Composition and kit for detecting vibrio harveyi

Abstract

The invention relates to the technical field of microbiological detection, and particularly discloses a composition and a kit for detecting vibrio harveyi, the composition for detecting vibrio harveyi is composed of a primer pair and a probe, the primer pair is composed of two single-stranded DNAs shown in a sequence 1 and a sequence 2 in a sequence table; the probe is a single-stranded DNA probe as shown in a sequence 3 in the sequence table (5'end is marked with a fluorophore FAM, and 3 'end is marked with a quenching group MGB). The method is high in sensitivity, accurate in result, good in repeatability, easy to operate and suitable for the fields of aquaculture and the like, a quenching group of the MGB probe is a non-fluorescent quenching group and does not generate fluorescence, the intensity of a background signal can be greatly reduced, the detection result is more accurate, and the purpose of rapidly and accurately detecting vibrio harveyi is achieved.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial detection, in particular to a composition and a kit for detecting Vibrio harveyi. Background Art

[0002] Vibrio harveyi is a Gram-negative bacterium widely found in marine environments and a common pathogen in aquaculture. It can infect a variety of marine organisms, such as fish, shrimp, and shellfish, causing serious illness and significant economic losses. Traditional methods for detecting Vibrio harveyi include plate culture, colloidal gold immunochromatography, and conventional PCR. Fluorescence quantitative PCR, which identifies templates through specific hybridization of TaqMan probes with templates, offers high accuracy and low pseudospecificity. Furthermore, the MGB quencher used in the probe is non-fluorescent and does not produce fluorescence. This significantly reduces background signal intensity, making detection more accurate and achieving rapid and accurate detection of Vibrio harveyi. The intensity of the fluorescent signal represents the copy number of the template DNA. There is a linear relationship between the logarithm of the initial concentration of the sample DNA and the critical cycle (Ct) value. By comparing the Ct value of the amplification reaction and analyzing the initial concentration of the reaction template, the purpose of accurately quantifying the amplification product can be achieved. However, the plate culture method has the disadvantage of a long time, and the colloidal gold immunochromatography method and the ordinary PCR method have the disadvantages of low sensitivity and inability to quantify. Therefore, a composition and a kit for detecting Vibrio harveyi are provided. Summary of the Invention

[0003] The purpose of the present invention is to address the defects of the prior art and provide a composition and a kit for detecting Vibrio harveyi to solve the problems raised by the above background technology.

[0004] To achieve the above-mentioned object, the present invention provides the following technical solution: a composition for detecting Vibrio harveyi, comprising a primer pair and a probe, wherein the primer pair comprises primer 1 and primer 2, wherein primer 1 is a single-stranded DNA shown in sequence 1 in the sequence listing, and primer 2 is a single-stranded DNA shown in sequence 2 in the sequence listing; and the probe is a single-stranded DNA probe shown in sequence 3 in the sequence listing.

[0005] As a preferred technical solution of the present invention, the 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.

[0006] As a preferred technical solution of the present invention, the fluorescent group is FAM; the quenching group is MGB.

[0007] A kit for detecting Vibrio harveyi comprises a Vibrio harveyi plasmid standard and the above-mentioned composition.

[0008] The real-time fluorescence quantitative PCR detection method for Vibrio harveyi employs the above-mentioned composition or the above-mentioned kit for detection, and the specific steps are as follows:

[0009] Step 1: Prepare a 20 μL reaction system with the following contents: 10 μL Detection U+Probes Master Mix, 1 μL upstream and downstream primers (10 μmol / L), 0.4 μL fluorescently labeled probe (10 μmol / L), and 2.6 μL deionized water.

[0010] Step 2: Add 5 μL of extracted DNA template to the prepared reagent;

[0011] Step 3: After thorough mixing, centrifuge briefly and place on a fluorescent quantitative PCR instrument for reaction;

[0012] Step 4: Set up the program on the fluorescence quantitative PCR instrument. The specific program is: 95°C for 1 min; 95°C for 10 s, 60°C for 60 s, 40 cycles;

[0013] Step 5: After the reaction is completed, use software to analyze and judge the results.

