Bacillus velezensis as well as liquid fungicide, solid fungicide and application thereof

Through liquid and solid inoculants of Bacillus Velez, the harm of heavy metal pollution and salinization to plants is solved, plant growth is promoted, and nutritional elements and safety are improved, thus achieving healthy growth in a polluted environment.

CN120665757APending Publication Date: 2025-09-19CHENGDU TEPU BIOTECH CO LTD +1
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510807507.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-17
Publication Date
2025-09-19

AI Technical Summary

Technical Problem

Heavy metal pollution and soil salinization pose serious risks to plant growth and soil quality, and existing technologies lack effective biological solutions.

Method used

Bacillus Velez and its liquid and solid microbial agents are used for fermentation and culture and mixed with chitosan to prepare a microbial preparation that can help plants resist heavy metal and salinization stress.

Benefits of technology

Promote plant growth under heavy metal pollution and salinization conditions, increase plant nutrients and nutrient content, reduce heavy metal absorption, enhance plant resistance and growth, and improve plant safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005453141060000101
    Figure BDA0005453141060000101
  • Figure BDA0005453141060000102
    Figure BDA0005453141060000102
  • Figure BDA0005453141060000111
    Figure BDA0005453141060000111
Patent Text Reader

Abstract

The invention provides bacillus velezensis as well as a liquid microbial agent, a solid microbial agent and application thereof, and belongs to the technical field of microbial agents. The bacillus velezensis is bacillus velezensis TP-06-01, and the preservation number of the bacillus velezensis is CCTCC (China Center For Type Culture Collection) NO: M2025693. The liquid fungicide or the solid fungicide obtained by utilizing the bacillus velezensis can promote plants to resist the harm of heavy metals and / or salinization, and can also improve the nutrient elements and / or nutritional ingredients of the plants. In addition, under the heavy metal pollution condition or the salinization condition, the liquid fungicide or the solid fungicide can promote plant growth.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of microbial agents, and in particular relates to a Bacillus velezensis and a liquid agent, a solid agent and applications thereof. Background Art

[0002] Currently, due to the development of industrialization, heavy metal pollution caused by activities such as the discharge of industrial wastewater and exhaust gas, transportation, and the misuse of fertilizers has become a very common source of pollution in the environment. At the same time, due to the non-degradability, persistence, and potential of heavy metals, the discharged heavy metals can continue to accumulate in the soil. Therefore, heavy metal pollution is one of the most widespread and serious environmental problems today. The heavy metals involved in soil pollution are mainly mercury, cadmium, lead, chromium, and arsenic, which are highly biotoxic. When the heavy metal content in the soil accumulates to a certain level, it will lead to soil degradation and a decline in the yield and quality of crops. For example, the traditional Chinese medicine Chuanxiong has long been plagued by excessive heavy metals, affecting the yield and quality of the medicinal material. Heavy metals accumulated in the soil can be absorbed and enriched by plants and then enter animals and humans through the food chain, directly endangering the health of animals, plants and humans. For example, rice, as an important food crop, has a high enrichment characteristic for some heavy metals, especially Cd. It easily absorbs heavy metals such as Cd and accumulates them in its grains. Then, through the food chain, humans ingest large amounts of Cd, which poses a great threat to human health and safety.

[0003] Soil salinization, also known as salination, refers to the process by which salt from the subsoil or groundwater rises to the surface with capillary water and, after evaporation, accumulates in the surface soil. Saline soils are characterized by high salinity and alkalinity, or by the absorption of exchangeable sodium by soil colloids. This leads to the destruction and leaching of soil organic matter, trace element deficiencies, poor soil structure, and poor aeration and water permeability. This is manifested by the presence of white saline-alkali deposits on the soil surface. Salinized soils can cause low germination rates and wilting in plants, making it difficult for plants to absorb fertilizer nutrients, reducing plant growth, impacting yields, and causing economic losses.

[0004] Currently, there are almost no reports on the research of biological products that can protect plants from heavy metal pollution and / or salinization hazards. Therefore, reducing the absorption of heavy metals by plants, promoting the ability of plants to resist salinization, and improving the quality and safety of plants are technical issues that need to be solved urgently. Summary of the Invention

[0005] In view of this, the object of the present invention is to provide a Bacillus velezensis and its liquid inoculum, solid inoculum and application.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The invention provides a Bacillus Velez subtilis. The Bacillus Velez subtilis is Bacillus Velez subtilis TP-06-01, and the deposit number is CCTCC NO: M2025693.

[0008] The invention provides a Bacillus Velez subtilis liquid inoculum, comprising chitosan and the fermentation liquid of the Bacillus Velez subtilis.

[0009] Preferably, the mass-to-volume ratio of the chitosan to the fermentation broth of Bacillus velezensis is 1-10 g:100 mL.

[0010] Preferably, based on 1 mL of the Bacillus Velez liquid inoculum, the effective viable count of the fermentation broth of the Bacillus Velez is 1×10 8 CFU or above.

