A kind of chilo suppressalis prevention and cure miRNA and its application in cultivating insect-resistant rice
By overexpressing miR-989 in rice and using RNAi technology to inhibit the ovarian development of the rice stem borer, the problems of pest resistance and agronomic trait stability in rice pest control were solved, and a specific insecticidal effect against the rice stem borer was achieved.
Patent Information
- Application Number
- CN202510818889.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-18
- Publication Date
- 2026-01-27
- Estimated Expiration
- 2045-06-18
AI Technical Summary
Existing chemically synthesized insecticides face issues of insect resistance, environmental toxicity, and food safety when controlling rice pests. Furthermore, traditional insect-resistant genetically modified crops pose a threat of resistance to target pests and outbreaks of non-target secondary pests.
Using miR-989 overexpression technology, miR-989 was overexpressed in rice via an amiRNA vector. RNAi technology was used to inhibit ovarian development in rice stem borers, reducing egg production and developmental progress. Genetic transformation was then performed using Agrobacterium-mediated transformation technology to obtain miR-989 transgenic rice.
It significantly inhibits feeding damage caused by rice stem borer larvae, provides specific resistance to rice stem borer, maintains stable agronomic traits, reduces egg production and development, and offers a green control strategy.
Smart Images

Figure CN120648687B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a miRNA for controlling rice stem borer and its application in cultivating insect-resistant rice. Background Technology
[0002] Globally, it is estimated that pests cause 13%–18% of crop yield losses annually, resulting in approximately $470 billion in economic losses. Rice (Oryza sativa), as the most widely cultivated food crop globally, supports the food needs of approximately 3 billion people worldwide. Currently, chemically synthesized pesticides remain the primary means of controlling rice pests, but increasingly serious issues such as pest resistance, environmental toxicity, and food safety pose greater challenges to crop pest control. Genetic engineering technology, through the development of high-quality insect-resistant transgenic crop varieties, has brought about a revolutionary change in agriculture. Bt cotton, approved for commercial use in China in 1997, has significantly reduced the use of chemical pesticides in cotton fields and further reduced the use of pesticides in non-Bt host crops by effectively controlling bollworm (Helicoverpa armigera) larvae. However, with the rapid development of insect-resistant transgenic crops, the development of resistance in target pests and the outbreak of non-target secondary pests pose a threat to their long-term application.
[0003] To address the problem of pesticide resistance in target pests, RNA interference (RNAi) technology has emerged. This technology silences key genes in insects using sequence-specific double-stranded RNA (dsRNA), thereby conferring insect resistance to crops. Specifically, target gene fragments are inserted into expression vectors as inverted repeat sequences. After transformation of host plants, these vectors are transcribed into long-chain dsRNA. When insects feed on the transgenic plants, the dsRNA is processed into small interfering RNA (siRNA), which binds to the target mRNA with specificity, triggering gene silencing and ultimately leading to growth inhibition or death of the pests. miRNAs, as a class of regulatory small RNAs, can trigger corresponding RNAi pathways and participate in various physiological processes such as biological development, reproduction, and apoptosis. Therefore, miRNA-mediated RNAi technology has also been applied to the development of insect-resistant crops. Furthermore, compared to currently used insect-resistant strategies, miRNA-mediated RNAi has the advantage of less impact on the environment and non-target organisms, and it is also more sensitive to some insects, thus possessing the potential to discover effective insect-resistant gene resources.
[0004] Artificial miRNA (amiRNA) technology can specifically generate single-function small RNAs in vivo by modifying the precursor scaffold of endogenous miRNAs. Since the amiRNA sequence does not need to be perfectly complementary to the target site, sequence optimization can achieve single-gene specific knockout or multi-gene synergistic regulation. Genome-wide expression profiling analysis shows that amiRNAs have high targeting specificity comparable to endogenous miRNAs. Vector systems based on modified Arabidopsis miRNA precursors have been successfully applied to the silencing of endogenous / exogenous genes in dicotyledonous plants such as Arabidopsis, tomato, and tobacco. Their precision and versatility have led amiRNA vectors to be recognized as second-generation RNA interference technology vectors. Summary of the Invention
[0005] This invention has shown that overexpression of miR-989 leads to delayed development of rice stem borer oocytes and inhibited ovarian development. Further, based on amiRNA technology, miR-989 was integrated into the rice genome and overexpressed in rice. It was found that miR-989 transgenic rice significantly inhibited feeding damage to rice stem borer larvae and exhibited specific insect-resistant effects against the target pest. Furthermore, miR-989 rice lines showed no statistically significant differences from wild-type lines in key indicators such as plant height, panicle length, and seed setting rate, demonstrating stable agronomic traits. Therefore, miR-989 can be applied to insect-resistant rice breeding.