[0014] Compared with the existing technology, the beneficial effects of the present invention are as follows: the present invention uses the conserved Vibrio harveyi toxR gene published in the GenBank database as the target gene, designs specific primers and TaqMan-MGB probes, constructs a standard curve by preparing recombinant plasmid PUC19-toxR as a standard, optimizes primer and probe concentrations and various reaction parameters, and simultaneously tests the sensitivity and repeatability of the method. For the first time, an accurate, convenient and fast TaqMan real-time fluorescence quantitative PCR detection method for Vibrio harveyi is established, providing technical support for large-scale sample detection and scientific research.

[0015] The present invention has high sensitivity, accurate results, good repeatability, simple operation and is easily applicable to fields such as aquaculture. The quenching group of the MGB probe adopts a non-fluorescent quenching group, which does not produce fluorescence itself, and can greatly reduce the intensity of the background signal, making the detection results more accurate and achieving the purpose of rapid and accurate detection of Vibrio harveyi. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 is the amplification curve diagram of different probe concentrations of the present invention;

[0017] Figure 2 is the amplification curve diagram of different primer concentrations of the present invention;

[0018] Figure 3 The amplification curve and standard curve of the fluorescent quantitative PCR of the present invention are shown;

[0019] Figure 4 This is a sensitivity diagram of PCR amplification detection of standard plasmids with different dilutions of the present invention;

[0020] Figure 5 This is a sensitivity detection amplification curve diagram of an embodiment of the present invention. DETAILED DESCRIPTION

[0021] The preferred embodiments of the present invention are described in detail below with reference to the accompanying drawings so that the advantages and features of the present invention can be more easily understood by those skilled in the art, thereby making a clearer and more precise definition of the protection scope of the present invention.

[0022] Example: A composition for detecting Vibrio harveyi, consisting of a primer pair and a probe, the primer pair consisting of primer 1 and primer 2, the primer 1 is the single-stranded DNA shown in sequence 1 in the sequence listing, and the primer 2 is the single-stranded DNA shown in sequence 2 in the sequence listing; the probe is the single-stranded DNA probe shown in sequence 3 in the sequence listing.

[0023] The 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quencher group; the fluorescent group is FAM; and the quencher group is MGB.

[0024] A kit for detecting Vibrio harveyi comprises a Vibrio harveyi plasmid standard and the above-mentioned composition.

[0025] The real-time fluorescence quantitative PCR detection method for Vibrio harveyi employs the above-mentioned composition or the above-mentioned kit for detection, and the specific steps are as follows:

[0026] Step 1: Prepare a 20 μL reaction system with the following contents: 10 μL DetectionU+Probes Master Mix, 1 μL upstream primer and downstream primer (10 μmol / L), 0.4 μL fluorescently labeled probe (10 μmol / L), and 2.6 μL deionized water.

[0027] Step 2: Add 5 μL of extracted DNA template to the prepared reagent;

[0028] Step 3: After thorough mixing, centrifuge briefly and place on a fluorescent quantitative PCR instrument for reaction;

[0029] Step 4: Set up the program on the fluorescence quantitative PCR instrument. The specific program is: 95°C for 1 min; 95°C for 10 s, 60°C for 60 s, 40 cycles;

[0030] Step 5: After the reaction is completed, use software to analyze and judge the results.

[0031] Establishment and application of real-time fluorescence quantitative PCR detection method for Vibrio harveyi

[0032] 1. Materials and Methods

[0033] 1.1. Design of primers and probes

[0034] Primers and probes were designed based on the conserved toxR gene sequence of Vibrio harveyi in the GenBank database (Table 1). The expected amplified fragment length was 117 bp (sequence 4). The probe had a 5'-end fluorescent group of FAM and a 3'-end fluorescent quencher of MGB, and was synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0035] Table 1: Primers and probes for fluorescent quantitative PCR amplification

[0036] name Gene sequence (5'-3') SEQ ID NO: Upstream primer (primer 1) AGACTCTACGAAGTCGCCTGA 1 Downstream primer (primer 2) ACGTTCAACTGAACAAATCAGT 2 probe GTAACCGCGCTTTGG 3

[0037] 1.2 Preparation of plasmid standards

[0038] The target gene sequence was cloned into the PUC19 vector by gene synthesis and transformed into E. coli. The bacterial solution containing the positive recombinant plasmid was sent for sequencing. The recombinant plasmid with correct sequencing was extracted and the concentration was determined by ND2000. The copy number was calculated according to the formula: [6.02×10 23 ×(ng / L×10 -9 )] / (DNA length × 660), and the number of copies per microliter of plasmid was calculated. This positive plasmid was used as the VH standard plasmid PUC19-toxR.

