P450 enzyme, enzyme composition, nucleic acid, expression vector, bioengineering strain, method and application

Abstract

The invention aims to catalyze bufalin and resibufogenin to modify and synthesize bufadienolide compounds, and discloses five newly discovered bufo bufo gargarizans source P450 enzymes, enzyme compositions, nucleic acids, expression vectors, bioengineering strains, methods and applications. The invention also discloses reported enzymes and enzyme compositions, nucleic acids, expression vectors, bioengineering strains, methods and applications of the P450 enzyme Sth10 related to catalysis of bufalin and resibufogenin for modification and synthesis of bufadienolide compounds. The amino acid sequence of the P450 enzyme is as shown in SEQ ID NO. 1-6. According to the invention, a plurality of P450 enzymes capable of modifying bufalin and / or resibufogenin at a fixed point under a mild condition are discovered for the first time, and a bioengineering strain and a biocatalytic synthesis method are developed based on the enzymes, so that a novel biosynthesis method for synthesizing bufadienolide compounds is established.

Description

Technical Field

[0001] The present invention relates to the field of biosynthesis, and in particular to a plurality of P450 enzymes and enzyme compositions, nucleic acids, expression vectors, bioengineering strains, methods and applications. Background Art

[0002] Bufalin, Resibufogenin and its modified derivatives are bufadienolide compounds, which are a class of compounds that can act on Na + / K + These steroids are known to inhibit ATPases and multiple cell signaling pathways, and possess cardiotonic and anti-tumor activities. Over 100 bufadienolide compounds have been reported, all derived from the parotid gland and skin secretions of toads. Their common structural features include cis-fusion of the AB and CD rings, and trans-fusion of the BC ring. A 5β,14β chemical bond is crucial for maintaining the compound's stereochemical configuration, and C17 connects the six-membered unsaturated lactone ring. Hydroxylation at various positions in the steroid nucleus and further modifications can affect the compound's activity.

[0003]

[0004] Bufadienolide drugs are clinically used to treat heart failure, arrhythmia and atrial fibrillation. Bufadienolide drugs can specifically bind to Na + / K + -ATPase α-subunit binding, inhibiting Na + / K + -ATPase activity, which makes the intracellular Na + Increased concentration promotes Na + -Ca 2+ exchange, so that intracellular Ca 2+ Increased concentrations promote contraction of troponin in myocardial cells, producing a positive inotropic effect. This is the mechanism of cardiotonic activity and treatment of heart failure of bufadienolides.

[0005] Bufadienolide compounds have excellent antitumor activity, demonstrating strong activity against liver cancer, colorectal cancer, lung cancer, breast cancer, and leukemia in both in vitro cell studies and mouse models. They achieve their antitumor effects through various mechanisms, including inducing apoptosis, triggering autophagy, inhibiting cell cycle progression, inhibiting vascular endothelial growth factor-mediated angiogenesis, blocking epithelial-mesenchymal transition and metastasis, inhibiting the stem cell properties of cancer cells, and reversing intrinsic and acquired resistance to traditional chemotherapeutics and targeted anticancer drugs. Cinobufacini, with bufadienolide as its main active ingredient, is the highest-selling antitumor Traditional Chinese Medicine in China. Some bufadienolide compounds exhibit certain discrimination between specific tumor cells and normal cells, demonstrating strong activity against some drug-resistant cancer cell lines. They can also exhibit synergistic effects when used in combination with other anticancer drugs. Hydroxylation modifications at different positions influence the antitumor activity of bufadienolide compounds, with single or multiple hydroxylation at certain sites enhancing the compounds' antitumor efficacy.

[0006] Although bufadienolide compounds possess diverse and highly effective pharmacological activities and are clinically used, they are extracted from toad skin and parotid glands, are present in very low concentrations, and are difficult to extract and obtain, severely limiting the development of new bufadienolide drugs. Identifying P450 enzymes that can catalyze the modification of bufalin or resifugin and utilizing biocatalytic methods to synthesize diverse and highly active bufadienolide compounds could lay the foundation for the development and application of such drugs. Summary of the Invention

[0007] To solve the problems existing in the above-mentioned prior art, the present invention provides a P450 enzyme and enzyme composition, nucleic acid, expression vector, bioengineering strain, method and application.

[0008] Specifically, the present invention provides:

[0009] (1) Five newly discovered P450 enzymes from Bufo bufo gargarizans, CYP46A34, CYP2AC114, CYP2AM11, CYP2D152, and CYP2AM13, and a reported fungal P450 enzyme Sth10, are characterized in that the amino acid sequences of these P450 enzymes are shown in SEQ ID NOs. 1-6.

[0010] (2) A nucleic acid encoding the P450 enzyme according to (1).

[0011] (3) The nucleic acid according to (2), wherein the nucleic acid comprises the nucleotide sequence shown in SEQ ID NO. 7-12.

[0012] (4) An expression vector, characterized in that the expression vector contains a protein encoding the P450 enzyme according to (1) and a P450 enzyme.

[0013] (5) The expression vector according to (4), wherein the expression vector comprises the nucleotide sequence shown in SEQ ID NO. 7-12.

[0014] (6) The expression vector according to (4), wherein the expression vector comprises a constitutive promoter HXT7p upstream of the nucleic acid encoding the P450 enzyme according to (1); preferably, the backbone of the expression vector is pRS426 or pRS425.

[0015] (7) An enzyme composition comprising the P450 enzyme according to (1) and cytochrome P450 enzyme reductase Ncp1.

[0016] (8) A bioengineering strain, characterized in that the bioengineering strain expresses the P450 enzyme according to (1); preferably, the bioengineering strain also expresses cytochrome P450 enzyme reductase Ncp1.

[0017] (9) The bioengineered strain according to (8), wherein the bioengineered strain is selected from Saccharomyces cerevisiae strains BY4742 and WAT11U.

[0018] (10) A method for preparing a bufadienolide compound, comprising contacting CYP46A34 according to (1) with bufalin in the presence of an electron donor, thereby catalyzing a reaction to produce a compound shown in Formula 1; contacting CYP2AC114 with resin tofu genin to catalyze the production of a compound shown in Formula 2; contacting CYP2AM11 with bufalin and / or resin tofu genin to produce compounds shown in Formulas 3 and 4 or mixtures thereof; contacting CYP2D152 with bufalin and / or resin tofu genin to produce compounds shown in Formulas 3 and 4 or mixtures thereof; contacting CYP2AM13 with bufalin and / or resin tofu genin to produce compounds shown in Formulas 3, 4, and 5 or mixtures thereof; and contacting Sth10 with bufalin and / or resin tofu genin to produce compounds shown in Formulas 6-10 or mixtures thereof:

[0019]

[0020] (11) The method according to (10), wherein the electron donor is cytochrome P450 enzyme reductase Ncp1;

[0021] (12) The method according to (10), wherein the catalytic reaction is carried out at 28-30°C for 2-3 days; preferably, the catalytic reaction is carried out at 30°C for 2 days.

[0022] (13) The method according to (12), wherein the P450 enzyme according to (1) is contacted with bufatoxin to perform a catalytic reaction to generate the compounds shown in Formula 1 and Formula 2; or the P450 enzyme according to (1) is contacted with bufatoxin to perform a catalytic reaction to generate the compounds shown in Formula 3 and Formula 4.

[0023] (14) The method according to (10), wherein the method comprises the following steps:

[0024] 1) Providing the bioengineered strain according to (8) or (9);

[0025] 2) providing the bioengineered strain and mixing it with bufalin and / or resifugin to obtain a mixed culture, and incubating the mixed culture; preferably, the mixed culture further comprises 5-aminolevulinic acid hydrochloride.

[0026] (15) The method according to (14), wherein in step 2), the OD of the bioengineered strain is 600 The final concentration of bufalin and / or resifugin in the mixed culture is 200 μM to 1 mM; the final concentration of 5-aminolevulinic acid hydrochloride in the mixed culture is 0.5-1 mM.

[0027] (16) The method according to (14), wherein the mixed incubation is carried out at 28-30°C and 220-250 rpm for 2-3 days; preferably, the mixed incubation is carried out at 30°C and 220 rpm for 2 days.

