InDel marker linked with characters of high-quality sweet-waxy corn kernels and application of InDel marker

Abstract

The invention discloses an InDel marker linked with characters of high-quality sweet-waxy corn kernels and application of the InDel marker, self-bred high-quality sweet-waxy corn kernels are selected to be hybridized with a conventional waxy corn inbred line, and molecular markers (primer pair sequences are as shown in SEQ ID No.1 and SEQ ID No.2) closely linked with target characters are utilized to perform rapid offspring screening, so that the breeding efficiency is remarkably improved. According to the method, the breeding period can be shortened, the breeding cost can be reduced, genetic resources of the sweet-waxy fused corn can be effectively widened, and technical support is provided for cultivation of novel sweet-waxy corn varieties.

Description

Technical Field

[0001] The present invention relates to molecular marker-assisted corn breeding, and in particular to an InDel marker linked to a high-quality sweet and glutinous grain trait of corn and an application thereof. Background Art

[0002] Fresh corn primarily falls into three categories: sweet corn, sticky corn, and sweet-sticky corn. Sweet-sticky corn, which combines the sweet and crisp texture of sweet corn with the soft, sticky texture of sticky corn, has become a popular choice and is widely considered a key type of high-quality fresh corn. However, the majority of sweet-sticky corn varieties currently marketed are mixed sweet-sticky varieties, containing both sweet and sticky kernels.

[0003] From the perspective of genetics, the sweetness of corn (such as sh1 、 sh2 and other recessive genes) and waxy traits (controlled by wx Both traits (e.g., sweetness and glutinousness) are recessively inherited, and the sweetness gene has an epistatic effect on the waxy quality gene. Therefore, when an inbred line carrying both sweet and glutinous recessive genes is crossed with a waxy inbred line, the F1 cob produces only two types of kernels, sweet and glutinous, distributed randomly. A typical sweet-glutinous corn variety typically has a sweet-to-glutinous kernel ratio of 1:3. According to probability theory, consumers need to consume at least 17 kernels per bite to have a 99% probability of tasting at least one sweet kernel. This uneven distribution makes it difficult to maintain a consistent eating quality in sweet-glutinous corn, impacting the consumer experience. Furthermore, due to differences in the accumulation and dehydration rates of sweet and glutinous kernels, sweet-glutinous corn often exhibits poor appearance after quick freezing, further limiting its market value. Therefore, breeding a blended sweet-glutinous corn variety in which all kernels exhibit both sweet and glutinous characteristics has become a key goal in fresh corn breeding.

[0004] During our research on fresh corn breeding, our project team unexpectedly discovered a stably inherited hybrid sweet-waxy corn germplasm from a waxy corn inbred line. The kernels of this germplasm exhibit a unique sweet-waxy texture when freshly picked, and upon maturity, they possess both the waxy endosperm characteristics of waxy corn and the wrinkled phenotype of sweet corn. This discovery provides key germplasm resources and technical possibilities for developing new hybrid sweet-waxy corn varieties with uniform sweetness and stickiness throughout the entire ear. However, effective molecular markers for their identification are currently lacking. Summary of the Invention

[0005] In response to the defects of the above-mentioned existing sweet and sticky mixed-grain corn varieties, such as unstable taste quality and poor processing appearance, the present invention provides an InDel molecular marker that is closely linked to the traits of the fusion sweet and sticky corn, which is used for molecular marker-assisted selection breeding to quickly breed a new fusion sweet and sticky corn variety with uniform sweetness and stickiness throughout the entire ear.

[0006] In order to achieve the above object, the technical solution of the present invention is as follows: The present invention is based on the unexpected discovery of a stable hereditary fusion sweet glutinous corn mutant germplasm w106 from the glutinous corn inbred line. wx After gene polymerization, the sweet grains showed a 3:1 separation phenomenon. This germplasm can achieve both glutinous and sweet taste in the same grain. Its amylopectin accounts for 96.2% of the total starch and the soluble sugar content is 10.8%.