[0039] 1.3. Optimization of reaction conditions

[0040] 1.3.1 Probe concentration

[0041] The primer concentration was fixed at 500 nM, and the probe concentrations were 100, 150, 200, 250, and 300 nM, respectively. Three wells were prepared in parallel for each concentration. The optimal probe working concentration was selected based on the cycle number (Cycle threshold value, Ct value) of the amplification reaction and the fluorescence intensity of the amplification curve.

[0042] 1.3.2 Primer concentration

[0043] The optimal concentration of the fixed probe was 200 nM, and the primer concentrations were 100, 200, 300, 400, 500, and 600 nM. Three wells were prepared in parallel for each concentration, and the optimal primer working concentration was selected based on the Ct value of the amplification reaction and the fluorescence intensity of the amplification curve.

[0044] 1.4. Establishment of standard curve

[0045] The VH standard plasmid PUC19-toxR was diluted 10×, and 2.63×10 7 -2.63×10 3 Quantitative PCR was performed using plasmids with a total of 5 concentration gradients of copies / μL as templates. The reaction was carried out according to the above-mentioned optimized system, and 3 parallel wells were prepared at the same time.

[0046] 1.5 Sensitivity testing

[0047] Take 2.63×10 8 -2.63×10 0 Quantitative PCR was performed using VH standard plasmids with a total concentration gradient of 10 copies / μL as templates to determine the detection limit and analyze its sensitivity.

[0048] 1.6 Repeatability test

[0049] The probes and primers were used in the fluorescence quantitative PCR reaction system at the optimized concentrations. The VH standard plasmid PUC19-toxR (2.63×10 7 -2.63×10 4 Reproducibility was tested using 100 copies / μL of plasmid as a template. Within-group variability was analyzed using six replicate wells for each standard plasmid dilution in the same PCR reaction. Six independent replicates were performed using the same conditions to analyze intergroup variability and calculate the coefficient of variation (CV), where CV = standard deviation (SD) / mean.

[0050] 1.7 Reaction system and parameters

[0051] Quantitative PCR reaction system (20 μL): 10 μL FastStart Essential DNA Probes Master, 0.4 μL upstream and downstream primers (10 μmol / L), 0.2 μL fluorescently labeled probe (10 μmol / L), 5 μL DNA template, and deionized water for equilibration. Amplification program: 95°C for 2 min; 95°C for 10 s, 60°C for 60 s, 45 cycles.

[0052] 1.8. Testing of actual samples

[0053] The Vibrio harveyi preservation solution was used to extract Vibrio harveyi DNA, and the DNA was detected using the above-established probe fluorescence quantitative PCR method, and the test results were analyzed.

[0054] 2. Experimental Results

[0055] 2.1 Preparation of plasmid standards

[0056] The target gene sequence was cloned into the PUC19 vector by gene synthesis and transformed into E. coli. The bacterial solution containing the positive recombinant plasmid was sent for sequencing. The recombinant plasmid with correct sequencing was extracted and the concentration was determined by ND2000. The copy number was calculated according to the formula: [6.02×10 23 ×(ng / L×10 -9 )] / (DNA length × 660), and the number of copies per microliter of plasmid was calculated. This positive plasmid was used as the VH standard plasmid PUC19-toxR.

[0057] The structure of the standard plasmid PUC19-toxR is described as follows: a recombinant plasmid obtained by connecting the DNA fragment in the sequence list to the PUC19 vector.

[0058] 2.2. Optimization of reaction conditions

[0059] 2.2.1. Probe concentration optimization

[0060] The Ct values ​​of the five probe concentrations differed slightly. In comparison, when the probe concentration was 200 nmol / L, the average Ct value (25.32) was the smallest and the fluorescence intensity was higher. Therefore, 200 nmol / L was selected as the working concentration of the probe ( Figure 1 ).