[0011] The present invention provides a method for preparing the above-mentioned Bacillus Velez liquid inoculum, comprising the following steps:

[0012] Fermenting and culturing the Bacillus Velez subtilis to obtain a fermentation liquid of the Bacillus Velez subtilis;

[0013] The fermentation liquid of the Bacillus Velez subtilis is mixed with chitosan to obtain a liquid inoculum of the Bacillus Velez subtilis.

[0014] Preferably, the fermentation temperature is 25-40°C and the fermentation time is 70-74 hours;

[0015] The fermentation medium, calculated per liter, comprises the following raw materials: 5-10 g rice flour, 5-10 g peptone, 1-5 g yeast extract, 5-10 g sodium chloride, and 2.5-5.0 g tea saponin; the pH of the fermentation medium is 6.7-7.3;

[0016] The chitosan is chitosan powder, and the preparation method of the chitosan powder comprises uniformly spraying a chitosan solution onto modified cellulose, granulating, and drying to obtain the chitosan powder;

[0017] The volume mass ratio of the chitosan solution to the modified cellulose is 20 mL:90-110 g;

[0018] The preparation of the chitosan solution comprises the steps of mixing and dissolving chitosan with acetic acid solution;

[0019] The modified cellulose includes sodium carboxymethyl cellulose.

[0020] The present invention provides a solid Bacillus Velez solid inoculum, comprising a carrier and a liquid Bacillus Velez solid inoculum; the liquid Bacillus Velez solid inoculum is the liquid Bacillus Velez solid inoculum or the liquid Bacillus Velez solid inoculum prepared by the above-mentioned liquid Bacillus Velez solid inoculum or the preparation method;

[0021] The carrier includes one or more of kaolin, diatomaceous earth, light calcium, talc, and bentonite;

[0022] The mass ratio of the carrier to the liquid inoculum of Bacillus velezii is 100:(2-5).

[0023] The present invention provides a method for preparing a solid inoculum of Bacillus velezensis, comprising the following steps:

[0024] The carrier is mixed with the liquid Bacillus Velez subtilis agent to obtain a solid Bacillus Velez subtilis agent.

[0025] The present invention provides an application of the above-mentioned Bacillus Velez, Bacillus Velez liquid inoculum or preparation method in at least one of the following a to f:

[0026] a. Promote plant resistance to heavy metal and / or salinization stress;

[0027] b. Preparation of products that promote plant resistance to heavy metal and / or salinization stress;

[0028] c. Improve plant nutrients and / or nutritional components;

[0029] d. Preparation of products for improving plant nutrients and / or nutritional components;

[0030] e. Promote plant growth under heavy metal pollution;

[0031] f. Promote plant growth under salinization conditions.

[0032] Preferably, the heavy metals include one or more of cadmium, lead, chromium, arsenic and mercury; the plant nutrient elements include one or more of calcium, selenium, iron and zinc; and the nutrient component is protein;

[0033] e, wherein the growth trait includes yield;

[0034] In f, the growth traits include germination rate and / or plant height.

[0035] Compared with the prior art, the present invention has the following beneficial effects:

[0036] The present invention provides a Bacillus Velez subtilis, a liquid inoculant, a solid inoculant, and uses thereof. The liquid or solid inoculant obtained using Bacillus Velez subtilis can help plants resist the damage caused by heavy metals and / or salinization, and can also increase the amount of plant nutrients and / or nutritional components. Furthermore, the liquid or solid inoculant can promote plant growth under heavy metal contamination or salinization conditions.

[0037] Biodeposit Information:

[0038] The name of the Bacillus velezensis of the present invention is Bacillus velezensis TP-06-01, Bacillus velezensis TP-06-01, which was deposited in the China Center for Type Culture Collection on April 3, 2025, with the deposit address being Wuhan University, Wuhan, China, and the deposit number being CCTCC NO: M2025693. DETAILED DESCRIPTION

[0039] The invention provides a Bacillus Velez subtilis. The Bacillus Velez subtilis is Bacillus Velez subtilis TP-06-01, and the deposit number is CCTCC NO: M2025693.

[0040] The invention provides a Bacillus Velez subtilis liquid inoculum, comprising chitosan and the fermentation liquid of the Bacillus Velez subtilis.

[0041] In the present invention, the liquid inoculum of Bacillus Velez is composed of chitosan and the fermentation broth of the above-mentioned Bacillus Velez. The mass ratio of the chitosan to the fermentation broth of Bacillus Velez is preferably 5 to 10:100. Based on 1 mL of the liquid inoculum of Bacillus Velez, the effective viable cell count of the fermentation broth of Bacillus Velez is 1×10 8CFU or more. The fermentation broth is obtained by fermentation culture of the above-mentioned Bacillus Velez. The fermentation temperature is 25-40°C, more preferably 30-35°C, more preferably 30°C; the fermentation time is preferably 70-74h, more preferably 71-73h, more preferably 72h. The culture medium for the fermentation culture comprises the following raw materials per 1L: 5-10g rice flour, 5-10g peptone, 1-5g yeast extract, 5-10g sodium chloride and 2.5-5.0g tea saponin; the pH of the culture medium is 6.7-7.3. As a preferred embodiment, the culture medium for the fermentation culture, per 1L, consists of the following raw materials: 5-10g rice flour, 5-10g peptone, 1-5g yeast extract, 5-10g sodium chloride, 2.5-5.0g tea saponin and 1000mL. The fermentation culture medium is a sterilized medium. The present invention does not specifically limit the sterilization method of the medium, and any method known in the art can be used, such as sterilization at 121° C. for 20 to 30 minutes. The pH of the medium is preferably 6.8 to 7.2, more preferably 7.0.