[0007] Using the F2 grains obtained by hybridizing the fusion sweet and sticky maize mutant germplasm w106 with the waxy maize inbred line B1 and then self-pollinating, waxy wild-type and fusion sweet and sticky maize grains were selected from the F2 grains. The candidate interval was preliminarily located on chromosome 10 using the Bulked Segregant Analysis (BSA) method. The physical length of the located interval is 22.60 Mb.

[0008] InDel primers were designed by genome resequencing, and molecular markers at both ends of the mapping interval were used to screen exchange kernels.

[0009] Develop new molecular markers in the initial mapping interval and use the markers to genotype exchange kernels and their self-pollinated progeny; By integrating phenotypic and genotypic data from exchanged plants and their offspring, the mapping interval was narrowed. Comparative analysis determined that the InDel molecular marker closely linked to the trait, which could be used for identification, originated from the L-9 marker locus. Based on this, the present invention developed an InDel marker primer set for molecular marker-assisted breeding, enabling efficient screening of fusion sweet and sticky corn germplasm and significantly improving breeding efficiency.

[0010] An application of the molecular marker tightly linked to the high-quality sweet and glutinous grains is at least one of a) to c); a) preparing a reagent or kit for identifying sweet-glutinous fusion grains; b) Used to identify sweet and glutinous fusion grains; c) Used for the breeding of sweet and sticky fusion grain varieties.

[0011] On the basis of the above scheme, the molecular marker for identifying the fusion sweet and sticky corn germplasm is the primer pair L-9.

[0012] Based on the above scheme, the primer pair for detecting the L-9 molecular marker is shown as SEQ ID No.1 and SEQ ID No.2.

[0013] On the basis of the above scheme, when used to identify fusion sweet and sticky corn germplasm, the genomic DNA of the corn to be tested is used as a template, and the primer pair shown in SEQ ID No.1 and SEQ ID No.2 is used for PCR amplification, and the amplified product is detected; When the amplified product is a single band of 219 bp, the corn sample to be tested is a fusion sweet and sticky corn germplasm; When the amplified product is a single band of 258 bp, the corn sample to be tested is a non-fusion sweet and glutinous corn germplasm; When the amplified products are two bands of 258 bp and 219 bp, the corn sample to be tested is a heterozygous fusion sweet and sticky corn germplasm.

[0014] On the basis of the above scheme, the method for breeding fusion sweet and sticky corn is to use L-9 molecular markers to identify or screen fusion sweet and sticky corn germplasm during the breeding process.

[0015] Through the above technical solution, the present invention achieves the following beneficial effects: 1. The present invention preferably uses the L-9 primer set for PCR detection. Specifically, a PCR reaction system is constructed using the DNA of the corn line to be tested as a template, and simultaneous amplification is performed using the w106 inbred line as a control. After agarose gel electrophoresis analysis, if the amplified product of the test sample shows the same characteristic band as that of w106, the corn line is determined to have the high-quality sweet and glutinous grain trait.

[0016] 2. The present invention provides an InDel molecular marker tightly linked to the high-quality sweet and glutinous grain trait of maize and its application. This marker has the following advantages: (1) It can achieve early selection at the seed or seedling stage, significantly improving breeding efficiency; (2) Genotyping can be completed based on agarose gel electrophoresis, without the need for enzyme digestion, sequencing, or chip analysis, which is simple and low-cost; (3) It co-segregates with the target trait and has good genetic stability; (4) It lays the foundation for subsequent cloning and functional research of related genes. The application of this marker can effectively shorten the breeding cycle and reduce breeding costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the phenotypic identification and nutritional composition analysis of sweet and glutinous kernel mutants. (A) shows the ear phenotypes of the waxy maize inbred line B1 and the w106 mutant. (B) shows the comparison of the soluble sugar and amylopectin content as a percentage of total starch in mature kernels of the wild type and w106. Figure 2Fine mapping of the w106 candidate gene. (A) The gene controlling the w106 mutant phenotype was initially located on a 22.60 Mb region on chromosome 10 using group segregation analysis (BSA). (B) The identification of some of the developed polymorphic markers. (C) The further fine mapping was performed using 3126 F2 kernels. Figure 3 This is the agarose gel electrophoresis result of corn variety genotype identification using marker L-9 in Example 2 of the present invention; Figure 4 3 is a schematic diagram of the process of implementing molecular marker-assisted selection breeding using marker L-9 in Example 3 of the present invention. DETAILED DESCRIPTION