[0006] The technical solution of the present invention includes:
[0007] 1. Based on the ovarian development during the pupal stage of the rice stem borer and the expression level of Vg in the fat body of female pupae from day 1 to day 6, fat bodies from female pupae on days 1, 3, and 5 were sent to BGI Genomics in Shenzhen for small RNA sequencing. The sequencing results were analyzed and preliminarily screened.
[0008] 2. The miR-989 agonist (agomiR-989) was introduced into the rice stem borer via injection. The biological function of the miRNA was clarified by analyzing various indicators and observing the phenotype. agomiR-989 is modified on the antisense strand, namely, cholesterol modification at the 3' end, two thiocarbonyl modifications at the 5' end, and full-chain methoxy modification at the 3' end with four thiocarbonyl modifications.
[0009] 3. This invention constructs an artificial pre-miR-989 using the osa-miR-528 precursor backbone, based on the method reported by Warthmann et al. (2008), and clones it into the pC1300-Ubi-nos vector to ultimately form an amiRNA expression vector. Agrobacterium-mediated genetic transformation is then used to introduce this expression vector into Zhonghua 11 (ZH11) rice to obtain miR-989 transgenic rice.
[0010] 4. Transgenic lines with high single-copy expression were obtained through PCR screening, qPCR expression level detection, and Southern blot copy number analysis.
[0011] 5. Single-copy transgenic rice lines (C#10, C#20, C#25, and C#2) were selected for indoor and field bioassays to analyze their insect resistance. Indoor bioassays showed that miR-989 transgenic rice significantly increased larval mortality and decreased egg production per female. Field bioassays showed that miR-989 transgenic rice significantly inhibited feeding damage to rice stem borer larvae.
[0012] 6. This invention selects the white-backed planthopper, a non-target insect in the same rice ecological niche as the rice stem borer, to evaluate the effects of miR-989 transgenic rice on non-target insects. It was found that after the white-backed planthopper feeds on miRNA transgenic rice, there are no significant changes in the degree of rice damage, the population size of the white-backed planthopper, the nymphal development period, the cumulative emergence rate, the adult lifespan, and the reproductive capacity of the long-winged planthopper, demonstrating a specific insect resistance effect against the target pest, the rice stem borer.
[0013] 7. The present invention also analyzed the agronomic traits of miR-989 transgenic rice. The results showed that the miR-989 transgenic line had no statistically significant differences from the wild type in key indicators such as plant height, panicle length and seed setting rate. The agronomic traits were stable and could be applied to insect-resistant breeding.
[0014] Specifically, the present invention provides a method for preventing and controlling rice stem borer, inhibiting ovarian development of rice stem borer, reducing egg production of rice stem borer and / or slowing down the development process of rice stem borer: overexpressing miRNA-989 in rice stem borer, wherein the sequence of miRNA-989 is: GUGUGAUGUGACGUAGUGGAAG (SEQ ID NO.1).
[0015] Furthermore, by overexpressing miRNA-989 in the rice stem borer, the deposition of vitellin in oocytes was reduced, resulting in delayed oocyte development, impaired ovarian development, significantly reduced egg production, and slowed development.
[0016] Specifically, miRNA-989 can be overexpressed in rice stem borers by transgenic technology or by injecting agomiR-989 or miRNA-989 mimics into the rice stem borer.
[0017] The present invention also provides a method for improving the resistance of rice to rice stem borer and / or for breeding rice resistant to rice stem borer transgenic rice: overexpressing miRNA-989 in rice to improve resistance to rice stem borer, wherein the sequence of miRNA-989 is: GUGUGAUGUGACGUAGUGGAAG (SEQ ID NO.1).
[0018] Furthermore, transgenic rice overexpressing miRNA-989 was prepared using transgenic methods.
[0019] Furthermore, the transgenic method includes constructing an overexpression vector, or designing and constructing an AmiR-989 expression vector based on the miR-989 sequence, cloning the miR-989 precursor into the expression vector, and then genetically transforming rice using an Agrobacterium-mediated transformation system.