[0042] The present invention provides a method for preparing the above-mentioned Bacillus Velez liquid inoculum, comprising the following steps:

[0043] Fermenting and culturing the Bacillus Velez subtilis to obtain a fermentation liquid of the Bacillus Velez subtilis;

[0044] The fermentation liquid of the Bacillus Velez subtilis is mixed with chitosan to obtain a liquid inoculum of the Bacillus Velez subtilis.

[0045] In the present invention, the Bacillus Velez subtilis is fermented to obtain a fermentation broth of Bacillus Velez subtilis. The Bacillus Velez subtilis is a seed culture broth obtained after activation and expansion culture. As a preferred method, the preparation method of the seed culture broth comprises the following steps: activating the Bacillus Velez subtilis in LB solid medium at 25-40°C for 24-48 hours, inoculating the activated Bacillus Velez subtilis into LB liquid medium and culturing it at 25-40°C for 24-48 hours, and further culturing the obtained Bacillus Velez subtilis culture broth in LB liquid medium at 25-40°C for 70-74 hours to obtain a seed culture broth. In the present invention, the fermentation temperature is preferably 25-40°C, more preferably 30-35°C, and more preferably 30°C; the fermentation time is preferably 70-74 hours, more preferably 71-73 hours, and more preferably 72 hours. During the fermentation culture, the inoculum size is 1-3%, which refers to the volume ratio of the seed culture broth to the fermentation medium. The sources of LB solid culture medium and LB liquid culture medium in the art are not particularly limited, and they can be prepared using methods known in the art or purchased from commercial products.

[0046] In the present invention, after obtaining the fermentation broth of Bacillus velez, the fermentation broth of Bacillus velez is mixed with chitosan to obtain a liquid inoculum of Bacillus velez. The volume-to-mass ratio of the fermentation broth of Bacillus velez to chitosan is preferably 100 mL: (1-10) g, more preferably 100 mL: (1-5) g, such as 100 mL: 1 g, 100 mL: 3 g, 100 mL: 5 g or 100 mL: 4 g. The present invention does not particularly limit the mixing method, and mixing can be performed using methods known in the art, such as stirring. The fermentation culture medium, per liter, includes the following raw materials: 5-10 g rice flour, 5-10 g peptone, 1-5 g yeast extract, 5-10 g sodium chloride and 2.5-5.0 g tea saponin; the pH of the culture medium is preferably 6.7-7.3, more preferably 6.8-7.2, and more preferably 7.0. As a preferred embodiment, the fermentation medium, per liter, is composed of the following raw materials: 5-10g rice flour, 5-10g peptone, 1-5g yeast extract, 5-10g sodium chloride, 2.5-5.0g tea saponin, and 1000mL. The fermentation medium is prepared by mixing the raw materials in the above amounts and sterilizing at 121°C for 20-30 minutes.

[0047] The chitosan is chitosan powder, and the preparation method of the chitosan powder includes uniformly spraying a chitosan solution onto modified cellulose, granulating, and drying to obtain chitosan powder; the volume mass ratio of the chitosan solution to the modified cellulose is 20mL:90-110g, more preferably 20mL:95-105g, and more preferably 20mL:100g. The preparation of the chitosan solution includes the steps of mixing and dissolving chitosan with an acetic acid solution; the mass volume ratio of the chitosan to the acetic acid solution is 10g:170-210mL, more preferably 10g:180-200mL, and more preferably 10g:200mL; the mass volume concentration of the acetic acid solution is preferably 2%-4%, more preferably 2.5%-3.5%, such as 3%, and the solvent of the acetic acid solution is water. The modified cellulose includes sodium carboxymethyl cellulose. The present invention has no special limitation on the sources of chitosan and sodium carboxymethyl cellulose, and they can be obtained by selecting commercially available products in the art or preparing them by known methods.

[0048] The present invention provides a solid Bacillus Velez solid inoculum, comprising a carrier and a liquid Bacillus Velez solid inoculum; the liquid Bacillus Velez solid inoculum is the liquid Bacillus Velez solid inoculum or the liquid Bacillus Velez solid inoculum prepared by the above-mentioned liquid Bacillus Velez solid inoculum or the preparation method;

[0049] The carrier includes one or more of kaolin, diatomaceous earth, light calcium, talc, and bentonite;

[0050] The mass ratio of the carrier to the liquid inoculum of Bacillus velezii is 100:(2-5).

[0051] The present invention provides a method for preparing a solid inoculum of Bacillus velezensis, comprising the following steps:

[0052] The carrier is mixed with the liquid Bacillus Velez subtilis agent to obtain a solid Bacillus Velez subtilis agent.

[0053] The present invention has found that the use of a liquid inoculant of Bacillus velezensis can help plants resist the hazards of heavy metals and / or salinization, promote plant growth, and improve plant quality and safety.