[0028] (17) The method according to (10), wherein the method further comprises purifying the compound represented by Formula 1-10 or a mixture thereof from the system obtained by the catalytic reaction.

[0029] (18) Use of the P450 enzyme described in (1), the nucleic acid described in (2) or (3), the expression vector described in any one of (4) to (6), the enzyme composition described in (7), or the bioengineering strain described in (8) or (9) in preparing the compounds represented by formulas 1 to 10 or their mixtures.

[0030] (19) Five bufadienolide compounds, obtained by catalyzing a reaction between the P450 enzyme according to (1) and bufalin or bufalin as a substrate in the presence of an electron donor; wherein the structural formulas of the bufadienolide compounds are shown in Formulas 1, 3, 5, 6, and 7:

[0031]

[0032] Compared with the prior art, the present invention has the following advantages and positive effects:

[0033] 1. The present invention has discovered for the first time multiple P450 enzymes that can modify bufalin and resibufogenin, and they can catalyze the formation of the corresponding bufadienolide compounds under mild conditions. Among them, CYP46A34 can catalyze bufalin to 23-hydroxybufalin, CYP2AC114 can catalyze resibufogenin to canebufotin, CYP2AM11, CYP2D152, and CYP2AM13 can all catalyze bufalin to 3-hydroxybufalin and resibufogenin to 3-keto-resibufogenin. CYP2AM13 can also catalyze resibufogenin to 1α-hydroxyresibufogenin. Meanwhile, Sth10 can catalyze bufalin to 7β,12α-dihydroxybufalin, 7β,18-dihydroxybufalin, 7β,16α-dihydroxybufalin, and 7β-hydroxybufalin, and catalyze resibufogenin to 12α-hydroxy-resibufogenin. This provides a new site-specific modification and efficient biosynthesis method, thereby achieving simple and efficient acquisition of these bufadienolide compounds.

[0034] 2. The present invention takes into account that eukaryotic P450 enzymes are membrane proteins located in the endoplasmic reticulum. Therefore, Saccharomyces cerevisiae, which has endoplasmic reticulum organelles, is used to express toad-derived P450 enzymes CYP46A34, CYP2AC114, CYP2AM11, CYP2D152, CYP2AM13 and fungal-derived P450 enzyme Sth10. The expression effect is ideal, and the expressed enzymes have the desired biological activity. In addition, the yeast used grows rapidly, is simple to culture, has a short conversion cycle, and is low in cost, thereby enabling the low-cost, simple, and efficient synthesis of specific bufadienolide compounds.

[0035] 3. The P450 enzymes of the present invention provide new candidate enzymes for the synthesis of bufadienolide compounds; the bioengineered strains and biocatalytic synthesis methods of the present invention provide new biocatalytic pathways for the synthesis of bufadienolide compounds. The present invention identifies enzymes that can catalyze the conversion of bufalin or resibufogenin to active bufadienolide compounds, and synthesizes them using biocatalysis, laying the foundation for the development and application of such compounds.

[0036] The concept, specific structure and technical effects of the present invention will be further described below in conjunction with the accompanying drawings to fully understand the purpose, characteristics and effects of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 A schematic diagram of a catalytic reaction according to one embodiment of the present invention is shown.

[0038] Figure 2A schematic diagram of a catalytic reaction according to one embodiment of the present invention is shown.

[0039] Figure 3 A schematic diagram of a catalytic reaction according to one embodiment of the present invention is shown.

[0040] Figure 4 A schematic diagram of a catalytic reaction according to one embodiment of the present invention is shown.

[0041] Figure 5 A schematic diagram of a catalytic reaction according to one embodiment of the present invention is shown.

[0042] Figure 6 A schematic diagram of a catalytic reaction according to one embodiment of the present invention is shown.

[0043] Figure 7 A schematic diagram of a catalytic reaction according to one embodiment of the present invention is shown.

[0044] Figure 8 The following are HPLC chromatograms of the catalytic reactions using the bioengineered strains of the present invention and structural diagrams of the relevant substrates and products in Examples 3 and 4 of the present application. 2)-5) and 7) are HPLC curves of the products obtained by biocatalysis of bufalin by bioengineering strains A (WAT11U (Ncp1 + CYP46A34), C (WAT11U (Ncp1 + CYP2AM11), D (WAT11U (Ncp1 + CYP2D152), E (WAT11U (Ncp1 + CYP2AM13), F (BY4742 (Ncp1 + Sth10)). 1) is an HPLC curve of the products obtained by biocatalysis of bufalin by the control bioengineering strain G (WAT11U (Ncp1)), and 6) is an HPLC curve of the products obtained by biocatalysis of bufalin by the control bioengineering strain H (BY4742 (Ncp1)).

[0045] In addition, 9)-12) and 14) are the high performance liquid chromatography curves of the products obtained by biocatalysis of esterbuflin by bioengineering strains B (WAT11U (Ncp1+CYP2AC114), C (WAT11U (Ncp1+CYP2AM11), D (WAT11U (Ncp1+CYP2D152), E (WAT11U (Ncp1+CYP2AM13), F (BY4742 (Ncp1+Sth10)). 8) is the high performance liquid chromatography curve of the products obtained by biocatalysis of esterbuflin by the control bioengineering strain G (WAT11U (Ncp1)), and 13) is the high performance liquid chromatography curve of the products obtained by biocatalysis of esterbuflin by the control bioengineering strain H (BY4742 (Ncp1)).

[0046] Figure 9Shown are high-resolution mass spectra of the products in Example 5 of the present application.

[0047] Figure 10-14 The NMR spectra of the isolated products 23-hydroxybuflin, 3-hydroxybuflin, 1α-hydroxylipibuflin, 7β,12β-dihydroxybuflin and 7β,18-dihydroxybuflin are shown respectively. 1 H NMR spectrum (600MHz); Figure B is 13 C NMR spectrum (150MHz); Figure C is 1 H- 1 Figure 1 is the H COSY NMR spectrum; Figure D is the HSQC NMR spectrum; Figure E is the HMBC NMR spectrum; Figure F is the NOSEY NMR spectrum. DETAILED DESCRIPTION

[0048] The following describes several preferred embodiments of the present invention with reference to the accompanying drawings to make its technical content clearer and easier to understand. The present invention can be embodied in many different forms of embodiments, and the scope of protection of the present invention is not limited to the embodiments mentioned herein.

[0049] It should be understood that the above-mentioned technical features of the present invention and the technical features specifically described below (including but not limited to implementation plans and examples) can be combined with each other in any appropriate manner to form a new or preferred technical solution, as long as there is no contradiction and the combined technical solution can be successfully implemented and can solve the technical problem of the present invention. The any appropriate manner shall be based on the ability to implement the technical solution of the present invention, solve the technical problem of the present invention, and achieve the corresponding technical effect.

[0050] In the present invention, words such as “including”, “further”, “having”, and “further” merely indicate better or more specific implementation methods or examples, and should be understood that they do not constitute a limitation on the scope of protection of the present invention.

[0051] In the present invention, "and / or" means any one or any combination of the listed items.

[0052] Unless otherwise specified, the numerical ranges in the present invention include both endpoints.

[0053] According to one aspect of the present invention, six P450 enzymes are provided. In addition to the fungal P450 enzyme Sth10, the newly discovered P450 enzymes CYP46A34, CYP2AC114, CYP2AM11, CYP2D152, and CYP2AM13 from the Chinese toad (Bufo bufo gargarizans) are capable of efficiently catalyzing the hydroxylation of inert C-H bonds at specific sites in bufalin and resifugin. The P450 enzymes' catalytic substrates are selected from bufalin and resifugin, and the bufadienolide compounds produced by the catalytic reactions are selected from the compounds represented by the following formulas 1-10:

[0054]

[0055]

[0056] In one embodiment of the present invention, Figure 1 As shown, the P450 enzyme CYP46A34 can catalyze the hydroxylation of the inert CH bond at the C23 position of bufalin to generate the compound shown in Formula 1.

[0057] In one embodiment of the present invention, Figure 2 As shown, the P450 enzyme CYP2AC114 can catalyze the hydroxylation of the inert CH bond at the C5 position of the lipofuginol to generate the compound shown in formula 2.