[0020] Furthermore, the sequence of the miR-989 precursor is shown in SEQ ID NO.2, and the expression vector is the pC1300-Ubi-nos vector.
[0021] Furthermore, the carrier construction process is as follows:
[0022] Furthermore, the genetic transformation includes the following steps: callus induction, subculture, Agrobacterium infection, resistance screening, resistant callus regeneration, and rooting and hardening, ultimately obtaining transgenic insect-resistant rice.
[0023] This invention also provides the use of miRNA-989 in any of the following:
[0024] A1) Control of rice stem borer;
[0025] A2) Prepare products for controlling rice stem borers;
[0026] A3) Inhibits ovarian development in rice stem borer;
[0027] A4) Preparation of products that inhibit ovarian development in *Chilodonella divaricata*;
[0028] A5) Reduce the egg-laying rate of the rice stem borer;
[0029] A6) Prepare products that reduce the egg-laying rate of the rice stem borer;
[0030] A7) Reduces the development process of rice stem borer;
[0031] A8) Prepare products that reduce the development process of rice stem borer;
[0032] A9) Improve rice resistance to rice stem borer;
[0033] A10) Preparation of products to enhance rice resistance to rice stem borer;
[0034] A11) Breeding transgenic rice resistant to rice stem borer;
[0035] A12) Preparation and cultivation of transgenic rice products resistant to rice stem borer.
[0036] The sequence of miRNA-989 is: GUGUGAUGUGACGUAGUGGAAG (SEQ ID NO.1).
[0037] Beneficial Effects: This invention discovered that overexpression of miR-989 can delay the development of rice stem borer oocytes and inhibit ovarian development. Further, based on amiRNA technology, miR-989 was integrated into the rice genome, resulting in miR-989 rice lines through overexpression. These lines not only showed no statistically significant differences from the wild type in key indicators such as plant height, panicle length, and seed setting rate, exhibiting stable agronomic traits, but also showed specific resistance to the rice stem borer. Field bioassays demonstrated a significant inhibitory effect on feeding damage caused by rice stem borer larvae. Therefore, miR-989 can be applied to rice insect-resistant breeding. This invention increases available germplasm resources and provides an effective control strategy for green pest control in agriculture. Attached Figure Description
[0038] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0039] Figure 1 For small RNA genome screening, Figure A shows the number of known and novel miRNAs identified in different comparison groups, and Figure B is a volcano diagram showing the changes in miRNA expression in the fat body of female pupae on day 1 and day 5.
[0040] Figure 2 To validate the function of miR-989, Figure A shows the abnormal ovarian development in the agomiR-989 treatment group compared to agomiR-NC (control group); Figure B shows the significant increase in miR-989 expression level after agomiR-989 treatment; Figure C shows that miR-989 overexpression significantly inhibits Vg expression; and Figure D shows the number of oocytes per ovary in the agomiR-NC and agomiR-989 treatment groups.
[0041] Figure 3 To identify miR-989 in transgenic rice, Figure A shows the screening of positive T0 generation transgenic plants by PCR analysis; Figure B shows the integration of miR-989 in 15 transgenic lines detected by Southern blot hybridization; Figure C shows the relative transcription level of miR-989 in single-copy T0 generation transgenic rice detected by qPCR; Figure D shows the PCR analysis of single-copy T1 generation transgenic rice transgenic plants; and Figure E shows the relative expression levels of miR-989 and ITGA 10 days after feeding on transgenic and WT rice.
[0042] Figure 4The study included indoor and outdoor bioassays of the rice stem borer. Figure A shows the survival rate of the rice stem borer after 21 days of feeding on four miR-989 transgenic rice plants (C#10, C#20, C#25, and C#28). Figure B shows the phenotype of dead larvae after feeding on transgenic miR-989 rice and wild-type rice. Figure C compares the lifetime reproductive capacity of transgenic rice lines C#10, C#20, C#25, and C#28 with the control plants. Figure D shows the damage caused by the rice stem borer after 18 days of feeding on wild-type and transgenic lines. Figure E shows the local damage caused by the rice stem borer to transgenic rice. Figure F shows that no obvious tissue damage was observed in the transgenic stems compared to wild-type stems.