[0054] The present invention provides an application of the above-mentioned Bacillus Velez, Bacillus Velez liquid inoculum or preparation method in at least one of the following a to f:

[0055] a. Promote plant resistance to heavy metal and / or salinization stress;

[0056] b. Preparation of products that promote plant resistance to heavy metal and / or salinization stress;

[0057] c. Improve plant nutrients and / or nutritional components;

[0058] d. Preparation of products for improving plant nutrients and / or nutritional components;

[0059] e. Promote plant growth under heavy metal pollution;

[0060] f. Promote plant growth under salinization conditions.

[0061] In the present invention, the plant includes one or more of rice, Chuanxiong and corn. The heavy metal includes one or more of cadmium, lead, chromium, arsenic and mercury; the plant nutrient element includes one or more of calcium, selenium, iron and zinc; and the nutrient component is protein.

[0062] e, wherein the growth trait includes yield, the plant includes one or more of rice, Chuanxiong and corn, and further, the plant is rice;

[0063] In f, the growth traits include germination rate and / or plant height, the plant includes one or more of rice, Chuanxiong and corn, and further, the plant is corn.

[0064] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0065] In the following examples, the TP medium consists of 7 g rice flour, 8 g peptone, 3 g yeast extract, 8 g sodium chloride, 4 g tea saponin, and 1000 mL water, and the pH is adjusted to 7.0.

[0066] The chitosan was purchased from Sigmaaldrich Company with the product number C3646, also known as deacetyl chitin.

[0067] Example 1

[0068] Screening and validation of a strain of Bacillus velezinoffii:

[0069] The Bacillus velezensis of this embodiment is Bacillus velezensis TP-06-01 (referred to as Bacillus velezensis TP-06-01), with a deposit number of CCTCCNO: M2025693.

[0070] The Bacillus velezensis TP-06-01 of this example is rod-shaped, Gram-positive, and has a size of 0.6-0.8 μm x 2.0-3.5 μm. The spores are centrally or terminally borne, with a non-inflated sporangium and a columnar shape.

[0071] On nutrient broth culture medium, the colonies are dark in color, with a slightly raised surface, and the surface of old colonies is dry and wrinkled.

[0072] Positive reaction: catalase; oxidase; starch hydrolysis; lactose fermentation to produce acid.

[0073] Negative reactions: anaerobic growth; lecithinase; propionate utilization.

[0074] 16SrDNA and gyrB gene sequence analysis: Genomic DNA was extracted from the bacteria, amplified using primers, and the PCR products were sequenced.

[0075] The sequences were proofread and spliced, and then compared with the sequences of related species in the GenBank database by BLAST. The results showed that the 16SrDNA sequence and gyrB gene sequence of the strain were 99% identical to those of Bacillus velezensis.

[0076] The 16S rDNA sequence of the strain:

[0077]

[0078] The gyrB gene sequence of this strain is:

[0079] cgtctgatgacactttatgatacgcgctttttcaagattaaaatcttctccgatccctgttccgagggccgtgatcattgatctgacctcattgtttgagagaatcttatcaagtctggctttctcaacgttcagaatcttaccgcgcagcggcagaatggcttggaaatgacggtcccgtccctgtttcgctgatccgcccgcagagtcaccctctacgatatacagctcggaaatgctcggatctttagaagaacagtccgccagtttgcccggcagattggaaatctcaagcgcacttttgcgccgggtcaattcccgggcttttttcgccgccatccgcgctcttgcggccattaaacctttttcaacgattttgcgggctgagtccggattttcaagaaggaatgtttccagcgcagaagaaaacagcgtatcagtgatcgttctcgcttcggagttgccgagcttggttttcgtctgcccttcgaattgcggatcagggtgcttaattgaaataatggcagtcagcccttctctcacatcatccccgcttaaattcggatcattttctttgaaaatcccttttcttcttgcatagtcgtttatgacacgggtcagaccggttttaaatccggcctcgtgcgtgccgccttcgtatgtgttgatattatttgtgaaagaataaatattgcttgtatagctgtcgttgtattgcaatgcaacttcaaccgttatgccgtctttctcgccttcgatataaatcggctcttcatgaacgacttctttggaacggtttaagtactcaacatagcttttgattccgccttcgtagtggtactcgtttttccgttcttgtccttcacgtttgtcttcaatcgtgatgtttacgccttctgtcaggaaggccaattctccggacacggtttgaaagcagatcatagtcattatacgg(SEQ ID NO.2).

[0080] Example 2

[0081] Preparation of chitosan powder:

[0082] 10.0 g of chitosan was added to 200 mL of 3% acetic acid solution under stirring to dissolve and obtain chitosan solution. 200 mL of chitosan solution was evenly sprayed into 1000 g of sodium carboxymethyl cellulose, and the mixture was boiled and granulated to obtain chitosan powder.

[0083] The 3% acetic acid solution was prepared by uniformly mixing 3 g of glacial acetic acid with 97 mL of distilled water.

[0084] The mass fraction of chitosan in the powder was measured to be 9.5%.