[0058] In one embodiment of the present invention, Figure 3 As shown, P450 enzyme CYP2AM11 can catalyze the hydroxylation of the inert CH bond at the C3 position of bufalin to generate the compound shown in formula 3, such as Figure 4 As shown, the P450 enzyme CYP2AM11 can catalyze the C3 hydroxylation of lipofugin and then dehydrate it to produce the compound shown in formula 4.

[0059] In one embodiment of the present invention, the P450 enzyme CYP2AM11 can catalyze the hydroxylation of inert CH bonds at specific sites of bufalin and resifugin to produce compounds of Formulas 3 and 4.

[0060] In one embodiment of the present invention, Figure 3 As shown, P450 enzyme CYP2D152 can catalyze the hydroxylation of the inert CH bond at the C3 position of bufalin to generate the compound shown in formula 3, such as Figure 4 As shown, the P450 enzyme CYP2D152 catalyzes the C3 hydroxylation of resifugin and then dehydrates it to produce the compound shown in formula 4.

[0061] In one embodiment of the present invention, the P450 enzyme CYP2D152 can catalyze the hydroxylation of inert CH bonds at specific sites of bufalin and resifugin to produce compounds of Formulas 3 and 4.

[0062] In one embodiment of the present invention, Figure 3 As shown, P450 enzyme CYP2AM13 can catalyze the hydroxylation of the inert CH bonds at the C3 and C1 positions of bufalin to generate compounds shown in formulas 3 and 5, such as Figure 5 As shown, the P450 enzyme CYP2AM13 can catalyze the C3 hydroxylation of lipofuginin followed by dehydration to generate the compound shown in Formula 4 and the C1 hydroxylation to generate the compound shown in Formula 5.

[0063] In one embodiment of the present invention, the P450 enzyme CYP2AM13 can catalyze the hydroxylation of inert CH bonds at specific sites of bufalin and resifugin to produce compounds of formulas 3, 4, and 5.

[0064] In one embodiment of the present invention, Figure 6 As shown, P450 enzyme Sth10 can catalyze the hydroxylation of inert CH bonds at positions C7, C12, C16, and C18 of bufalin to generate compounds shown in formula 6-9, such as Figure 7 As shown, the P450 enzyme Sth10 can catalyze the hydroxylation of the inert CH bond at the C12 position of the lipofugin to generate the compound shown in formula 10.

[0065] In one embodiment of the present invention, the P450 enzyme Sth10 can catalyze the hydroxylation of inert CH bonds at specific sites of bufalin and resifugin to produce compounds shown in Formulas 6-10.

[0066] The amino acid sequences of the P450 enzymes according to the present invention are shown in SEQ ID NO. 1 to SEQ ID NO. 6. See the sequence file.

[0067] The present invention also provides a nucleic acid encoding the P450 enzyme of the present invention. The nucleic acid can be DNA or RNA.

[0068] In some embodiments of the present invention, the nucleic acid comprises a nucleotide sequence encoding the P450 enzyme CYP46A35 of the present invention. Preferably, the nucleotide sequence is as shown in SEQ ID NOs. 7-12. See sequence file.

[0069] According to another aspect of the present invention, an expression vector is provided, which comprises the nucleic acid of the present invention to encode the P450 enzyme of the present invention.

[0070] Preferably, in the expression vector, the present invention utilizes the constitutive strong promoter HXT7p to enhance the expression of the six P450 enzymes. In some preferred embodiments, the constitutive strong promoter HXT7p is located upstream of the nucleotide sequence encoding the P450 enzymes.

[0071] The backbone of the expression vector can be pRS426 or pRS425. According to some specific embodiments of the present invention, the backbone of the vector can be modified to be more suitable for expressing the enzyme of the present invention by inserting a specific promoter and terminator. For example, pRS426 is constructed as pRS426-HXT7p-FBA1t-Ura3 by inserting the strong constitutive promoter HXT7p and the terminator FBA1t.

[0072] In some preferred embodiments, the present invention also constructs an expression vector containing cytochrome P450 enzyme reductase Ncp1. Cytochrome P450 enzyme reductase can provide electron donors for the biocatalysis of P450 enzymes.

[0073] The amino acid sequence of cytochrome P450 enzyme reductase Ncp1 is shown in SEQ ID NO. 13. See sequence file.

[0074] The nucleotide sequence encoding the cytochrome P450 enzyme reductase Ncp1 is shown in SEQ ID NO. 14. See sequence file.

[0075] The backbone of the expression vector containing the cytochrome P450 enzyme reductase can be pRS426 or pRS425. According to some specific embodiments of the present invention, the backbone of the vector can be modified to be more suitable for expressing the cytochrome P450 enzyme reductase by inserting a specific promoter and terminator. For example, pRS425 is constructed as pRS425-TEF1p-PGK1t-Leu2 by inserting the constitutive promoter TEF1p and the terminator PGK1t.

[0076] According to another aspect of the present invention, an enzyme composition is provided, comprising the P450 enzyme of the present invention and cytochrome P450 enzyme reductase Ncp1.

[0077] The P450 enzyme of the present invention can efficiently synthesize the specific bufadienolide compound represented by formula 1-10 with cytochrome P450 enzyme reductase as an electron donor.

[0078] According to another aspect of the present invention, a bioengineering strain is provided, which expresses the P450 enzyme of the present invention.

[0079] Preferably, the bioengineered strain further expresses cytochrome P450 enzyme reductase Ncp1.

[0080] The bioengineered strain can be made to express the P450 enzyme and / or cytochrome P450 enzyme reductase by comprising the expression vector of the present invention.

[0081] In some specific embodiments, the bioengineered strains of the present invention can be constructed by the following methods:

[0082] Step (1): obtaining five P450 enzyme genes from Bufo bufo gargarizans and a P450 enzyme Sth10 gene from a source fungus; obtaining a cytochrome P450 enzyme reductase Ncp1 gene;

[0083] Step (2): cloning the P450 enzyme gene and CPR gene obtained in step (1) into expression vectors respectively, and screening positive plasmids;

[0084] Step (3): The positive plasmids obtained in step (2) are respectively transferred into host bacteria, thereby constructing the bioengineered strain of the present invention.

[0085] In the above step (3), the host bacteria for the P450 enzyme CYP46A34, CYP2AC114, CYP2AM11, CYP2D152, and CYP2AM13 genes are Saccharomyces cerevisiae WAT11U strains, and the host bacteria for the P450 enzyme Sth10 gene are Saccharomyces cerevisiae BY4742 strains.

[0086] According to a preferred embodiment of the present invention, the bioengineered strain of the present invention can be constructed by the following method:

[0087] Step (1): using the cDNA of the postauricular gland tissue of Bufo bufo gargarizans as a template, obtaining the P450 enzyme cyp46a34, cyp2ac114, cyp2am11, cyp2d152, and cyp2am13 genes by PCR amplification; synthesizing the Sth10 gene, and using the genome of the yeast Saccharomyces cerevisiae strain BY4742 as a template, obtaining the cytochrome P450 enzyme reductase CPR gene Ncp1 by PCR amplification;

[0088] Step (2): cloning the P450 enzyme gene and CPR gene Ncp1 obtained in step (1) into yeast expression vectors, respectively, and screening positive plasmids;

[0089] Step (3): The positive plasmids obtained in step (2) are respectively transferred into host bacteria, thereby constructing the bioengineered strain of the present invention.

[0090] In some embodiments, the bioengineered strains of the present invention can be cultured by the following method, comprising: culturing the bioengineered strain in YPD medium at 28°C to 30°C, 220 rpm to 250 rpm, for 2 to 3 days. Preferably, the culture conditions are 30°C, 220 rpm, and 2 days. SD-Ura-Leu medium can also be used for culture.

[0091] According to another aspect of the present invention, a method for preparing a bufadienolide compound is provided, wherein the P450 enzyme of the present invention is contacted with a substrate in the presence of an electron donor, thereby performing a catalytic reaction to produce a bufadienolide compound. The substrate is selected from bufalin or resibufogenin, and the bufadienolide compound is selected from the compounds or mixtures represented by the following formulas 1-10:

[0092]

[0093] In some embodiments of the present invention, the P450 enzyme CYP46A34 is contacted with the substrate bufalin in the presence of an electron donor to catalyze the hydroxylation of the inert CH bond at position C23 of bufalin to generate the compound shown in Formula 1.