[0043] Figure 5 To assess the safety of miR-989 transgenic rice against non-target insects, Figure A compares the damage caused by white-backed planthoppers to transgenic miR-989 and wild-type rice; Figure B shows the survival rate of planthoppers feeding on transgenic lines; Figure C shows the developmental history of nymphs feeding on transgenic lines; Figure D shows the cumulative emergence rate of feeding on transgenic lines; Figure E shows the lifespan of adult planthoppers feeding on transgenic lines; and Figure F assesses the lifetime reproductive capacity of adult long-winged planthoppers feeding on transgenic lines.
[0044] Figure 6 For the evaluation of agronomic traits of miR-989 rice, Figure A shows the field growth of transgenic rice, Figure B shows the comparison of plant height phenotype between transgenic rice and wild type, Figure C shows the comparison of panicle length between transgenic rice and wild type, and Figures D and E show the data comparison between transgenic lines and wild type in five indicators: panicle length, plant height, number of tillers per plant, weight of 500 grains, and seed setting rate. Detailed Implementation
[0045] The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. Unless specifically stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Unless specifically stated, the reagents and materials used in the following embodiments are commercially available.
[0046] Example 1: Analysis of high-throughput sequencing results of small RNA genomes
[0047] Raw reads from small RNA sequencing were filtered using SOAPnuke 1.5.0 sRNA filter (parameters: -minSize=15, -polyA=0.7, -qualSys=2) to remove low-quality reads, reads without inserts, reads with 5' adapter contamination, reads without 3' adapter sequences, reads containing polyA sequences, and reads that were too short, resulting in clean reads. Bowtie software was used to align these clean reads with the *Stachys chinensis* reference genome (GCA_004000445.1_ASM400044v1) to determine the presence of contamination in the sequencing samples and to locate its genomic information, thus creating mapped reads. These were then compared with mature miRNAs in the miRBase (V22.0) database. Since miRBase did not contain miRNA information for *Stachys chinensis*, redundancy was removed from mature insect miRNA sequences; those completely identical were identified as *Stachys chinensis* known miRNAs. For miRNA read allocation in samples, miRNAs with more than 10 transcripts per kilobase of exon model per million mapped reads (TPM) were selected for subsequent analysis; the remaining mapped reads were classified as candidate novel miRNAs. In addition, reads originating from intergenomic regions or coding gene antisense strands were selected, and novel miRNAs were predicted using miRDeep2 software, followed by further filtering and analysis to obtain novel miRNAs.
[0048] Based on the high-throughput sequencing results, a total of 24,318,167 raw reads were obtained. After filtering out low-quality sequences, adapter sequences, poly A sequences, and sequences with fewer than 15 bases, 22,382,834 clean reads were obtained, accounting for 92.042% of the raw reads. The clean reads were first aligned with the *Taxobacterium tumefaciens* genome, matching 20,837,568 sequences (mapped reads). The mapped reads were then aligned with the Pfam database to remove non-coding RNAs such as rRNA, tRNA, sRNA, and snRNA, obtaining unannotated reads (Table 1), which were then used for small RNA identification analysis.
[0049] Table 1 Statistical summary of small RNA library sequencing data
[0050]
[0051] Based on miRNA copy number (Reads count) or expression level (TPM) analysis, a total of 317 known and 372 novel differentially expressed miRNAs were obtained from fat body samples at three time points. Further screening of differentially expressed miRNAs using DESeq2 software (parameters: |log2 foldchange| > 1 and padj < 0.05) revealed 30 significantly different miRNAs between the fat bodies of female pupae on day 1 and day 3 (FP1-PB vs. FP3-PB), including 15 known miRNAs and 15 novel miRNAs; 74 significantly different miRNAs between the fat bodies of female pupae on day 1 and day 5 (FP1-PB vs. FP5-PB), including 44 known miRNAs and 30 novel miRNAs; and 50 significantly different miRNAs between the fat bodies of female pupae on day 3 and day 5 (FP3-PB vs. FP5-PB), including 33 known miRNAs and 17 novel miRNAs. Figure 1 A).
[0052] Because the ovarian development changes most dramatically on days 1 and 5, with significant differences in vitellogenin (Vg) expression levels, the FP1-PB vs. FP5-PB group was selected for further analysis. This group contained 46 upregulated and 28 downregulated miRNAs (…). Figure 1 B). To screen for miRNAs related to oocyte development, nine miRNAs with a fold change greater than ≥ |3| were selected from 44 known miRNAs for further analysis. Based on the sequences of these nine miRNAs, corresponding miRNA inhibitors (antagomiR) and agonists (agomiR) were synthesized using conventional methods and injected into *Chilodonella esculenta* for phenotypic screening. It was found that miR-989 significantly affected ovarian development in *Chilodonella esculenta*.