[0085] Example 3

[0086] A method for preparing a liquid inoculum of Bacillus velez for inducing plants to resist the hazards of heavy metals and salinization comprises the following steps:

[0087] (1) The Bacillus velez TP-06-01 described in Example 1 was cultured in LB solid medium at 30°C for 36 h, and then a single colony of Bacillus velez TP-06-01 was picked and inoculated into 100 mL of LB liquid medium, and cultured at 30°C for 36 h to obtain a Bacillus velez culture solution. The Bacillus velez culture solution was inoculated into a 10 L seed tank containing LB liquid medium at an inoculum size of 1%, and cultured at 30°C for 72 h to obtain a seed culture solution;

[0088] The seed culture solution was inoculated into 100 LTP medium at an inoculum rate of 3% for fermentation, and cultured in the TP medium at 30° C. for 72 hours to obtain Bacillus velezensis fermentation solution.

[0089] 100 mL of the Bacillus velezensis fermentation broth was mixed with 3 g of the chitosan powder described in Example 2 to obtain a Bacillus velezensis liquid inoculum.

[0090] The effective live bacteria content of the Bacillus Velez liquid inoculum was 6.5×10 8 CFU / mL, the mass fraction of chitosan in 100mL of Bacillus Velez liquid inoculum is 0.25g.

[0091] Example 4

[0092] A method for preparing a liquid inoculum of Bacillus velez for inducing plants to resist the hazards of heavy metals and salinization comprises the following steps:

[0093] (1) The Bacillus velez TP-06-01 described in Example 1 was cultured in LB solid medium at 30°C for 36 h, and then a single colony of Bacillus velez TP-06-01 was picked and inoculated into 100 mL of LB liquid medium, and cultured at 30°C for 36 h to obtain a Bacillus velez culture solution. The Bacillus velez culture solution was inoculated into a 10 L seed tank containing LB liquid medium at an inoculum size of 1%, and cultured at 30°C for 72 h to obtain a seed culture solution;

[0094] The seed culture solution was inoculated into 100 LTP medium at an inoculum rate of 3% for fermentation, and cultured in the TP medium at 30° C. for 72 hours to obtain Bacillus velezensis fermentation solution.

[0095] 100 mL of the Bacillus velezensis fermentation broth was mixed with 5 g of the chitosan powder described in Example 2 to obtain a Bacillus velezensis liquid inoculum.

[0096] The effective live bacterial count of the Bacillus Velez liquid inoculum was 5.3×10 8 CFU / mL, the mass fraction of chitosan in 100mL of Bacillus Velez liquid inoculum is 0.45g.

[0097] Example 5

[0098] A method for preparing a liquid inoculum of Bacillus velez for inducing plants to resist the hazards of heavy metals and salinization comprises the following steps:

[0099] (1) The Bacillus velez TP-06-01 described in Example 1 was cultured in LB solid medium at 30°C for 36 h, and then a single colony of Bacillus velez TP-06-01 was picked and inoculated into 100 mL of LB liquid medium, and cultured at 30°C for 36 h to obtain a Bacillus velez culture solution. The Bacillus velez culture solution was inoculated into a 10 L seed tank containing LB liquid medium at an inoculum size of 1%, and cultured at 30°C for 72 h to obtain a seed culture solution;

[0100] The seed culture solution was inoculated into 100 LTP medium at an inoculum volume of 10% for fermentation and cultured in the TP medium at 30° C. for 72 h to obtain Bacillus velezensis fermentation solution.

[0101] 100 mL of the Bacillus velezensis fermentation broth was mixed with 10 g of the chitosan powder described in Example 2 to obtain a Bacillus velezensis liquid inoculum.

[0102] The effective live bacteria content of the Bacillus Velez liquid inoculum was 9.7×10 8CFU / mL, the mass fraction of chitosan in 100mL of Bacillus Velez liquid inoculum is 0.91g.

[0103] Example 6

[0104] A method for preparing a solid inoculum of Bacillus velez for inducing plants to resist the hazards of heavy metals and salinization comprises the following steps:

[0105] 100 mL of the Bacillus Velez liquid inoculum prepared in Example 5 was mixed with 1000 g of a carrier and granulated to prepare a solid preparation, wherein the carrier was one of kaolin, diatomaceous earth, light calcium, talc or bentonite.

[0106] The effective live bacteria content of the solid inoculum of Bacillus Velez was 5.1×10 7 CFU / g, the mass fraction of chitosan in 1000g of Bacillus Velez solid inoculum is 0.078g.

[0107] Test Example 1

[0108] This experimental example provides a field application effect experiment of a liquid inoculant of Bacillus Velezii for reducing the heavy metal content in Chuanxiong.

[0109] (1) Experimental location: Pengzhou, Chengdu, Sichuan Province.

[0110] (2) Crop: Chuanxiong.

[0111] (3) Preparation of the agent: The liquid inoculum of Bacillus velezensis prepared in Example 4 was mixed with water at a volume ratio of 1:100 or 1:300 to prepare a 100-fold diluted agent or a 300-fold diluted agent, respectively.