[0094] In some embodiments of the present invention, the P450 enzyme CYP2AC114 is contacted with resifugin in the presence of an electron donor to catalyze the hydroxylation of the inert CH bond at the C5 position of resifugin to produce the compound shown in Formula 2.

[0095] In some embodiments of the present invention, the P450 enzyme CYP2AM11 is contacted with the substrate bufalin in the presence of an electron donor to catalyze the hydroxylation of the inert CH bond at the C3 position of bufalin to produce the compound shown in Formula 3. In other embodiments, the P450 enzyme CYP2AM11 is contacted with the substrate resifobafugin in the presence of an electron donor to catalyze the hydroxylation at the C3 position of resifobafugin to produce the compound shown in Formula 4.

[0096] In some embodiments of the present invention, the P450 enzyme CYP2AM11 is contacted with the substrates bufalin and resifugin in the presence of an electron donor to catalyze the hydroxylation of inert CH bonds at specific sites of bufalin and resifugin to produce compounds shown in Formulas 3 and 4.

[0097] In some embodiments of the present invention, the P450 enzyme CYP2D152 is contacted with the substrate bufalin in the presence of an electron donor to catalyze the hydroxylation of the inert C-H bond at the C3 position of bufalin to produce the compound shown in Formula 3. In other embodiments, the P450 enzyme CYP2D152 is contacted with the substrate resifobafugin in the presence of an electron donor to catalyze the hydroxylation at the C3 position of resifobafugin to produce the compound shown in Formula 4.

[0098] In some embodiments of the present invention, the P450 enzyme CYP2D152 is contacted with the substrates bufalin and resifugin in the presence of an electron donor to catalyze the hydroxylation of inert CH bonds at specific sites of bufalin and resifugin to produce compounds shown in Formulas 3 and 4.

[0099] In some embodiments of the present invention, the P450 enzyme CYP2AM13 is contacted with the substrate bufalin in the presence of an electron donor to catalyze the hydroxylation of the inert CH bonds at the C3 and C1 positions of bufalin to produce compounds shown in Formulas 3 and 5. In other embodiments, the P450 enzyme CYP2AM13 is contacted with the substrate resifobafugin in the presence of an electron donor to catalyze the hydroxylation at the C3 position of resifobafugin to produce the compound shown in Formula 4 after dehydration.

[0100] In some embodiments of the present invention, the P450 enzyme CYP2AM13 is contacted with the substrates bufalin and resifugin in the presence of an electron donor to catalyze the hydroxylation of inert CH bonds at specific sites of bufalin and resifugin to produce compounds shown in Formulas 3, 4 and 5.

[0101] In some embodiments of the present invention, the P450 enzyme Sth10 is contacted with the substrate bufalin in the presence of an electron donor to catalyze the hydroxylation of the inert CH bonds at positions C7, C12, C16, and C18 of bufalin to produce compounds shown in Formulas 6-9. In other embodiments, the P450 enzyme Sth10 is contacted with the substrate resifobafugin in the presence of an electron donor to catalyze the hydroxylation of the inert CH bond at position C12 of resifobafugin to produce the compound shown in Formula 10.

[0102] In some embodiments of the present invention, the P450 enzyme Sth10 is contacted with the substrates bufalin and resifugin in the presence of an electron donor to catalyze the hydroxylation of inert CH bonds at specific sites of bufalin and resifugin to produce compounds shown in Formula 6-10.

[0103] The desired product can be separated and purified from the catalytic reaction product by, for example, preparative reverse phase column chromatography, for example, separation and purification of the compound represented by Formula 1-10 or any mixture thereof.

[0104] Preferably, the electron donor is the cytochrome P450 enzyme reductase Ncp1.

[0105] Preferably, the catalytic reaction is carried out at 28-30°C for 2-3 days.

[0106] In the method for preparing 11-deoxycorticosterone, the P450 enzyme can be extracted and purified from the bioengineered bacteria of the present invention, or can be present in the bioengineered bacteria. The extraction and purification can be performed using methods known in the art.

[0107] In a preferred embodiment of the present invention, the P450 enzyme is present in the bioengineered bacteria of the present invention, and the method comprises the following steps:

[0108] 1) Providing the bioengineered strain of the present invention;

[0109] 2) Providing a mixed culture of the bioengineered strain, bufalin or bufalin, and 5-aminolevulinic acid hydrochloride, and incubating the mixed culture.

[0110] Preferably, in step 2), the OD of the bioengineered strain is 600 The final concentration of bufalin or resifugin in the mixed culture is 0.2-1 mM, and the final concentration of 5-aminolevulinic acid hydrochloride in the mixed culture is 0.5-1 mM.

[0111] Also preferably, the incubation is performed at 28-30° C. and 220-250 rpm for 2-3 days.

[0112] The incubation can be performed on a thermostatic shaker.

[0113] In some specific embodiments of the present invention, step 2) comprises the following steps:

[0114] a) inoculating the bioengineered strain into SD-Ura-Leu medium and culturing until OD 600 is about 2.0;

[0115] b) Inoculate 5%-10% (volume) of the inoculum into YPD medium to make the OD 600 is about 0.1-0.2;

[0116] c) adding bufalin or resifugin and 5-aminolevulinic acid hydrochloride, and incubating the mixed culture.

[0117] In some specific embodiments of the present invention, the method of catalyzing bufalin or esterbufogenin to synthesize a plurality of bufadienolide compounds comprises the following steps:

[0118] Step (1): dissolving bufalin or sebufugin in a reaction solvent to obtain a bufalin or sebufugin solution;

[0119] Step (2): mixing the bufalin or bufalin solution obtained in step (1) at a concentration of 1% (V / V) with the bioengineered strain culture of the present invention and incubating the mixture;

[0120] Step (3): The mixture of step (2) is shaken on a shaker to carry out microbial catalysis to obtain a variety of toad diene lactone products.

[0121] The reaction solvent in step (1) can be methanol or N,N-dimethylformamide. Those skilled in the art will appreciate that other solvents can also be used in the method of the present invention, as long as the biocatalytic reaction can be achieved to obtain the bufadienolide product.

[0122] The method for preparing a bufadienolide product of the present invention may further comprise the step of purifying the bufadienolide product from the obtained reaction product. The purification method may be performed by ethyl acetate extraction, followed by separation and purification of the bufadienolide compound from the catalytic reaction product by preparative reverse phase column chromatography.

[0123] Preferably, the ethyl acetate extraction method is carried out by the following steps:

[0124] 1) The reaction product was centrifuged and the supernatant was extracted twice with twice the volume of ethyl acetate;

[0125] 2) Add acetone to the cells and then perform ultrasonic disruption;

[0126] 3) removing ethyl acetate and acetone by rotary evaporation to obtain a crude product;

[0127] 4) The crude product was redissolved in methanol and subjected to rough separation by normal column chromatography, and then subjected to secondary separation by preparative liquid chromatography.

[0128] In step 4), separation can also be performed directly using preparative liquid chromatography.

[0129] The P450 enzymes CYP46A34, CYP2AC114, CYP2AM11, CYP2D152, CYP2AM13, and Sth10 discovered in this study can efficiently catalyze the synthesis of various bufadienolide compounds modified at specific positions under mild conditions using bufalin and / or resifugin. This method is efficient, simple, low-cost, environmentally friendly, and has promising industrial application prospects.

[0130] According to another aspect of the present invention, there is also provided the use of the P450 enzyme, the nucleic acid, the expression vector and the bioengineering strain of the present invention in the preparation of bufadienolide compounds.

[0131] According to another aspect of the present invention, five bufadienolide compounds are provided, which are obtained by catalyzing the P450 enzyme of the present invention with resibufogenin as a substrate in the presence of an electron donor; wherein the structural formulas of the bufadienolide compounds are shown in Formulas 1, 3, 5, 6, and 7:

[0132]

[0133] Formula 1 (23-hydroxybuflin), Formula 3 (3-hydroxybuflin), Formula 5 (1α-hydroxylipibuflin), Formula 6 (7β,12α-dihydroxybuflin), and Formula 7 (7β,18-dihydroxybuflin) are all new, previously unreported bufadienolide compounds. Their potential applications are worthy of exploration.