[0018] The following is a detailed description of the specific embodiments of the present invention in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention and are not intended to limit the present invention.

[0019] The high-quality sweet and glutinous grain w106, glutinous corn inbred line B1 and its mapping population involved in the following examples are all preserved by the Corn Genetics and Breeding Group of the Agricultural College of Yangzhou University.

[0020] Example 1 Determination of the Location Interval of High-Quality Sweet and Glutinous Corn Kernels and Development and Screening of Molecular Markers The F2 grains obtained by hybridizing the mutant inbred line w106 with the waxy corn inbred line B1 and then self-pollinating were selected to select waxy wild-type and w106-type grains (such as Figure 1 As shown), the gene controlling the phenotype of the w106 mutant was located using group segregation analysis (BSA), and the target gene was preliminarily located on chromosome 10. The physical length of the positioning interval was 22.60 Mb. In order to verify the accuracy of the group segregation analysis positioning results, 10 pairs of relatively evenly distributed polymorphic molecular markers that were completely linked or partially linked to the target gene were selected on maize chromosome 10 and their physical positions were calculated. 500 F2 grain DNAs were extracted, and the 10 pairs of molecular markers selected were used to perform PCR amplification of the above DNAs in a single sample. The positioning interval of the target gene was determined to be between the M4-M5 molecular markers on chromosome 10 (as shown). Figure 2 shown), with a physical distance of 18.66 Mb.

[0021] In order to further determine the specific physical location of the target gene, four pairs of molecular markers were added on the basis of the original markers. The number of F2 wild-type and w106 corn kernels increased to 3126, and the positioning interval was again compressed to between M11 and M14.

[0022] Example 2 Development of molecular markers tightly linked to high-quality sweet and sticky corn kernels The nucleic acid sequences of the primers for the molecular marker L-9, which is tightly linked to high-quality sweet and glutinous corn kernels, are shown as L-9-F (SEQ ID No. 1) and L-9-R (SEQ ID No. 2).

[0023] L-9-F: 5'-TCCTCGTCTGTTTCCAACCG-3'; L-9-R: 5'-ACCTGTCCCGTTTCAATCCC-3'.

[0024] Using maize genomic DNA as a template and L-9 molecular markers for PCR amplification, if the amplified product is a single band of 219 bp (SEQ ID No. 3) after agarose electrophoresis, the maize sample to be tested is a fusion sweet-waxy maize germplasm. If the amplified product is two bands of 258 bp (SEQ ID No. 4) and 219 bp (SEQ ID No. 3), the corn sample to be tested is a heterozygous fusion sweet and sticky corn germplasm; if the amplified product is a single band of 258 bp (SEQ ID No. 4), the corn sample to be tested is a non-fusion sweet and sticky corn germplasm.

[0025] SEQ ID No.3 (5'-3'): TCCTCGTCTGTTTCCAACCGCAAAAATATGCACCTACATCAATGCATCCGTCCAATTGTCTTTATTCCATTTCATTTCAAGCCCATCATCCACTTTCTCAGATGCATACGACTCCCGCGGCCCCGGCCTCCGGTGCATAAATTGTGTTAGGCCCGCCTGCCTGTTTCAGAAGAAAAAAATATCGGCACCGCGTCCTGTAGGGATTGAAACGGGACAGGT; SEQ ID No.4 (5'-3'): TCCTCGTCTGTTTCCAACCGCAAAAATATGCACCTACATCAATGCATCCGTCCAATTGTCTTTATTCCATTTCATTTCAAGCCCATCATCCACTTTCTCAGATGCATACGACTCCCGCGGCCCCGGCCT CCGGTGCATAAATTGTGTTAGGCCCGCCAATGGCCCACCATCCTCCCTCGTTTCCTGGCTGCCCGCCTGCCTGTTTCAGAAGAAAAAAATATCGGCACCGCGTCCTGTAGGGATTGAAACGGGACAGGT.

