invention tested the swelling efficiency of PAM-MN, PAMGA-MN, and Col-PAMGA-MN in 1×PBS solution (pH 7.4). It was found that when the three patches were immersed in PBS solution for 5 minutes, a swelling rate of about 80% could be achieved, while the swelling rate of Col-PAMGA-MN could reach as high as 400% in 2 hours and still showed an increasing trend. This is attributed to the pore size of the hydrogel system allowing more water to quickly enter the interior of the hydrogel, significantly improving the initial water absorption rate and maximum water absorption capacity. This shows that the microneedle system has good swelling properties and provides a good platform for the extraction of interstitial fluid. Finally, in order to be closer to the effect of skin interstitial fluid extraction, the extraction effect of Col-PAMGA-MN in vivo was simulated by agarose, and it was found that the average extraction mass was as high as 0.65 mg per piece at the 15th minute.

[0101] The mechanical properties of PAM-MN, PAMGA-MN and Col-PAMGA-MN were characterized by compression tests: a sensor probe with a flat surface slowly compressed PAM-MN, PAMGA-MN and Col-PAMGA-MN fixed on a rigid substrate at a controlled speed of 0.5 mm / min, and the force on the probe was recorded in real time when the sensor was displaced. The mechanical properties characterization diagrams of the microneedles of PAM-MN, PAMGA-MN and Col-PAMGA-MN are shown in Figure 2. Figure 3 Studies have shown that the minimum force required to effectively penetrate the skin is 0.058 N. This shows that MN has the advantage of being strong enough to penetrate the skin.

[0102] from Figure 3 The test results show that the mechanical properties of PAMGA-MN are significantly improved after the addition of the GO.Apt complex. This is because the high-strength GO layer also provides physical support for the hydrogel. Furthermore, the GO.Apt complex acts as an "anchor point" to further crosslink the polymers in the hydrogel, forming a denser three-dimensional network and further enhancing its mechanical properties. Furthermore, during the hydrogel synthesis process, the present inventors found that PAMGA gels with the addition of the GO.Apt complex gelled more quickly than PAM alone and could form a gel at room temperature. This further demonstrates that the GO.Apt complex provides additional crosslinking points in the reaction system, accelerating the polymerization and crosslinking of the monomers. Since Col is an alkaline solution, it can disrupt the molecular bonds during the PAM gelation process, preventing gelation. This poses a challenge to the one-pot synthesis of Col-PAM. Therefore, the present inventors first synthesized the PAM gel and then incorporated a dose of Col into the PAM gel via swelling. The experimental results show that Col not only did not disrupt the PAM gelation process but actually enhanced its mechanical properties. This is because PAM hydrogels are formed through chemical crosslinking (such as free radical polymerization of acrylate monomers and amide bond crosslinking), and their three-dimensional network is composed of covalent bonds. These bonds have high energy (~200-400 kJ / mol) and are difficult to break in a colchicine solution environment (pH <13), thus maintaining the integrity of the network structure. Furthermore, colchicine can be physically embedded in the hydrogel pores, increasing the support strength of the hydrogel network and further improving its mechanical properties.

[0103] To evaluate the biocompatibility of Col-PAMGA-MN, its cytotoxicity against mouse embryonic fibroblasts (L929) was tested at the cellular level using the CCK-8 method, cell live-death staining, and apoptosis experiments. The cell viability of PAM-MN, PAMGA-MN, and Col-PAMGA-MN extracts was tested on days 1 and 3 of co-culture with L929 cells, and the cell viability of the blank group was also tested. The cytotoxicity of the microneedle group was reflected by comparing the cell viability of the blank group with that of the microneedle group. The experimental results showed that the cell growth rates of the microneedle group and the control group were basically the same, with no significant difference. This indicates that PAM-MN, PAMGA-MN, and Col-PAMGA-MN all have good biocompatibility. In addition, the live-death fluorescence staining results of the cells after co-culture met the biosafety standards, and the cell survival rate of the microneedle group was not statistically different from that of the control group. Subsequently, the present invention also used a cell apoptosis detection kit, and the experimental results showed that the microneedle group did not cause a significant increase in the apoptosis rate of fibroblasts.

[0104] 1. Research on the performance of uric acid detection

[0105] (1) In vitro detection of Col-PAMGA-MN: Agarose gel containing 0-1000 μM UA was prepared using UA buffer (120 mM NaCl, 1 mM aMgCl2, 20 mM Tris-HCl, 5 mM KCl, pH 7.4) and covered with plastic wrap. The Col-PAMGA-MN patch was applied to the simulated skin for 15 minutes, and then the patch was removed from the simulated skin and dried in a dark environment for 10 minutes. Fluorescence images were taken before and after the patch was inserted, and the corresponding fluorescence response of each patch was calculated by the normalization formula to calculate the standard curve, and the LOD was calculated to obtain the linear curve of Col-PAMGA-MN in vitro detection as shown in the figure. Figure 4 shown.