[0134] Example

[0135] In the following examples, the experimental methods without specific steps and conditions were carried out according to conventional methods and conditions known in the art, or according to the methods and conditions recommended by the manufacturers.

[0136] Unless otherwise specified, the materials, reagents, instruments, etc. used in the examples can be obtained from conventional commercial sources.

[0137] The sources or formulas of the following reagents are as follows:

[0138] The pRS426-HXT7p-FBA1t-Ura3 and pRS425-TEF1p-PGK1t-Leu2 plasmids can be constructed according to the reference "Wang, WF; Xiao, H.; Zhong, JJ, Biosynthesis of a ganoderic acid in Saccharomyces cerevisiae by expressing a cytochrome P450 gene from Ganodermalucidum. Biotechnol Bioeng 2018, 115(7), 1842-1854"; they can also be constructed by inserting the yeast-derived promoter HXT7p and terminator FBA1t into the pRS426 plasmid, and by inserting the yeast-derived promoter TEF1p and terminator PGK1t into the pRS425 plasmid. Plasmids pRS425 and pRS426 can be purchased from Addgene.

[0139] Bufalin: Shanghai Yuanye Biotechnology Co., Ltd.

[0140] Resifugin: Shanghai Yuanye Biotechnology Co., Ltd.

[0141] Methanol: purchased from Shanghai MacLean Biochemical Technology Co., Ltd.

[0142] SD-Ura-Leu culture medium: Shanghai Shaoxin Biotechnology Co., Ltd.

[0143] Ethyl acetate: purchased from Shanghai MacLean Biochemical Technology Co., Ltd.

[0144] 5-Aminolevulinic acid hydrochloride: purchased from Shanghai MacLean Biochemical Technology Co., Ltd.

[0145] Saccharomyces cerevisiae BY4742 strain: American Type Culture Collection ATCC Saccharomyces cerevisiae WAT11U strain: Beijing Baosai Biotechnology Co., Ltd. Leukemia HL60 cells: American Type Culture Collection ATCC

[0146] Lung cancer A549 cells: American Type Culture Collection (ATCC)

[0147] Hepatocellular carcinoma HepG2 cells: American Type Culture Collection (ATCC)

[0148] Breast cancer MDA-MB-231 cells: American Type Culture Collection (ATCC)

[0149] Colon cancer SW480 cells: American Type Culture Collection ATCC

[0150] Example 1. Construction of expression vectors for P450 enzymes CYP46A34, CYP2AC114, CYP2AM11, CYP2D152, CYP2AM13, and Sth10

[0151] 1. Extract RNA from the postauricular gland tissue of Bufo bufo gargarizans and obtain cDNA through reverse transcription. Design primers for amplification based on the DNA sequences of CYP46A34, CYP2AC114, CYP2AM11, CYP2D152, and CYP2AM13 (SEQ ID NOs. 7-11), and obtain the CYP46A35 gene fragment by PCR amplification. Synthesize the Sth10 gene sequence (SEQ ID NO. 12), and use primers Sth10-F and Sth10-R to amplify the gene fragment. Amplify the genomic DNA of Saccharomyces cerevisiae BY4742 strain as a template, and use primers Ncp1-F and Ncp1-R to amplify the cytochrome P450 enzyme reductase (CPR) gene ncp1 fragment. The nucleotide sequences of Ncp1 are shown in SEQ ID NO. 14, and the primers used are as follows:

[0152] CYP46A34-F:tttttaattttaatcaaaaaATGTGGAGAACTGTGGGGTC(SEQ ID NO.15)CYP46A34-R:atcaattaatttgaattaacgtttCTACTTGCGGGGTCTCAGGG(SEQ ID NO.16)CYP2AC114-F:tttttaattttaatcaaaaaATGGATCTGGTCATTCTTCTC(SEQ ID NO.17)CYP2AC114-R:atcaattaatttgaattaacgtttCTATCTACGTGGTACAGCAC(SEQ ID NO.18)CYP2AM11-F:tttttaattttaatcaaaaaATGGCTCTGCACATTGCTTC(SEQ ID NO.19)

[0153] CYP2AM11-R:atcaattaatttgaattaacgtttTCAGGAACGAGGCACAAC(SEQ ID NO.20)CYP2D152-F:tttttaattttaatcaaaaaATGGCTGAGTTCCTCTCCTTC(SEQ ID NO.21)CYP2D152-R:atcaattaatttgaattaacgtttTTATACTCTAGGTACAAC(SEQ ID NO.22)CYP2AM13-F:tttttaattttaatcaaaaaATGGCTCTGGACATTGCTTC(SEQ ID NO.23)CYP2AM13-R:atcaattaatttgaattaacgtttTCAGAAACGAGGGAGAACC(SEQ ID NO.24)Sth10-F:tttttaattttaatcaaaaaATGTCCAACTCCACCTTGGTTTC(SEQ ID NO.25)

[0154] Sth10-R:atcaattaatttgaattaacgtttCTACTCTTCGACCAAGGTAAC(SEQ ID NO.26)Ncp1-F:atctaagttttaattacaaaatgccgtttggaatagac(SEQ ID NO.27)

[0155] Ncp1-R: cgatttcaattcaattcaatgtttttaccagacatcttcttg (SEQ ID NO.28)

[0156] 2. Construction of expression vector containing P450 enzyme gene and CPR gene

[0157] The linearized plasmid vectors pRS426-HXT7p-FBA1t-Ura3 and pRS425-TEF1p-PGK1t-Leu2 were obtained by single-restriction digestion with the restriction endonuclease MssI. Using a one-step cloning method, the CPR gene amplified fragment was homologously recombined with the linearized plasmid vector pRS425-TEF1p-PGK1t-Leu2; the P450 enzyme gene was homologously recombined with the linearized plasmid vector pRS426-HXT7p-FBA1t-Ura3. The homologous recombination products were transformed into competent Escherichia coli DH5α cells, and transformants were selected on LB plates containing 100 μg / mL ampicillin. Positive clones were identified by sequencing to obtain recombinant plasmids.

[0158] Example 2. Construction of bioengineered strains expressing CYP46A34, CYP2AC114, CYP2AM11, CYP2D152, CYP2AM13 or Sth10

[0159] The recombinant expression vector obtained in Example 1 was extracted and used to transform competent cells of the Saccharomyces cerevisiae strain WAT11U, which harbors genes encoding the P450 enzymes CYP46A34, CYP2AC114, CYP2AM11, CYP2D152, and CYP2AM13, as well as the Ncp1 gene. Competent cells of the Saccharomyces cerevisiae strain BY4742 were also transformed using recombinant expression vectors harboring genes encoding the P450 enzymes Sth10 and Ncp1. Competent cells of WAT11U and BY4742 were also transformed using the empty pRS426-HXT7p-FBA1t-Ura3 vector and an expression vector harboring Ncp1 as controls. This Saccharomyces cerevisiae strain does not express the CYP46A35 enzyme or the cytochrome P450 reductase Ncp1. Transformants were screened using uracil- and leucine-deficient plates to obtain bioengineered strain AH.

[0160]

[0161]

[0162] Among them, bioengineered strains AF were transformed with recombinant expression vectors inserted with the P450 gene and the Ncp1 gene. As controls, bioengineered strains G and H were transformed with only the recombinant expression vector inserted with the cytochrome P450 enzyme reductase Ncp1, and therefore could not express the P450 enzyme gene to function.

[0163] Example 3. Catalytic synthesis of bufadienolide compounds using bufalin as a substrate

[0164] Bufalin was used as a substrate and dissolved in methanol at a bufalin concentration of 20 mM.

[0165] The bioengineered strains A and CF constructed in Example 2 were inoculated into SD-Ura-Leu medium and cultured at 30°C and 220 rpm until the OD 600 The OD value is about 2.0; 5% (volume) inoculation amount is inoculated into YPD medium (yeast extract 1%, peptone 2%, glucose 2%). 600 The concentration of the mixture was about 0.1, and 5-aminolevulinic acid hydrochloride and a methanol solution of bufalin were added at a final concentration of 1 mM, so that the final concentration of bufalin was 200 μM; the mixture was shaken at 30° C. and 220 rpm for 2 days to obtain a biocatalytic system solution.