[0026] Example 3: Breeding high-quality sweet and sticky corn kernel lines using molecular marker L-9 In order to cultivate a variety with high-quality sweet and glutinous grains of corn, this protocol used the mutant inbred line w106 in Example 1 and several glutinous inbred lines such as B1 to conduct continuous self-pollination, and used molecular marker-assisted selection (MAS) to screen out superior individual plants carrying high-quality sweet and glutinous grains of corn. Figure 3 Starting from the hybrid F2, the InDel marker L-9, which is closely linked to the high-quality sweet and glutinous grain of corn, was used for polymerase chain reaction amplification and gel electrophoresis detection. Individual plants with the w106 homozygous genotype were selected and self-pollinated for more than 4 times. Based on the field agronomic traits and molecular markers, the selected plants were confirmed to carry the w106 homozygous genotype (such as Figure 4 The selected lines were planted in plots for comprehensive trait evaluation, resulting in five high-quality sweet and glutinous corn kernels. These kernels maintained their size, darkened in color, and contained reduced endosperm storage materials. Lines were selected for their amylopectin content of ≥96% of total starch and soluble sugar content of ≥10%, exhibiting the characteristics of a blend of sweet and glutinous kernels. The marker screening method provided by this invention can effectively improve breeding efficiency and accelerate the breeding process.

[0027] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

[0028] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0029] In addition, the various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. An InDel molecular marker L-9 tightly linked to high-quality sweet and glutinous corn kernels, characterized by: The primer pair sequences of the molecular marker are shown in SEQ ID No. 1 and SEQ ID No.

2.

2. A kit for detecting high-quality sweet and glutinous corn kernels, characterized in that: A primer pair comprising the InDel molecular marker according to claim 1.

3. Use of the InDel molecular marker L-9 according to claim 1 in any of the following: a) preparing a reagent or kit for identifying sweet-glutinous fusion corn kernels; b) Identify whether corn germplasm or kernels are sweet-glutinous fusion types; c) Assist in the breeding of fusion corn varieties with uniform sweetness and stickiness throughout the entire ear.

4. A molecular identification method for fusion sweet and sticky corn germplasm, characterized in that: The following steps are involved: (1) Extracting genomic DNA from the corn sample to be tested; (2) performing PCR amplification using the primer pair described in claim 1; (3) Detect the amplified product by electrophoresis: If a single band of 219 bp appears, the corn sample to be tested is determined to be a homozygous fusion sweet and sticky corn germplasm; If a single band of 258 bp appears, the corn sample to be tested is determined to be a non-fusion sweet and sticky corn germplasm; If the 258bp and 219bp bands appear at the same time, the corn sample to be tested is determined to be a heterozygous fusion sweet and sticky corn germplasm.

5. A method for molecular marker-assisted breeding of fusion sweet and sticky corn varieties, characterized in that: The following steps are involved: (1) Constructing a hybrid population of target parents; (2) In the F2 generation and above, screening for individual plants carrying a homozygous fusion genotype using the method of claim 4; (3) Combined with agronomic trait evaluation, stable varieties with both sweet and sticky phenotypes and excellent agronomic traits were obtained.

6. The method according to claim 5, characterized in that The kernels of the fusion sweet and sticky corn variety simultaneously meet the following requirements: the content of amylopectin in the total starch is ≥96%, and the content of soluble sugar is ≥10%.

Images