[0112] (4) Experimental design:

[0113] A Chuanxiong experimental field contaminated with heavy metals of mercury, cadmium, lead, chromium, and arsenic (named Chuanxiong experimental field 1) and another Chuanxiong experimental field contaminated with heavy metals of mercury, cadmium, chromium, and arsenic (named Chuanxiong experimental field 2) were selected. The treatment groups were randomly divided into four groups. The groups and treatments were as follows:

[0114] Control group 1: In the Chuanxiong experimental field 1, clean water was sprayed on Chuanxiong 4 times starting from the seedling stage, with an interval of 20 days, and the spraying amount each time was 45L / mu.

[0115] Low concentration agent group: In the Chuanxiong experimental field 1, the agent diluted 300 times was sprayed on the Chuanxiong 4 times starting from the seedling stage, with an interval of 20 days and a spraying amount of 45L / mu each time.

[0116] Control group 2: In the Chuanxiong experimental field 2, clean water was sprayed on Chuanxiong 4 times starting from the seedling stage, with an interval of 20 days, and the spraying amount each time was 45L / mu.

[0117] High concentration agent group: In the Chuanxiong experimental field 2, the agent diluted 100 times was sprayed on the Chuanxiong 4 times starting from the seedling stage, with an interval of 20 days and a spraying amount of 45L / mu each time.

[0118] Among them, the methods of sowing, transplanting, fertilizing, watering, weeding, and pest and disease control of Chuanxiong are based on local Chuanxiong planting habits.

[0119] After harvesting, the contents of heavy metals such as mercury, cadmium, lead, chromium, and arsenic in the Ligusticum chuanxiong plants of each group were tested.

[0120] Chromium content was determined using Method 9304 of the Guiding Principles of the Pharmacopoeia of the People's Republic of China (2020 Edition, Volume IV). Mercury, cadmium, lead, and arsenic were determined using Method 2 of General Chapter 2321 of the Pharmacopoeia of the People's Republic of China (2020 Edition, Volume IV). The limit of quantification for mercury testing was 0.003 mg / kg. The results are shown in Tables 1 and 2. The following data are the average values ​​of heavy metal concentrations measured in 10 strains of Chuanxiong.

[0121] The calculation formula for the reduction rate of each heavy metal is = (heavy metal content of the control group - heavy metal content of the drug-treated group) ÷ heavy metal content of the control group × 100%.

[0122] Table 1 Results of heavy metal content determination in Ligusticum chuanxiong plants after treatment with low concentration pesticides

[0123]

[0124] Table 2 Results of heavy metal content determination in Ligusticum chuanxiong plants after treatment with high concentration of pesticides

[0125]

[0126] The results in Table 1 show that, compared with the control group 1, in the Chuanxiong experimental field 1, after the Chuanxiong was sprayed with the Bacillus Velez liquid inoculant of the present invention, the contents of cadmium, chromium, arsenic, mercury and lead in the Chuanxiong were significantly reduced.

[0127] The results in Table 2 show that, compared with the control group 2, in the Chuanxiong experimental field 2, after the Chuanxiong was sprayed with the Bacillus Velez liquid inoculant of the present invention, the cadmium, chromium, arsenic and lead contents in the Chuanxiong were significantly reduced.

[0128] At the same time, real-time fluorescence quantitative PCR (qRT-PCR) was used to detect the expression levels of cadmium ion absorption and transport-related genes LcNRAMP and LcZIP in each Chuanxiong in the control group 2 and the high-concentration drug group. The results are shown in Table 3. Table 3 Analysis of the cadmium ion absorption and transport-related genes LcNRAMP and LcZIP in Chuanxiong showed that the transcription levels of LcNRAMP and LcZIP in the control group Chuanxiong were significantly higher than those in the drug-treated group. After drug treatment, the activity levels of genes related to cadmium ion absorption and transport in Chuanxiong were downregulated, which helps to reduce cadmium absorption.

[0129] Table 3 Results of related gene activity detection in Ligusticum chuanxiong plants after treatment with high concentration of pesticides

[0130]

[0131] Note: Compared with control group 2, different lowercase letters after the data indicate significant differences, and different uppercase letters after the data indicate extremely significant differences.

[0132] The results of Table 1, Table 2 and Table 3 show that the high-concentration agent group prepared by the liquid inoculum of Bacillus Velez-Pinus of the present invention reduces the heavy metal (such as cadmium, chromium, arsenic and lead content) in Chuanxiong more significantly than the low-concentration agent group. The gradient effect further proves the effectiveness of the inoculum of the present invention. Furthermore, the liquid inoculum of Bacillus Velez-Pinus treatment can down-regulate the expression of cadmium ion-related absorption and transport genes in Chuanxiong, further proving the effect of the inoculum of the present invention on reducing cadmium pollution.

[0133] Test Example 2

[0134] This test example provides a field application effect experiment of a liquid inoculant of Bacillus velezensis for reducing the heavy metal content in rice.

[0135] (1) Crop: Rice.

[0136] (2) Agent: The liquid agent of Bacillus velezensis prepared in Example 2 was added.