[0166] The biocatalytic system solution was extracted twice with twice the volume of ethyl acetate and centrifuged at 15,000 rpm for 15 minutes. The ethyl acetate layer was evaporated in a rotary concentrator (1,000 rpm, 30°C). Methanol was added for reconstitution and centrifuged at 15,000 rpm for 15 minutes. The supernatant was filtered through a 0.22 μm filter to obtain the product solution.

[0167] The product solution was detected by ultra-high performance liquid chromatography (HPLC). HPLC detection conditions were as follows: Agilent 1260 Infinity II liquid chromatography system, C18 reverse phase column (model: InfinityLab Poroshell 120); mobile phase A: 0.1% formic acid in water, mobile phase B: acetonitrile, gradient elution; column temperature: 30°C, elution rate: 0.5 mL / min, diode array detector (DAD) UV detection wavelength: 300 nm.

[0168] As a control, cultures of the engineered yeast strains G and H obtained in Example 2 were used to react with bufalin as a substrate using the same method as above and detected by HPLC.

[0169] The HPLC results were as follows Figure 8As shown, 2)-5) and 7) are the HPLC curves of the products obtained by biocatalysis of bioengineered strains A and CF. These bioengineered strains have been transformed with P450 enzyme genes and cytochrome P450 enzyme reductase Ncp1 genes, and their reaction product curves show new peaks different from bufalin. The product components were subjected to high-resolution mass spectrometry and nuclear magnetic resonance (for specific data, see Example 7 and Figure 9 ,10,11,13,14) verification, confirming that the new peak Figure 8 Shown are compounds 1, 3, 6-9 containing bufadienolide compounds. 1) shows the HPLC curve of the biocatalytic products obtained by control bioengineering strain G (WAT11U (Ncp1)), and 6) shows the HPLC curve of the biocatalytic products obtained by control bioengineering strain H (BY4742 (Ncp1)). Control bioengineering strains G and H were only transformed with the cytochrome P450 reductase gene, without the P450 enzyme gene. The reaction product curves show that bufalin is still present in large quantities, but no bufadienolide product peaks are observed. This indicates that bioengineering strains G and H, which do not have the P450 enzyme gene, are unable to catalyze the hydroxylation reaction of bufalin at specific sites.

[0170] The above results also prove that the bioengineered strain constructed by the present invention successfully transcribes and expresses the transferred P450 enzyme gene and cytochrome P450 enzyme reductase gene, and the two expressed enzymes can exert the desired biological activity and effectively play the role of substrate catalysis and electron transfer.

[0171] Example 4. Catalytic synthesis of bufadienolide compounds using resibufogenin as substrate

[0172] Resifugin as a substrate was dissolved in methanol at a resifugin concentration of 20 mM.

[0173] The bioengineered strain BF constructed in Example 2 was inoculated into SD-Ura-Leu medium and cultured at 30°C and 220 rpm until the OD 600 The OD value is about 2.0; 5% (volume) inoculation amount is inoculated into YPD medium (yeast extract 1%, peptone 2%, glucose 2%). 600 The reaction mixture was stirred at 30°C and 220 rpm for 2 days to obtain a biocatalytic system solution.

[0174] The biocatalytic system solution was extracted twice with twice the volume of ethyl acetate and centrifuged at 15,000 rpm for 15 minutes. The ethyl acetate layer was evaporated in a rotary concentrator (1,000 rpm, 30°C). Methanol was added for reconstitution and centrifuged at 15,000 rpm for 15 minutes. The supernatant was filtered through a 0.22 μm filter to obtain the product solution.

[0175] The product solution was detected by ultra-high performance liquid chromatography (HPLC). The HPLC detection conditions were the same as those in Example 3.

[0176] As a control, cultures of the engineered yeast strains G and H obtained in Example 2 were used to react with resibufogenin as a substrate using the same method as above and detected by HPLC.

[0177] The HPLC results were as follows Figure 8 As shown, 9)-12) and 14) are high performance liquid chromatography curves of the products obtained by biocatalysis of bioengineered strain BF. These bioengineered strains have been transformed with P450 enzyme genes and cytochrome P450 enzyme reductase Ncp1 genes, and their reaction product curves show new peaks different from lipofugin. The product components were subjected to high resolution mass spectrometry and nuclear magnetic resonance (for specific data, see Examples 7 and Figure 9 ,12) Verify and confirm the new peak Figure 8 The graphs show compounds 2, 4, 5, and 10, which contain bufadienolide compounds. (8) shows the HPLC curve of the biocatalytic products obtained using control bioengineering strain G (WAT11U (Ncp1)), and (13) shows the HPLC curve of the biocatalytic products obtained using control bioengineering strain H (BY4742 (Ncp1)). Control bioengineering strains G and H were only transfected with the cytochrome P450 reductase gene, without the P450 enzyme gene. The reaction product curves show the presence of a large amount of resifugin, but no bufadienolide product peaks were observed. This indicates that bioengineering strains G and H, which do not have the P450 enzyme gene, are unable to catalyze the hydroxylation reaction at a specific site of resifugin.

[0178] The above results also prove that the bioengineered strain constructed by the present invention successfully transcribed and expressed the transferred P450 enzyme CYP46A35 gene and cytochrome P450 enzyme reductase gene, and that both expressed enzymes can exert the desired biological activity and effectively play the role of substrate catalysis and electron transfer.

[0179] Example 5. High-resolution mass spectrometry and nuclear magnetic resonance verification of the product

[0180] The structures of the reaction products of Examples 3 and 4 were elucidated as follows: the target products were separated on a C18 X-bridge (5 μm, 10 × 250 mm) column using an Agilent 1260 Infinity II preparative HPLC system (Agilent Technologies, USA). Subsequently, an Agilent 6120 Quadruple HPLC-HRMS system (Agilent Technologies, USA) was used to detect the purity and precise molecular weight of the compounds using the same conditions as for HPLC (except that the flow rate of HPLC-HRMS was 0.4 mL / min). Finally, the isolated high-purity compound was evaporated to dryness, dissolved in deuterated methanol, and subjected to nuclear magnetic resonance (NMR) spectroscopy, and its structure was elucidated based on its molecular weight and nuclear magnetic spectrum.

[0181] Canebufotoxin (compound represented by formula 2)

[0182]

[0183] The high-resolution mass spectrometry calculated value C of the compound of formula 2 24 H 32 O5[M+H] + :401.2323, high resolution mass spectrometry measured value 401.2325 (such as Figure 9 shown)

[0184] 1 H NMR (700MHz, Methanol-d4): δ7.89 (d, J=9.4Hz, 1H, H23), 7.47 (s, 1H, H21), 6.40 (d, J=9.7Hz, 1H,H22),4.39(brs,J=2.1Hz,1H,H15),3.62(brs,1H,H3),1.17(s,3H,H19),0.81(s,3H,H18).

[0185] 13 C NMR (175MHz, Methanol-d4): δ164.5(C24)151.80(C21),149.58(C22),124.5(C20), 115.42(C23),76.13(C5),75.80(C14),69.06(C3),61.19(C15),46.19(C17),43.87( C13),42.05(C9),40.13(C10),37.73(C12),35.21(C4),34.13(C6),33.15(C8),28. 53(C16),28.15(C2),26.11(C1),24.02(C7),22.70(C11),17.30(C19),17.10(C18).

[0186] By comparing with the NMR data of reported compounds, the structure of the compound of formula 2 was determined to be canebufagin.

[0187] 3-ketoesterbufogenin (compound represented by formula 4)

[0188]

[0189] The high-resolution mass spectrometry calculated value C of the compound of formula 4 24 H 30 O4[M+H] + :383.2217, high resolution mass spectrometry measured value 383.2225 (such as Figure 9 shown)

[0190] 1 H NMR (700MHz, Methanol-d4): δ7.91 (dd, J=9.7, 2.3Hz, 1H, H23), 7.46 (d, J=2.1Hz ,1H,H21),6.27(dd,J=9.7,0.6Hz,1H,H22),1.09(s,3H,H19),0.79(s,3H,H18).