[0106] The physiological range of UA in healthy adults is 90-360 μM for females and 150-420 μM for males. Hyperuricemia is defined as a level above the upper limit of the range. Figure 4 It can be seen that the Col-PAMGA-MN prepared in Example 1 of the present invention has a good linear increasing relationship (R 2 =0.986), which can detect UA in the physiological and hyperuricemia ranges with a detection limit of 54 μM.

[0107] (2) In addition, the present invention also conducted a UA-aptamer specificity test by applying the Col-PAMGA-MN patch to a simulated skin loaded with nonspecific targets, with the following steps: using glucose buffer (147mM NaCl, 4mM KCl, 2.25mM CaCl2, pH 7.4); serotonin buffer (1×PBS, 2mM MgCl2, pH 7.4); insulin buffer (10mM NaCl, 25mM HEPES, 1mM MgCl2, pH 7.6); uricase buffer (0.2M borate buffer); urea buffer (0.9% saline); lactate buffer (1×PBS) according to the method outlined above to prepare agarose gel containing 500μM glucose, insulin, serotonin, urea, lactate, uricase and other biomarkers. Confocal fluorescence microscopy was used to image the fluorescence signal of Col-PAMGA-MN before insertion to determine its F0. Next, the Col-PAMGA-MN uric acid-specific microneedles were inserted into agarose containing nonspecific targets for testing, and the patches were imaged again (representing F). The fluorescence response of the microneedle patch was measured using a normalized calculation (F - F0 / F0). The specificity of the Col-PAMGA-MN assay was observed. The results showed that nonspecific targets such as glucose, insulin, serotonin, urea, lactate, and uricase did not produce a significant response, demonstrating the specificity of the Col-PAMGA-MN assay.

[0108] (3) Establishment of a rat model of hyperuricemia with acute gout: A hyperuricemia with gout model was established using 6-week-old male SD rats. 100 mg / mL potassium oxonate solution was orally administered to the rats' stomachs at a dose of 250 mg / kg. The control group was gavaged with an equal dose of normal saline at the same time for 14 consecutive days. After two weeks, blood samples were collected from the jugular vein and the rats' uric acid levels increased by 1.55 times, indicating that the above method can successfully establish a rat model of hyperuricemia with acute gout.

[0109] Six-week-old male SD rats were randomly divided into two groups, a control group and a model group, with 5 rats in each group. Rats were anesthetized by inhalation of isoflurane gas. For 14 consecutive days, the model group rats were gavaged with potassium oxonate solution (250 mg / kg), and the control group was gavaged with the same dose of normal saline. Subsequently, the Col-PAMGA-MN patch prepared in Example 1 was vertically applied to the abdomen of the blank group and the model group rats, and fixed with medical tape for 15 minutes before being pulled out. Dry for 10 minutes in a dark environment at room temperature. The fluorescence intensity F0 and F before and after patch insertion were recorded using a fluorescence microscope. The fluorescence response of the microneedle patch was calculated by normalization calculation (F-F0 / F0), and the corresponding uric acid concentration was calculated by a calibration curve. At the same time, blood was collected from the jugular vein into a 1.5 mL centrifuge tube. After the blood was processed as described above, the UA content of the serum was measured using a uric acid kit (purchased from Leigen Bio, China). A methodological comparison of the uric acid levels measured by the two methods was performed.

[0110] The measured UA levels were normalized using the fluorescence image of Col-PAMGA-MN before insertion as a reference. The fluorescence images clearly show that Col-PAMGA-MN has a good response in both normal and model rats. Furthermore, serum uric acid levels were simultaneously measured using a uric acid kit. A comparison of the results of Col-PAMGA-MN for uric acid detection in rats and the uric acid kit for measuring serum UA levels is shown in the figure below. Figure 5 As shown, from Figure 5 As can be seen in the Figure 3, serum uric acid levels followed the same trend as interstitial fluid uric acid levels, which further demonstrated the reliability of the Col-PAMGA-MN assay.