[0053] Example 2: Acquisition and Functional Verification of miR-989
[0054] 1) Microinjection: Based on sequencing results, the miR-989 sequence was obtained as GUGUGAUGUGACGUAGUGGAAG (SEQ ID NO.1). The miR-989 agonist (agomiR-989) was further synthesized. AgomiR-989 underwent modification on the antisense strand, specifically a cholesterol modification at the 3' end, two thiocyanate modifications at the 5' end, and a full-chain methoxy modification at the 3' end. 750 nL (200 μM) of agomiR-989 was injected into the lymphatic fluid of the female pupa via the abdominal intersegmental membrane using a microinjector. Two injections were administered at different time points. The female pupa was injected once at 48 h, with a booster injection on day 4. Dissection and sampling were performed 48 h after both injections to analyze interference efficiency and observe the ovaries.
[0055] 2) Detection of mRNA and miRNA expression levels. The main steps are as follows:
[0056] A. Total RNA extraction. Fat body samples were collected from female pupae 48 h after two injections. The samples were homogenized using a homogenizer with steel balls and RNAisoPlus reagent. The homogenate was incubated at room temperature for 5 min; centrifuged at 12000 g at 4 ℃ for 5 min; the supernatant was transferred to a new enzyme-free centrifuge tube, 1 / 5 volume of chloroform was added, and the tube was inverted until the solution turned milky white. The tube was incubated at room temperature for 5 min, and then centrifuged at 12000 g at 4 ℃ for 15 min; the colorless supernatant was transferred to a new enzyme-free centrifuge tube, 0.5–1 volume of pre-chilled isopropanol was added, and the mixture was thoroughly mixed and incubated at -20 ℃ for 10–30 min; then centrifuged at 12000 g at 4 ℃ for 10 min; the supernatant was discarded, and pre-chilled 75% anhydrous ethanol was added. The tube was washed by inverting the tube and then centrifuged at 7500 g at 4 ℃ for 5 min; this step was repeated once; the supernatant was discarded, and the tube was opened to evaporate any remaining ethanol. Dissolve the precipitate in an appropriate amount of RNase-free water; place on ice for later use. Detect the concentration and A260 / A280 ratio using a spectrophotometer; analyze RNA integrity using agarose gel electrophoresis. Samples that pass the tests are placed on ice for subsequent experiments or stored at -80 °C.
[0057] B. cDNA Reverse Transcription and qPCR. cDNA was synthesized according to the instructions of a standard reverse transcription kit. First, the following system was prepared to remove genomic DNA: 2 μL of 5×gDNA Eraser Buffer, 1 μL of gDNA Eraser, and 1 μg of Total RNA were prepared, and RNase-free water was added to a final volume of 10 μL. The mixture was incubated at 42 °C for 2 min in a PCR instrument to remove genomic DNA. Then, 4 μL of 5×PrimeScript Buffer 2, 4 μL of RT Primer Mix, and 1 μL of PrimeScript RT Enzyme Mix I were added to the 10 μL reaction solution, and RNase-free water was added to a final volume of 20 μL. The PCR reaction was performed at 37 °C for 15 min and then at 85 °C for 5 s for reverse transcription. To ensure that the amplification efficiency of the target gene and the internal control gene was essentially the same, the amplification efficiency of each primer pair was first verified using a template gradient dilution method. qPCR was performed using Hieff® qPCR SYBR GreenMaster Mix. The specific operating steps are as follows: The total volume of the reaction system is 10 μL, containing 2 μL cDNA template, 0.5 μL (10 μM) upstream and downstream primers, 5 μL Hieff® qPCR SYBR Green Master Mix, and 2 μL RNase-free water. Three technical replicates are set up for each sample, with the EF1 gene as an internal control. Subsequently, the Ct method (2-ΔΔCt) is used for comparison. Ct The relative gene expression levels were calculated using a method (Livak and Schmittgen, 2001). The reaction program was as follows: pre-denaturation: 95 ºC: 5 min; three-step amplification: 95 ºC: 10 s; 60 ºC: 20 s; 72 ºC: 20 s, 40 cycles; melting curves were generated. When the amplification efficiency was between 90-110%, the relative gene expression levels between different treatments were detected.