[0191] 13 C NMR (175MHz, Methanol-d4): δ214.45(C3),163.06(C24),150.39(C21),148.15(C22) ,123.08(C20),113.96(C23),74.13(C14),59.82(C15),47.2(C17),44.91(C5),43.9 6(C13),41.56(C4),39.68(C8),38.41(C2),36.48(C1),36.43(C12),34.97(C9),33. 48(C10),31.78(C16),25.60(C6),21.42(C7),20.89(C11),19.88(C19),15.70(C18).

[0192] By comparing with the NMR data of reported compounds, the structure of the compound of formula 4 was determined to be 3-ketoester bufotoxin.

[0193] 7β,16β-dihydroxybuflin (compound represented by formula 8)

[0194]

[0195] The high-resolution mass spectrometry calculated value C of the compound of formula 8 24 H 34 O6[M+H]+ :419.2428, high resolution mass spectrometry measured value 419.2434 (such as Figure 9 shown)

[0196] 1 H NMR (600MHz, Pyridine-D5): δ8.59(d,J=9.7Hz,1H,H23),7.55(s,1H,H21),6.40(d,J=9.7Hz ,1H,H22),4.88(t,J=7.6Hz,1H,H16),4.30(m,2H,H3,7),1.06(s,3H,H19),1.04(s,3H,H18).

[0197] 13 C NMR (150MHz, Pyridine-D5): δ162.18(C24),151.43(C21),150.3(C22),123.9(C20) ,112.35(C23),85.49(C14),72.45(C16),69.94(C7),65.49(C3),59.06(C17),49.03 (C13),46.89(C8),44.18(C10),40.86(C12),37.56(C9),37.34(C4),35.43(C5),35. 07(C15),34.91(C2),29.84(C6),28.33(C1),23.87(C11),21.54(C19),17.11(C18).

[0198] By comparing with the NMR data of reported compounds, the structure of the compound of formula 8 was determined to be 7β,16β-dihydroxybuflin.

[0199] 7β-Hydroxybuflin (compound represented by formula 9)

[0200]

[0201] The high-resolution mass spectrometry calculated value C of the compound of formula 9 24 H 34 O5[M+H] + :403.2479, high resolution mass spectrometry measured value 403.2491 (such as Figure 9 shown)

[0202] 1H NMR (700MHz, Methanol-d4): δ8.09 (dd, J=9.7, 2.5Hz, 1H, H23), 7.41 (m, 1H, H21), 6.27 (dd, J= 9.7,0.5Hz,1H,H22),4.01(brs,1H,H3),3.93(s,1H,H7),1.01(s,3H,H19),0.72(s,3H,H18).

[0203] 13 C NMR (175MHz, Methanol-d4): δ163.52(C24),148.93(C21),148.43(C22),123.76(C20) ,113.96(C23),85.11(C14),69.80(C7),65.89(C3),50.93(C17),46.38(C13),40.34(C 8),36.84(C10),36.37(C12),36.12(C9),34.93(C4),34.80(C5),33.81(C15),33.15( C2),29.06(C16),28.48(C6),26.92(C1),22.80(C11),21.27(C19),16.11(C18).TheMS and NMRdata was identical to those reported in the literature 4 .

[0204] By comparing with the NMR data of reported compounds, the structure of the compound of formula 9 was determined to be 7β-hydroxybuflin.

[0205] 12β-Hydroxybufagin (compound represented by formula 10).

[0206]

[0207] The high-resolution mass spectrometry calculated value C of the compound of formula 10 24 H 32 O5[M+H] + :401.2323, high resolution mass spectrometry measured value 401.2334 (such as Figure 9 shown)

[0208] 1H NMR (600MHz, Methanol-d4): δ7.86 (dd, J=9.7, 2.1Hz, 1H, H23), 7.47 (d, J=1.9Hz, 1H, H21), 6.28 (d, J=9.7Hz, 1H, H 22),4.06(brs,1H,H3),3.60(brs,1H,H15),3.44(dd,J=11.6,4.1Hz,1H,H12),1.02(s,3H,H19),0.73(s,3H,H18).

[0209] 13 C NMR (150MHz, Methanol-d4): δ164.9(C24),115.3(C23),149.9(C22),150.9(C 1),125.1(C20),30.6(C1),28.4(C2),67.3(C3),37.8(C4),37.9(C5),27.0(C 6),71.0(C7),47.6(C8),33.1(C9),36.3(C10),30.7(C11),76.4(C12),55.6( C13),86.9(C14),61.0(C15),34.0(C16),47.5(C17),10.7(C18),24.29(C19).

[0210] By comparing with the NMR data of reported compounds, the structure of the compound of formula 10 was determined to be 12β-hydroxy bufotoxin.

[0211] The H-NMR and C-NMR data of the compound of formula 1,3,5-7 are shown in Tables 1 and 2 below:

[0212] Table 1. H NMR spectroscopy data of compounds of formula 1, 3, 5-7 (700 MHz or 600 MHz, Methanol-d4, multi, J in Hz)

[0213]

[0214]

[0215] a:700MHz

[0216] b:600MHz

[0217] Table 2. C NMR spectroscopy data of compounds of formula 1, 3, 5-7 (175 MHz or 150 MHz, Methanol-d4)

[0218]

[0219] a:175MHz

[0220] b:150MHz

[0221] 23-Hydroxybuflin (compound of formula 1)

[0222]

[0223] According to the high-resolution mass spectrometry m / z 403.2483[M+H] + The pseudo molecular ion peak of the compound was determined to be C 24 H 34 O5, indicating that the compound of formula 1 is a monohydroxylated product of bufalin. Figure 10 As shown, compared with bufalin, the Dept135 and 13 The C spectrum showed the disappearance of the aromatic methane signal at δ114.0. Instead, a non-protonated aromatic carbon appeared at δ143.1. This suggests that the aromatic methane at C21, C22, or C23 was replaced by a hydroxyl group. The coupling constant between H21 and H22 was 1.9 Hz, consistent with meta-substitution of the aromatic proton. Combined with the HMBC correlations between H21 and C17, and H22 and C17, the structure of 1 was identified as 23-hydroxy-bufotolin.

[0224] 3-Hydroxybuflin (compound of formula 3)

[0225]

[0226] According to the high-resolution mass spectrometry m / z 385.2380 [M+H-H2O] + The ion peak of formula 3 is inferred to be C 24 H 34 O5, it is speculated that this compound may be a monohydroxylated product of bufalin. Figure 11 As shown, compared with bufalin, the Dept135 and 13 The C spectrum showed an additional oxidized C signal at δ 100.9, absent from C3. This suggests the introduction of two hydroxyl groups at C3. This was confirmed by HMBC correlations from H1 to C3 and from H5 to C3. Therefore, the structure of the compound of Formula 3 was identified as 3-hydroxybuflin.

[0227] 1α-Hydroxylipobufogenin (compound of formula 5)

[0228]

[0229] According to the high-resolution mass spectrometry m / z 401.2320[M+H] + The pseudo molecular ion peak of formula 5 was confirmed to be C 24 H 32O5, indicating that the compound is a monohydroxylated product of lipofugin. Figure 12 As shown, compared with resifugin, the Dept135 and 13 The C spectrum revealed an additional oxidized CH signal at δ 67.6. HMBC correlations between H1 and C3, and H1 and C19, indicated the introduction of a hydroxyl group at C1. The coupling constants for H1 and H2 were 9.2 and 2.5 Hz, respectively, confirming the α-configuration of the 1-OH group. Therefore, the structure of the compound of Formula 5 was identified as 1α-hydroxylimonafologenin.

[0230] 7β,12α-dihydroxybuflin (compound of formula 6)

[0231]

[0232] According to the high-resolution mass spectrometry m / z 419.2438[M+H] + The pseudo molecular ion peak of formula 6 was determined to be C 24 H 34 O6, indicating that the compound is a dihydroxylated product of bufalin. Figure 13 As shown, compared with bufalin, the Dept135 and 13 The C spectrum shows two additional oxidized CH signals at δ 76.4 and 71.0. 13 The downfield shifts of C6 (δ+8.9) and C8 (δ+7.0) in the C NMR spectrum indicate that one of the hydroxyl groups in Formula 6 was introduced at C7. This was confirmed by HMBC correlations of H7 with C14 and H7 with C9. NOESY enhancements observed at H7 and H9 strongly confirmed the β-configuration of the 7-OH group. HMBC correlations of H12 with C18 and H12 with C14 confirmed the introduction of another hydroxyl group at C12. Due to the γ-gauche effect, the C18 signal shifts to δ10.8 when a β-OH group is present at C12, confirming the β-configuration of this hydroxyl group. Therefore, the structure of Formula 6 was identified as 7β,12α-dihydroxybuflin.