[0111] 2. Drug Release Performance

[0112] (1) Loading efficiency and drug release of Col-PAMGA-MN

[0113] Col-PAMGA-MN (1 mg Col) was placed in a 50 mL centrifuge tube and 40 mL of 1×PBS solution (pH 7.4) preheated to 37°C was added. It was then placed in a constant temperature shaker at 37°C, 30 rpm. At the cumulative time points of 0, 0.25, 0.5, 1, 2, 4, 6, 12, 24, and 48 h, 100 μL was taken out and placed in a 96-well plate, 100 μL of 1×PBS was added, and the plate was returned to the shaker for continued release. The absorbance of the solution in the 96-well plate was measured at a wavelength of 350 nm using an enzyme reader. Each group of samples was tested 5 times in parallel, and the average value was calculated as its absorbance. The standard solution was used to fit the standard curve, and the standard curve was used to calculate the content of Col in the solution to measure its cumulative release efficiency;

[0114] The in vitro drug release efficiency of Col-PAMGA-MN prepared in Example 1 was detected as shown in the figure below: Figure 6 As shown, Figure 6 A in the middle is the linear standard curve of colchicine absorbance intensity at 350 nm; Figure 6 B in the figure is the cumulative release efficiency of colchicine in Col-PAMGA-MN. Figure 6 It can be seen that Col in Col-PAMGA-MN achieved rapid drug release in the first two hours, reached an inflection point at the second hour, and reached equilibrium at the fourth hour, with a cumulative release of approximately 70%. This indicates that Col-PAMGA-MN has considerable drug release efficiency.

[0115] (2) Skin irritation of Col-PAMGA-MN

[0116] SD rats were anesthetized and placed in a supine position. PAM-MN and Col-PAMGA-MN were inserted into the depilated abdominal skin of the rats, fixed with tape for 4 hours, and then removed. The mice were euthanized within 24 hours, and samples were collected from the untreated skin and the skin where PAM-MN and Col-PAMGA-MN had been inserted, followed by hematoxylin and eosin (H&E) staining. The skin sections were observed to see if there was any distribution of inflammatory cells. H&E skin tissue sections showed no significant difference in histological appearance between the Col-PAMGA-MN group and the control group without the patch or the blank microneedle group, confirming that the Col-PAMGA-MN prepared in this study did not cause inflammatory irritation to the skin. This may be because Col is only loaded on the first layer of the needle tip and does not irritate the surface skin.

[0117] (3) Inhibitory effect of Col-PAMGA-MN on inflammation in rats with hyperuricemia and acute gout

[0118] Twelve rats were randomly divided into four groups: 1) blank group, 2) model group, 3) Col-PAMGA-MN group, and 4) Col tablet gavage group (igCol), with 3 rats in each group. Rats were anesthetized by inhalation of isoflurane gas. Except for the blank group, rats in all other groups were treated with the gout and hyperuricemia rat model as described above. First, Col-PAMGA-MN containing 1 mg of Col was applied to the area near the knee joint of each rat in the Col-PAMGA-MN group and secured with medical tape. Similarly, rats in the gavage group were gavaged with an aqueous Col solution (0.5 mg / kg, 1 mg / mL). 24 hours later, the anesthetized rats were injected with 200 μL of 20 mg / mL MSU crystals. Blood was collected from the jugular vein 24 hours later to measure inflammatory cytokine levels. The experimental animals were fasted for 24 hours before the injection of MSU crystals, with free access to water.

[0119] 1. Rat knee joint diameter

[0120] Before the experiment, the rats' knee joints were depilated and the knee joint measurement position was marked with a marker to unify the measurement standard. The diameter of the knee joint swelling of each rat was measured before and after the experiment using a vernier caliper. The degree of joint swelling was evaluated according to the formula, where V t and V0 represent the knee joint diameters before and after the experiment, respectively.

[0121] Joint swelling rate = (V t -V0) / V0×100%

[0122] 2. Levels of inflammatory factors such as IL-6, TNF-α, and IL-1β

[0123] This study further investigated the severity of acute gout in each group of rats at the molecular level. TNF-α and IL-1β levels increase during acute gout attacks because the deposition of MSU crystals triggers the production of these inflammatory factors by inflammatory cells, such as monocytes and macrophages. TNF-α promotes the expression of IL-1β and its precursor mRNA in diseased joints. Transmembrane TNF-α can also trigger MSU-induced acute gout attacks in mice. IL-1β plays a central role in MSU-induced acute gout attacks, promoting the release of chemokines and proinflammatory cytokines, which in turn positively amplifies inflammatory pathways and triggers an inflammatory cascade, the primary cause of acute gout attacks. The proinflammatory cytokine IL-6 is crucial for initiating the innate immune response. Therefore, IL-6, TNF-α, and IL-1β levels can, to some extent, represent the progression of acute gout in mice.