[0058] C. miRNA reverse transcription and qPCR. The RNA was tagged with PolyA using the miDETECT A Track™ miRNA qRT-PCR Starter Kit. Reverse transcription was then performed using a primer with a specific sequence to generate the first strand of cDNA corresponding to the miRNA. Based on the mature miRNA, U was replaced with T. A miRNA-specific forward primer (primer sequence: GTGTGATGTGACGTAGTGGA) was designed according to the universal reverse primer Tm value in the kit and following general primer design principles. This primer was then used in a qPCR reaction with the Uni-Reverse Primer from the miDETECT A Track™ miRNA qPCR Kit. The specific steps are as follows: First, prepare a reaction system on ice containing 2 μg total RNA, 2 μL 5×Poly(A) Polymerase Buffer, 1 μL Poly(A) Polymerase, and RNase-free water to a final volume of 10 μL. Mix thoroughly and incubate briefly at 37 °C for 1 h. Then, add 4 μL RTase mix, 4 μL 5×RTase Buffer, and 2 μL miDETECTA Track™ Uni-RT-PCR Starter Kit to the 10 μL reaction system. The primer was placed in a PCR instrument and reacted at 42 °C for 1 h, followed by incubation at 72 °C for 10 min for reverse transcription to obtain cDNA. All cDNA was diluted 5× as a template, and 18 S rRNA was used as a miRNA internal reference gene. The qPCR reaction system was prepared as follows: 0.5 μL miRNA-specific forward primer, 0.5 μL miDETECT A Track™ Uni-Reverse Primer, 5 μL 2× SYBR Green Mix, 2 μL cDNA, and 2 μL RNase-free water. Pre-denaturation was performed in the qPCR instrument: 95 °C: 15 min; three-step amplification: 95 °C: 2 s; 60 °C: 20 s; 70 °C: 10 s, 40 cycles; melting curve was generated.
[0059] 3) Dissection and observation of ovarian development. The ovaries were dissected 48 hours after the two injections to observe the phenotype; at the same time, fat body samples were taken to detect the expression levels of miR-989 and the female reproductive indicator gene Vg.
[0060] The results are as follows Figure 2 As shown, miR-989 overexpression significantly reduced vitellin deposition in oocytes ( Figure 2A); Compared with the agomiR-NC control group, overexpression of miR-989 not only induced a significant increase in the expression of the corresponding miRNA ( Figure 2 B), and also downregulated Vg expression ( Figure 2 C). Furthermore, the number of oocytes in the ovary is significantly reduced ( Figure 2 (D) indicates that miR-989 overexpression leads to delayed oocyte development and impaired ovarian development.
[0061] Example 3: Construction and genetic transformation of miRNA expression plasmids
[0062] An AmiR-989 expression vector was designed and constructed based on the miR-989 sequence. Following the method of Warthmann et al. (2008), artificial pre-miR-989 was constructed using the rice osa-miR-528 precursor scaffold. BamHI (5') and KpnI (3') restriction sites were designed at both ends of the artificial miRNA precursor: GGATCCCAGCAGCAGCCACAGCAAAATTTGGTTTGGGATAGGTAGGTGTTATGTTAGGTCTGGTTTTTTGGCTGTAGCAGCAGCAGGTGTGATGTGACGTAGTGGAAGCAGGAGATTCAGTTTGAAGCTGGACTTCACTTTTGCCTCTCTCTTCCTCTAGGTCACATCACACTTCCTGCTGCTAGGCTGTTCTGTGGAAGTTTGCAGAGTTTATATTATGGGTTTAATCGTCCATGGCATCAGCATCAGCAGCGGTACC (SEQ ID NO.2). The entire sequence was synthesized by a synthetic company and assembled into the pC1300-Ubi-nos vector, thus forming the artificial miRNA expression vector. Based on the Agrobacterium transformation system established by Lin et al. (2002), genetic transformation experiments were carried out on the japonica rice variety ZH11. The core process was to obtain transformed and regenerated plants through callus induction, subculture, genetic transformation, resistance screening, and regeneration of resistant callus.