[0233] 7β,18-dihydroxybuflin (compound of formula 7)

[0234]

[0235] According to the high-resolution mass spectrometry m / z 419.2438[M+H] + The pseudo molecular ion peak of the compound 7 was determined to be C 24 H 34 O6, indicating that the compound is a dihydroxylated product of bufalin. Figure 14 As shown, compared with bufalin, the Dept135 and13 The C spectrum shows that the methyl group at C18 disappears, while additional oxidized CH2 signals are found at δ60.5 and δ71.1, respectively. Combined with the HMBC correlation between H18 and C14, this indicates that a hydroxyl group has been introduced at C18. 13 The downfield shifts of C6 (δ+8.9) and C8 (δ+7.0) in the C spectrum indicated that the additional hydroxyl group in this compound was introduced at C7. This was confirmed by HMBC correlations between H7 and C14 and H7 and C9. Enhanced NOEs at H7 and H9 in the NOESY spectrum strongly confirmed the β-configuration of the 7-OH group. Therefore, the structure of compound 7 was identified as 7β,18-dihydroxy-bufalin.

[0236] Example 7. Determination of antitumor activity of the product

[0237] The inhibitory effects of the compounds of formula 1-10 prepared by the method of the present invention on different tumor cell lines were studied. The specific experimental method is: tumor cells are cultured in RMPI-1640 or DMEM medium, the medium is supplemented with 10% fetal bovine serum, and the tumor cells are cultured in an incubator at a temperature of 37°C and 5% CO2. The cytotoxicity of the compound to tumor cells was evaluated by the 3-(4,5-dimethylthiazol-2-yl)-5(3-carboxymethyloxyphenyl)-2-(4-sulfophenyl)-2H-tetrazole (MTS) method. Briefly, the cells were plated at 5×10 3 Cells were seeded into 96-well plates at a density of 100 cells / mL and incubated in culture medium at 37°C for 12 h. Compounds were added to the cell cultures at different concentrations in triplicate, and cisplatin was used as a positive control. The IC of each compound was calculated using the method of Reed and Muench. 50 value.

[0238]

[0239] Table 3. IC against five tumor cell lines 50 Value (cisplatin as positive control)

[0240]

[0241]

[0242] a: Leukemia HL 60 cells

[0243] b: Lung cancer A549 cells

[0244] c: Hepatocellular carcinoma HepG2 cells

[0245] d: breast cancer MDA-MB-231 cells

[0246] e: Colon cancer SW480 cells

[0247] The results showed that most of the obtained bufadienolide products had IC values ​​of 50 The values ​​remained in the nM to μM range, which was higher than the inhibitory effect of cisplatin. This indicated that these compounds have the potential to inhibit the growth of tumor cells and are suitable for further research and application. 50 The cytotoxicity of bufadienolide against leukemia and lung cancer cells was higher than that against breast cancer, liver cancer, and colon cancer cells. The antitumor activity of bufadienolides with a 14-15 epoxy group was generally lower than that of bufadienolides with a C14β-hydroxy group, and the antitumor activity of dihydroxylated products was also lower than that of monohydroxylated products.

[0248] The preferred embodiments of the present invention have been described in detail above. It should be understood that numerous modifications and variations based on the concepts of the present invention are possible without inventive effort by those skilled in the art. Therefore, any technical solution that can be derived by one skilled in the art through logical analysis, reasoning, or limited experimentation based on the concepts of the present invention and the prior art should be within the scope of protection defined by the claims.

Claims

1. A P450 enzyme modified with bufalin and resifugin, selected from the group consisting of CYP46A34, CYP2AC114, CYP2AM11, CYP2D152, CYP2AM13 and Sth10, characterized in that: The amino acid sequences of the P450 enzymes are shown in SEQ ID NO. 1 to SEQ ID NO.

6.

2. A nucleic acid encoding the P450 enzyme according to claim 1.

3. The nucleic acid according to claim 2, wherein the nucleic acid comprises the nucleotide sequence shown in SEQ ID NO.7 to SEQ ID NO.

12.

4. An expression vector, characterized in that The expression vector comprises the nucleic acid according to claim 2 or 3. 5 . The expression vector according to claim 4 , wherein the expression vector comprises a constitutive promoter HXT7p upstream of the nucleic acid encoding the P450 enzyme according to claim 1 . The expression vector according to claim 4 , wherein the backbone of the expression vector is pRS426 or pRS425.

7. An expression vector composition comprising a first expression vector and a second expression vector, wherein the first expression vector is the expression vector according to any one of claims 4 to 6, and the second expression vector comprises a coding sequence for cytochrome P450 enzyme reductase Ncp1.

8. The expression vector composition according to claim 7, wherein the second expression vector comprises a constitutive promoter TEF1p upstream of the coding sequence of the cytochrome P450 enzyme reductase; preferably, the backbone of the second expression vector is pRS426 or pRS425.

9. An enzyme composition comprising one of the P450 enzymes according to claim 1 and cytochrome P450 enzyme reductase.

10. The enzyme composition of claim 9, wherein the cytochrome P450 enzyme reductase is Ncp1.

11. A bioengineered strain, characterized in that: The bioengineered strain expresses the P450 enzyme according to claim 1; preferably, the bioengineered strain also expresses cytochrome P450 enzyme reductase Ncp1.

12. The bioengineered strain according to claim 11, wherein the bioengineered strain is selected from the group consisting of Saccharomyces cerevisiae strains BY4742 and WAT11U.

13. A method for preparing a bufadienolide compound, comprising contacting the CYP46A34 according to claim 1 with bufalin in the presence of an electron donor, thereby catalyzing a reaction to produce a compound shown in formula 1; contacting CYP2AC114 with resinbufogenin to catalyze the production of a compound shown in formula 2; contacting CYP2AM11 with bufalin to produce a compound shown in formula 3, and contacting with resinbufogenin to produce a compound shown in formula 4; contacting CYP2D152 with bufalin to produce a compound shown in formula 3, and contacting with resinbufogenin to produce a compound shown in formula 4; contacting CYP2AM13 with bufalin to produce a compound shown in formula 3, and contacting with resinbufogenin to produce compounds shown in formula 4 and 5; contacting Sth10 with bufalin to produce compounds shown in formulas 6-9, and contacting with resinbufogenin to produce a compound shown in formula 10.

14. The method of claim 13, wherein the electron donor is the cytochrome P450 enzyme reductase Ncp1.

15. The method according to claim 13, wherein the catalytic reaction is carried out at 28-30°C for 2-3 days.

16. The method according to claim 13, wherein the method comprises the following steps: 1) Providing the bioengineered strain according to claim 11 or 12; 2) Providing a mixed culture of the bioengineered strain, bufalin or resifugin and 5-aminolevulinic acid hydrochloride, and incubating the mixed culture.

17. The method according to claim 16, wherein in step 2), the OD of the bioengineering strain is 600 The final concentration of bufalin or resifugin in the mixed culture is 200 μM, and the final concentration of 5-aminolevulinic acid hydrochloride in the mixed culture is 0.5-1 mM. The method according to claim 16 , wherein the incubation is performed at 28-30° C. and 220-250 rpm for 2-3 days.

19. The method according to claim 13, further comprising purifying the compounds represented by formulas 1 to 10 or mixtures thereof generated in each reaction from the system obtained by the catalytic reaction.

20. Use of the P450 enzyme of claim 1, the nucleic acid of claim 2 or 3, the expression vector of any one of claims 4 to 6, the expression vector composition of claim 7 or 8, the enzyme composition of claim 9 or 10, or the bioengineered strain of claim 11 or 12 in preparing the compounds of formulae 1 to 10 or mixtures thereof.

Images