[0124] Blood was collected from rats using the jugular vein method. After standing at room temperature for 1 hour, the blood was centrifuged at 3500 rpm and 4°C for 10 minutes, and the supernatant serum was collected. Serum levels of IL-6, TNF-α, and IL-1β in mice were measured using ELISA kits according to the manufacturer's instructions. Serum samples were not diluted. The results of each group were statistically analyzed and compared, and the inhibition rates of IL-6, TNF-α, and IL-1β expression were calculated according to the following formula.

[0125]

[0126] The results of the inflammation inhibition effect of Col-PAMGA-MN were shown in the figure below. Figure 7 As shown, Figure 7 Middle A is the optical image of the knee joints of rats in different groups; Figure 7 Middle B shows the changes in rat knee joint diameter before and after MSU crystal injection; Figure 7 Middle C shows the changes in knee joint diameter before and after MSU crystal injection in rats in the model group; Figure 7Middle D is the comparison of knee joint diameters in different groups 24 hours after MSU crystal injection.

[0127] Depend on Figure 7 It can be seen that compared with the control group, the knee joints of rats in the untreated group showed significant swelling, reaching a peak at 24 hours and lasting for 72 hours. After 72 hours, the degree of knee joint swelling was not significantly different from that before MSU injection (p>0.05). This is similar to the swelling and self-limiting nature of acute gout attacks in humans. In addition, 24 hours after MSU injection, the degree of knee joint swelling in rats in the untreated model group was approximately 130% of that in the control group, with a highly significant difference (p<0.001). In addition, the knee joint diameters of the four groups of rats were measured using a vernier caliper, and it was found that there was no significant difference between the acute gout rats that underwent preventive treatment and the control group (p>0.05). This shows that Col-PAMGA-MN can inhibit knee joint swelling in acute gout model rats to a certain extent, similar to the effect of igCol.

[0128] Figure 8 The results of the detection of inflammatory factor levels in rats of different groups 24 hours after injection of MSU crystals in the present invention are shown in FIG. Figure 8 A in the middle is IL-1β; Figure 8 B in the middle is TNF-α; Figure 8 C in the middle is IL-6. Figure 8 Results showed that the order of serum IL-6, TNF-α, and IL-1β levels in rats was as follows: model group > Col-PAMGA-MN group > igCol-treated group > control group. After modeling, serum inflammatory cytokine levels in the blank and igCol-treated groups were significantly lower (p < 0.001) than those in the model group. There were no statistically significant differences in IL-6 and TNF-α levels between the blank and igCol-treated groups (p > 0.05), while IL-1β levels were statistically significant (p < 0.05). Furthermore, there were no significant differences in inflammatory cytokine expression between the Col-PAMGA-MN and igCol-treated groups (p > 0.05). The inhibition rates of IL-6, TNF-α, and IL-1β expression after Col-PAMGA-MN administration were 51.3%, 21.4%, and 18.6%, respectively. Intragastric administration (igCol) resulted in inhibition rates of 67.6%, 32%, and 21.3%, respectively. The lower therapeutic effect of the Col-PAMGA-MN group compared to the igCol group may be due to the inability of Col-PAMGA-MN to release sufficient Col within 4 hours in a real skin environment. However, transdermal administration of Col-PAMGA-MN via microneedles showed a certain inhibitory effect on inflammatory factors, similar to the results of the igCol treatment group.

[0129] In summary, the Col-PAMGA-MN prepared in Example 1 exhibits excellent mechanical properties and toughness, allowing it to penetrate the skin and recover to its initial state in approximately 20 minutes. Furthermore, its swelling rate reaches 400% within 2 hours, demonstrating its high swelling capacity and providing an excellent platform for drug delivery and extraction of interstitial fluid markers. Finally, it exhibits excellent biocompatibility at both the cellular and animal levels, ensuring its application in in vivo experiments. The higher results of the uric acid test kit compared to the Col-PAMGA-MN test may be due to the time lag and concentration differences between UA levels in interstitial fluid and blood. However, the detection trend of the Col-PAMGA-MN test was consistent with that of the test kit and was able to distinguish between healthy mice and model mice, demonstrating the applicability of the Col-PAMGA-MN test for detecting UA in interstitial fluid. Evaluation of the knee joint diameter and inflammatory cytokine levels in the control, untreated, Col-PAMGA-MN, and igCol groups revealed that the Col-PAMGA-MN group exhibited a significant inhibitory effect on inflammation, comparable to that of igCol. This suggests that Col-PAMGA-MN treatment can replace oral administration of Col to a certain extent and can improve the limitations of oral administration of Col.