[0137] (3) Experimental design:

[0138] A rice experimental field contaminated with heavy metal cadmium (named Rice Experimental Field 1) was selected in Meishan, Sichuan Province, and a rice experimental field contaminated with heavy metals chromium, arsenic, cadmium, mercury, and lead (named Rice Experimental Field 2) was selected in Kaijiang, Dazhou, Sichuan Province. The treatment groups were randomly divided into four groups. The groups and treatments were as follows:

[0139] Control group a: In rice experimental field 1, the rice was sprayed with clean water once by drone after transplanting, in the greening stage, in the heading stage, and in the flowering and filling stage, with a spraying amount of 1L / mu each time.

[0140] Agent Group 1: In the rice experimental field 1, the Bacillus Velez liquid inoculum prepared in Example 4 was sprayed on the rice by drone after transplanting, in the greening stage, in the heading stage, and in the flowering and grain filling stage, respectively. The spraying amount was 1 L / mu each time.

[0141] Control group b: In rice experimental field 2, the rice was sprayed with clean water once by drone after transplanting, in the greening stage, in the heading stage, and in the flowering and filling stage, with a spraying amount of 1L / mu each time.

[0142] Agent Group 2: In the rice experimental field 2, the liquid inoculum of Bacillus velezensis prepared in Example 4 was sprayed on the rice by drone after transplanting, in the greening stage, in the heading stage, and in the flowering and grain filling stage, respectively. The spraying amount was 1 L / mu each time.

[0143] Among them, the methods of rice sowing, transplanting, fertilizing, watering, weeding, and pest and disease control are based on local rice planting practices.

[0144] After rice harvest, the experiment in Rice Experimental Field 1 was conducted to test the levels of heavy metals such as mercury, cadmium, lead, chromium, and arsenic in rice grains, as well as the levels of calcium and selenium in rice plants in each group.

[0145] After rice harvest, the experiment in Rice Experimental Field 2 was conducted to test the levels of heavy metals mercury, cadmium, lead, chromium and arsenic in rice grains, as well as the levels of calcium, selenium, protein, iron and zinc in rice plants in each group.

[0146] Lead content is tested using Method 2 of GB 5009.12-2017. Cadmium content is tested using GB 5009.15-2014. Chromium content is tested using GB 5009.123-2014. Total mercury content is tested using Method 1 of Part 1 of GB 5009.17-2021. Inorganic arsenic content is tested using Method 1 of Part 2 of GB 5009.11-2014. Protein content (g / 100g) is tested using Method 1 of GB 5009.5-2016. Calcium (calculated as Ca) content is tested using Method 2 of GB 5009.268-2016. Iron (calculated as Fe) content is tested using Method 1 of GB 5009.268-2016. Zinc (calculated as Zn) content is tested using Method 1 of GB 5009.268-2016. Selenium (measured as Se) was tested using Method 1 of GB 5009.268-2016. The limit of quantification for mercury testing was 0.003 mg / kg. The results are shown in Tables 4 and 5. The following data are the average values ​​of heavy metal concentrations measured in 10 rice plants.

[0147] Table 4 Results of heavy metal tests on rice and calcium and selenium content in rice plants by different groups

[0148] Test items Drug Group 1 Control group a Rate of change (%) Cadmium (mg / kg) 0.0023 0.0104 77.88 Selenium (mg / kg) 0.038 0.032 18.75 Calcium (mg / kg) 132 95.7 37.93

[0149] The results in Table 4 show that, compared with control group a, treatment with the Bacillus Velez liquid inoculum of the present invention significantly reduced the cadmium content in rice grains by 77.88%. Compared with control group a, treatment with the Bacillus Velez liquid inoculum of the present invention significantly increased the selenium and calcium contents in rice plants by 18.75% and 37.93%, respectively.

[0150] Table 5 Results of the determination of heavy metals in rice and the contents of calcium, selenium, protein, iron and zinc in rice plants by different groups

[0151]

[0152]

[0153] The results in Table 5 show that, compared with control group b, treatment with the Bacillus Velez liquid inoculum of the present invention significantly reduced the contents of cadmium, chromium, arsenic, mercury, and lead in rice, with reduction rates of 35.19%, 49.04%, 42.11%, and 72.04% for cadmium, chromium, arsenic, and lead, respectively. Compared with control group a, treatment with the Bacillus Velez liquid inoculum of the present invention significantly increased the contents of calcium, selenium, protein, iron, and zinc in rice plants, with increase rates of 11.64%, 229.24%, 9.73%, 62.96%, and 139.86%, respectively.

[0154] At the same time, after the rice was harvested, the per-acre yield of the experiment in the rice experimental field 1 was tested. The results are shown in Table 6. The per-acre yield result of each group is the average value after three parallel tests.

[0155] Table 6 Rice yield per mu after treatment in different groups

[0156] Drug group 1 (kg / mu) Control group a (kg / mu) Increased yield per mu (kg / mu) 954.21 883.11 71.10

[0157] The results in Table 6 show that the treatment with the liquid inoculum of Bacillus Velezii of the present invention increased the per-acre yield of rice and promoted the growth of rice.

[0158] Test Example 3

[0159] This test example provides an experiment on the application effect of Bacillus Velez liquid inoculant on improving corn seed germination rate and plant height under salinization conditions.