[0063] Example 4 Molecular identification of miRNA-transfected rice lines
[0064] 1) Positive detection and expression level analysis of miRNA-transfected rice plants
[0065] Approximately three weeks after the transgenic plants rooted, genomic DNA was extracted from individual rice leaves using the CTAB method. Positive transformants were identified by PCR detection of the hygromycin B phosphotransferase gene (hpt) using primers (hpt557-F, hpt557-R). Additionally, total RNA was extracted from fresh T0 and T1 generation rice leaves using Trizol reagent, and miRNA reverse transcription was performed. qPCR was then used to determine miRNA expression levels. The specific procedures are described in step C of Example 2.
[0066] The sequences of primers hpt557-F and hpt557-R are as follows:
[0067] hpt557-F:ACACTACATGGCGTGATTTCAT
[0068] hpt557-R:TCCACTATCGGCGAGTACTTCT
[0069] 2) Southern blot
[0070] To determine the copy number of transgenic plants, 10 μg of DNA was extracted from leaves of transgenic and wild-type rice at the tillering stage and digested with HindIII restriction endonuclease (TaKaRa) at 37 °C for 16 h. The digestion products were subjected to 0.8% agarose gel electrophoresis (30 V, 16 h) and then transferred to a nylon membrane via capillary blotting. Southern hybridization was performed at 48 °C using a digoxigenin (DIG)-labeled probe (hpt gene) according to the DIG-High Prime DNA labeling and DIG nucleic acid detection reagent instructions. Finally, the membrane was placed in a dark room and exposed to X-ray film at 80 °C for 4 h for development. The probe was:
[0071] hpt-F:ACACTACATGGCGTGATTTCAT
[0072] hpt-R: TCCACTATCGGCGAGTACTTCT
[0073] This invention yielded a total of 30 miR-989 transgenic T0 generation rice plants. PCR screening identified 27 positive lines (…). Figure 3 A). Similarly, Southern blot analysis was performed on 15 lines, and the results showed that 9 lines carried a single copy of amiR-989 (A). Figure 3 B). PCR further validated the positive strain ( Figure 3 D), qPCR determined the expression levels of 9 single-copy lines, among which lines C#10, C#20, C#25, and C#28 showed higher expression levels ( Figure 3C). Therefore, these strains were selected for subsequent bioassays.
[0074] Example 5 Bioassay of target insects and non-target insects
[0075] To assess the resistance of miRNA-transgenic rice to the rice stem borer, fresh stems from three rice lines expressing high levels of single-copy miRNAs were selected. Stem segments of approximately 8 cm were placed in 9 cm diameter petri dishes and sealed with breathable sealing film. Each dish was fed with 30 newly hatched larvae. Three biological replicates were established for each line. Fresh stem segments were replaced every 3 days until pupation. Larval survival rate and growth and development indicators, including larval stage, pupal weight, and lifetime reproductive capacity, were recorded. Larvae were collected after 10 days of feeding for qPCR analysis to determine the expression levels of miRNAs and target genes in the larvae. In the field trial, 25 newly hatched rice stem borer larvae were inoculated into four transgenic lines and four wild-type control lines, and fed continuously for 18 days. The extent of damage to the rice was checked every 2 days after inoculation, and the leaf sheaths were dissected to assess the extent of rice stem borer infestation.
[0076] To investigate the potential impact of miRNAs on non-target insects, bioassays were first performed on the white-backed planthopper (Sogatella furcifera, WBPH), which occupies the same rice ecological niche. After the rice entered the tillering stage, the plants were transplanted into culture bottles and inoculated with 20 newly hatched nymphs. Nymphal growth, development, and survival rates were recorded. Newly emerged male and female adults were paired 1:1 and placed on corresponding rice lines for mating. Observations and data were collected every 3 days, and the number of eggs laid by each female was tracked and recorded until death.