[0130] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A double-layer high swelling hydrogel microneedle, characterized in that: It comprises a base layer and a microneedle body arranged in an array on the base layer; the microneedle body comprises a first needle tip layer and a second needle tip layer arranged in sequence from the tip to the bottom; The material of the first layer of the needle tip is a polyacrylamide gel coated with colchicine; the raw materials for preparing the material of the second layer of the needle tip include GO.Apt complex and polyacrylamide gel solution; the material of the base layer is polyacrylamide gel; The polyacrylamide gel is a double-crosslinked gel of N,N'-methylenebisacrylamide and polyethylene glycol dimethacrylate; the GO.Apt complex is prepared using carboxylated graphene oxide, 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride, NaCl, 4-morpholineethanesulfonic acid, and an amino-modified aptamer as raw materials; The amino-modified aptamer is 5ˋCy3CTCTCGACGACATTACGGGACCTTGCTAAAGGTGGAATTATGTCGT3ˋNH2.

2. The double-layer high swelling hydrogel microneedle according to claim 1, characterized in that: The double-layer high-swelling hydrogel microneedles have a conical array structure; the height of the microneedles is 600-900 μm, the bottom diameter of the microneedles is 200-400 μm; and the center distance between adjacent microneedles is 600-900 μm.

3. The double-layer high swelling hydrogel microneedle according to claim 1, characterized in that: Along the direction perpendicular to the base layer, the height ratio of the first needle tip layer to the second needle tip layer is 1:

1.

4. The double-layer high swelling hydrogel microneedle according to claim 1, characterized in that: The mass fraction of colchicine in the microneedle body is 25% to 40%; the mass fraction of the GO.Apt complex in the second layer of the needle tip is 0.2% to 0.8%.

5. A method for preparing the double-layer high-swelling hydrogel microneedle according to any one of claims 1 to 4, characterized in that: The following steps are involved: (1) Acrylamide, ammonium persulfate, N,N′-methylenebisacrylamide, methyl methacrylate, polyethylene glycol dimethacrylate, and deionized water are mixed and ultrasonically shaken to obtain a polyacrylamide gel solution, also known as a PAM gel solution; Carboxylated graphene oxide, EDC-HCl, NaCl, 4-morpholineethanesulfonic acid, amino-modified aptamer and deionized water were mixed, stirred and post-treated in sequence to obtain a GO.Apt complex; dispersing the GO.Apt complex in HEPES buffer to obtain a GO.Apt complex solution; (2) pouring a portion of the PAM gel solution obtained in step (1) into the microneedle mold, vacuuming and removing bubbles, then sucking out excess PAM gel liquid so that the tip microcavity of the microneedle mold retains the PAM gel liquid, and then sequentially performing a first curing and drying process, and then dripping colchicine solution into the microneedle mold, and performing a drying-swelling process to form a first needle tip layer in the microneedle mold; (3) After removing the supernatant from the GO.Apt complex solution obtained in step (1) by centrifugation, the supernatant was mixed with a portion of the PAM gel solution obtained in step (1) to obtain a PAMGA gel solution; Pour the PAMGA gel solution onto the surface of the first needle tip layer formed in step (2), and perform vacuuming and second curing in sequence to form a second needle tip layer on the surface of the first needle tip layer; (4) adding a PAM gel solution to the surface of the second layer of the needle tip formed in step (3), performing a third curing to form a base layer on the surface of the second layer of the needle tip, and demolding to obtain a double-layer high-swelling hydrogel microneedle.

6. The method for preparing the double-layer high-swelling hydrogel microneedle according to claim 5, characterized in that: The first curing in step (2) is a curing treatment at 60-80° C. for 7-12 minutes.

7. The method for preparing the double-layer high-swelling hydrogel microneedle according to claim 5, characterized in that: The concentration of the colchicine solution in step (2) is 3-7 mg / mL; the amount of the colchicine solution added is 100-400 μL.

8. The method for preparing the double-layer high-swelling hydrogel microneedle according to claim 5, characterized in that: The drying-swelling treatment in step (2) includes alternately performing drying and dripping colchicine solution for swelling 3 to 4 times. The drying temperature is 60-70° C., the drying time is 1-2.5 hours, and the swelling time is 3-5 hours.

9. The method for preparing a double-layer high-swelling hydrogel microneedle according to claim 5, characterized in that: The second curing in step (3) is to stand at room temperature for 1 to 3 hours.

10. Use of the double-layer high-swelling hydrogel microneedle according to any one of claims 1 to 4 or the double-layer high-swelling hydrogel microneedle prepared by the preparation method according to any one of claims 6 to 8 in preparing a microneedle patch for detecting uric acid and / or delivering colchicine.

Images