[0160] (1) Chemical treatment:

[0161] In the control group, 100 corn seeds were soaked in clean water for 5 hours, and then sown into the matrix soil at a rate of 10 seeds per pot. The seeds were irrigated with 300 mol NaCl solution twice a week to maintain the matrix humidity at about 70%.

[0162] Chemical treatment group: 100 corn seeds were soaked in the Bacillus Velez liquid inoculum prepared in Example 4 diluted with 300 times the volume of water for 5 hours. Ten seeds were sown in the substrate soil per pot and irrigated with 300 mol NaCl solution twice a week, maintaining the substrate humidity at about 70%.

[0163] According to the randomized block design, 10 pots were placed in each of the control group and the drug treatment group, with each pot as a replicate. They were randomly placed in the greenhouse test platform at a temperature of 25-30℃. After 3 weeks, the germination rate was counted and the plant height was measured.

[0164] Germination rate = the number of corn germinated 3 weeks after sowing ÷ the total number of corn seeds × 100%.

[0165] The results showed that under salinization conditions, the corn germination rate in the control group was 65% and the plant height was 5.5 cm. In contrast, the corn germination rate in the agent-treated group was 91% and the plant height was 13 cm. This indicates that treatment with the Bacillus Velez liquid inoculant of the present invention improves corn's ability to resist salinization.

[0166] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A Bacillus Velezii, characterized in that The Bacillus Velez is Bacillus Velez TP-06-01, and its deposit number is CCTCCNO: M2025693.

2. A liquid inoculum of Bacillus Velez, characterized in that: The invention comprises chitosan and the fermentation broth of the Bacillus Velez subtilis according to claim 1.

3. The liquid inoculum of Bacillus Velezii according to claim 2, characterized in that The mass volume ratio of the chitosan and the fermentation liquid of Bacillus velezensis is 1-10 g:100 mL.

4. The liquid inoculum of Bacillus Velezii according to claim 3, characterized in that The effective viable cell count of the fermentation broth of Bacillus velez in the liquid inoculum of Bacillus velez is 1×10 8 CFU / mL or above.

5. The method for preparing the liquid inoculum of Bacillus Velezii according to any one of claims 2 to 4, characterized in that: The following steps are involved: Fermenting and culturing the Bacillus Velez subtilis to obtain a fermentation liquid of the Bacillus Velez subtilis; The fermentation liquid of the Bacillus Velez subtilis is mixed with chitosan to obtain a liquid inoculum of the Bacillus Velez subtilis.

6. The preparation method according to claim 5, characterized in that The fermentation culture temperature is 25-40°C and the time is 70-74 hours; The fermentation medium, calculated per liter, comprises the following raw materials: 5-10 g rice flour, 5-10 g peptone, 1-5 g yeast extract, 5-10 g sodium chloride, and 2.5-5.0 g tea saponin; the pH of the fermentation medium is 6.7-7.3; The chitosan is chitosan powder, and the preparation method of the chitosan powder comprises uniformly spraying a chitosan solution onto modified cellulose, granulating, and drying to obtain the chitosan powder; The volume mass ratio of the chitosan solution to the modified cellulose is 20 mL:90-110 g; The preparation of the chitosan solution comprises the steps of mixing and dissolving chitosan with acetic acid solution; The modified cellulose includes sodium carboxymethyl cellulose.

7. A solid inoculum of Bacillus Velez, characterized in that: It comprises a carrier and a liquid inoculum of Bacillus Velez; the liquid inoculum of Bacillus Velez is the liquid inoculum of Bacillus Velez according to any one of claims 2 to 4 or the liquid inoculum of Bacillus Velez prepared by the preparation method according to claim 5 or 6; The carrier includes one or more of kaolin, diatomaceous earth, light calcium, talc, and bentonite; The mass ratio of the carrier to the liquid inoculum of Bacillus velezii is 100:(2-5).

8. A method for preparing a solid inoculum of Bacillus Velez, characterized in that: The following steps are involved: The carrier is mixed with the liquid Bacillus Velez subtilis agent to obtain a solid Bacillus Velez subtilis agent.

9. Use of the Bacillus Velez subtilis according to claim 1, the liquid inoculum of Bacillus Velez subtilis according to any one of claims 2 to 4, the preparation method according to claim 5 or 6, or the preparation method according to claim 7 or 8 in at least one of the following a to f: a. Promote plant resistance to heavy metal and / or salinization stress; b. Preparation of products that promote plant resistance to heavy metal and / or salinization stress; c. Improve plant nutrients and / or nutritional components; d. Preparation of products for improving plant nutrients and / or nutritional components; e. Promote plant growth under heavy metal pollution; f. Promote plant growth under salinization conditions.

10. The use according to claim 9, characterized in that: The heavy metals include one or more of cadmium, lead, chromium, arsenic and mercury; the plant nutrient elements include one or more of calcium, selenium, iron and zinc; and the nutrient component is protein; e, wherein the growth trait includes yield; In f, the growth traits include germination rate and / or plant height.

Citation Information

Cited By

  • Compound microorganism, fungicide and application of fungicide in improvement of cadmium-polluted acidified soil

    CN121538102A