[0077] Based on molecular identification, strains C#10, C#20, C#25, and C#28 were selected to feed newly hatched larvae. It was found that after 21 days of feeding, the larval mortality rate was 56.7–72.2%, while the control group had a mortality rate of only 9.97%. Figure 4 A) indicates that the miR-989 transgenic rice exhibits high resistance to the rice stem borer. Observation of the dead larvae revealed that they were smaller in size ( Figure 4 B) indicates that its development process is slower. Meanwhile, by detecting the relative expression level of miR-989 in the body of the rice stem borer 10 days after feeding on transgenic and WT rice, a significant increase in its expression level was found. Figure 3 E). To further clarify the impact of miR-989-transgenic rice on the female reproduction of the rice stem borer, a very small number of larvae entered the adult stage. Statistical analysis of the oviposition rate of female adults revealed a significant decrease in oviposition (E). Figure 4C). These results all indicate that the miR-989 transgenic rice not only exhibits high resistance to the rice stem borer larvae but also affects the reproductive capacity of surviving adults, ultimately reducing the offspring population. In the greenhouse experiment, only one of the nine C#20, C#25, and C#28 rice lines died, while all three WT rice lines died. Specific symptoms were as follows: WT rice died due to heart rot, with obvious insect damage and severe stem infestation, while the transgenic rice only showed slight leaf sheath damage (…). Figure 4 DF).
[0078] This invention further evaluated the safety of miR-989 transgenic rice against the non-target insect, the white-backed planthopper. Damage symptoms were observed, and the planthopper survival rate, nymphal developmental duration, cumulative emergence rate, adult lifespan, and lifetime reproductive capacity of long-winged adults were analyzed. Figure 5 (AF), and found that none were affected. These results indicate that miRNA-mediated RNAi has high specificity for the target pest rice stem borer and minimal negative impact on non-target insects.
[0079] Example 6: Agronomic Trait Analysis of Rice Transformed with miRNA
[0080] Three lines of each miRNA-transfected rice plant were selected and field-grown with wild-type rice (WT) to assess differences in agronomic traits. From the booting stage to maturity, plant height, number of tillers per plant, panicle length, and seed setting rate were systematically measured. After harvest, the seeds were washed, dried, and weighed.
[0081] Compared with the wild type, the miR-989 transgenic rice showed no significant differences in five indicators: plant height, panicle length, number of tillers per plant, weight of 500 grains, and seed setting rate. Figure 6 (AH). The results indicate that the agronomic traits of miR-989 rice are stable.
[0082] In summary, this invention verifies the control effect of miR-989 on rice stem borer, as well as the safety and effectiveness of rice transgenic with miR-989, increases the available germplasm resources, and provides an effective control strategy for green control of agricultural pests.
[0083] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.
Claims
1. A method for controlling the rice stem borer, characterized in that, The rice stem borer was overexpressed with miRNA-989, the sequence of which is: GUGUGAUGUGACGUAGUGGAAG.
2. The method according to claim 1, characterized in that, By overexpressing miRNA-989 in rice borers, the deposition of vitellin in oocytes is reduced, resulting in delayed oocyte development, impaired ovarian development, significantly reduced egg production, and slowed development.
3. A method for improving rice resistance to rice stem borer, characterized in that, Overexpression of miRNA-989 in rice enhances resistance to rice stem borer. The sequence of miRNA-989 is: GUGUGAUGUGACGUAGUGGAAG.
4. The method according to claim 3, characterized in that, Transgenic rice expressing miRNA-989 was prepared using a transgenic method.
5. The method according to claim 4, characterized in that, Based on the sequence of miR-989, an AmiR-989 expression vector was designed and constructed. The miR-989 precursor was cloned into the expression vector, and rice was genetically transformed using an Agrobacterium-mediated transformation system.
6. The method according to claim 5, characterized in that, The sequence of the miR-989 precursor is shown in SEQ ID NO.2, and the expression vector is the pC1300-Ubi-nos vector.
7. The method according to claim 5, characterized in that, The genetic transformation includes the following steps: callus induction, subculture, Agrobacterium infection, resistance screening, resistant callus regeneration, and rooting and seedling hardening, ultimately obtaining transgenic insect-resistant rice.
8. Application of miRNA-989 in the control of rice stem borer, wherein the sequence of miRNA-989 is: GUGUGAUGUGACGUAGUGGAAG.
9. Application of miRNA-989 in the breeding of transgenic rice resistant to rice stem borer, wherein the sequence of miRNA-989 is: GUGUGAUGUGACGUAGUGGAAG.
10. The application of miRNA-989 in inhibiting ovarian development and / or reducing oviposition in rice stem borer, wherein the sequence of miRNA-989 is: GUGUGAUGUGACGUAGUGGAAG.
Citation Information
Patent Citations
MiRNA and application thereof in rice insecticidal improvement
CN116376913A
Methods for enhancing the efficacy of microrna mediated interference
WO2013055898A1