[0061] 2.2.2. Primer concentration optimization

[0062] The Ct values ​​of the six primer concentrations were relatively small. In comparison, the average Ct values ​​of 500 nmol / L and 600 nmol / L were lower (25.42 and 25.34, respectively). However, the results of repeated experiments showed that 500 nmol / L was the most stable, so 500 nmol / L was selected as the working concentration of the primers ( Figure 2 ).

[0063] 2.3. Drawing of the standard curve

[0064] Take 2.63×10 7 -2.63×10 3 The plasmids with 5 concentration gradients of 10 copies / μL were used as templates for fluorescence quantitative PCR. Three wells were tested in parallel for each concentration to obtain the amplification curve and standard curve ( Figure 3 and Figure 4 The logarithm of the starting template concentration and the Ct value showed a linear relationship, y = -3.6813x + 40.377, the amplification efficiency was 108%, and the correlation coefficient R 2 is 0.9999.

[0065] 2.4 Sensitivity testing

[0066] Quantitative PCR was performed using a 10-fold diluted standard plasmid PUC19-toxR as a template, a primer concentration of 500 nmol / L, and a probe concentration of 200 nmol / L to obtain an amplification curve ( Figure 5 ), when the template concentration is 2.63×10 1 The Ct value at 37.33 was 35.49, which was the lowest detection concentration. The results of repeated experiments remained stable.

[0067] 2.5 Repeatability test

[0068] 2.63×10 7 -2.63×10 4 The repeatability test was performed on the last shift of the standard plasmid with 4 copies / μL concentration. As shown in the result table, the coefficient of variation of the repeatability within and between groups of the standard plasmid at each concentration was less than 1%, indicating that the repeatability of this method was good.

[0069] Table 2: Repeatability experimental results of fluorescence quantitative PCR

[0070]

[0071]

[0072] Sequence 1: AGACTCTACGAAGTCGCCTGA

[0073] Sequence 2: ACGTTCAACTGAACAAATCAGT

[0074] Sequence 3: GTAACCGCGCTTTGG

[0075] Sequence 4:

[0076] AGACTCTACGAAGTCGCCTGAATTTGTAAAAACGGTGCCAAAGCGCGGTTACCAACTGATTTGTTCAGTTGAACGT

[0077] The above embodiments merely illustrate the implementation methods of the present invention. Although the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that a person skilled in the art may make various modifications and improvements without departing from the scope of the present invention, and these modifications and improvements fall within the scope of protection of the present invention.

Claims

1. A composition for detecting Vibrio harveyi, comprising a primer pair and a probe, characterized in that: The primer pair consists of primer 1 and primer 2, wherein primer 1 is the single-stranded DNA shown in sequence 1 in the sequence list, and primer 2 is the single-stranded DNA shown in sequence 2 in the sequence list; the probe is the single-stranded DNA probe shown in sequence 3 in the sequence list.

2. The composition for detecting Vibrio harveyi according to claim 1, characterized in that: The 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.

3. The composition for detecting Vibrio harveyi according to claim 2, characterized in that: The fluorescent group is FAM; the quenching group is MGB.

4. A kit for detecting Vibrio harveyi, characterized in that: The invention comprises a Vibrio harveyi plasmid standard and the composition according to any one of claims 1 to 3.

5. A real-time fluorescence quantitative PCR detection method for Vibrio harveyi, characterized by: The specific steps for detection using the composition according to any one of claims 1 to 3 or the kit according to claim 4 are as follows: Step 1: Prepare a 20 μL reaction system with the following contents: 10 μL Detection U+Probes Master Mix, 1 μL upstream and downstream primers (10 μmol / L), 0.4 μL fluorescently labeled probe (10 μmol / L), and 2.6 μL deionized water. Step 2: Add 5 μL of extracted DNA template to the prepared reagent; Step 3: After thorough mixing, centrifuge briefly and place on a fluorescent quantitative PCR instrument for reaction; Step 4: Set up the program on the fluorescence quantitative PCR instrument. The specific program is: 95°C for 1 min; 95°C for 10 s, 60°C for 60 s, 40 cycles; Step 5: After the reaction is completed, use software to analyze and judge the results.

Images